Search Results

Search found 25727 results on 1030 pages for 'solution'.

Page 975/1030 | < Previous Page | 971 972 973 974 975 976 977 978 979 980 981 982  | Next Page >

  • Making Global Struct in C++ Program

    - by mosg
    Hello world! I am trying to make global structure, which will be seen from any part of the source code. I need it for my big Qt project, where some global variables needed. Here it is: 3 files (global.h, dialog.h & main.cpp). For compilation I use Visual Studio (Visual C++). global.h #ifndef GLOBAL_H_ #define GLOBAL_H_ typedef struct TNumber { int g_nNumber; } TNum; TNum Num; #endif dialog.h #ifndef DIALOG_H_ #define DIALOG_H_ #include <iostream> #include "global.h" using namespace std; class ClassB { public: ClassB() {}; void showNumber() { Num.g_nNumber = 82; cout << "[ClassB][Change Number]: " << Num.g_nNumber << endl; } }; #endif and main.cpp #include <iostream> #include "global.h" #include "dialog.h" using namespace std; class ClassA { public: ClassA() { cout << "Hello from class A!\n"; }; void showNumber() { cout << "[ClassA]: " << Num.g_nNumber << endl; } }; int main(int argc, char **argv) { ClassA ca; ClassB cb; ca.showNumber(); cb.showNumber(); ca.showNumber(); cout << "Exit.\n"; return 0; } When I`m trying to build this little application, compilation works fine, but the linker gives me back an error: 1>dialog.obj : error LNK2005: "struct TNumber Num" (?Num@@3UTNumber@@A) already defined in main.obj Is there exists any solution? Thanks.

    Read the article

  • ReadFile doesn't work asynchronously on Win7 and Win2k8

    - by f0b0s
    According to MSDN ReadFile can read data 2 different ways: synchronously and asynchronously. I need the second one. The folowing code demonstrates usage with OVERLAPPED struct: #include <windows.h> #include <stdio.h> #include <time.h> void Read() { HANDLE hFile = CreateFileA("c:\\1.avi", GENERIC_READ, 0, NULL, OPEN_EXISTING, FILE_FLAG_OVERLAPPED, NULL); if ( hFile == INVALID_HANDLE_VALUE ) { printf("Failed to open the file\n"); return; } int dataSize = 256 * 1024 * 1024; char* data = (char*)malloc(dataSize); memset(data, 0xFF, dataSize); OVERLAPPED overlapped; memset(&overlapped, 0, sizeof(overlapped)); printf("reading: %d\n", time(NULL)); BOOL result = ReadFile(hFile, data, dataSize, NULL, &overlapped); printf("sent: %d\n", time(NULL)); DWORD bytesRead; result = GetOverlappedResult(hFile, &overlapped, &bytesRead, TRUE); // wait until completion - returns immediately printf("done: %d\n", time(NULL)); CloseHandle(hFile); } int main() { Read(); } On Windows XP output is: reading: 1296651896 sent: 1296651896 done: 1296651899 It means that ReadFile didn't block and returned imediatly at the same second, whereas reading process continued for 3 seconds. It is normal async reading. But on windows 7 and windows 2008 I get following results: reading: 1296661205 sent: 1296661209 done: 1296661209. It is a behavior of sync reading. MSDN says that async ReadFile sometimes can behave as sync (when the file is compressed or encrypted for example). But the return value in this situation should be TRUE and GetLastError() == NO_ERROR. On Windows 7 I get FALSE and GetLastError() == ERROR_IO_PENDING. So WinApi tells me that it is an async call, but when I look at the test I see that it is not! I'm not the only one who found this "bug": read the comment on ReadFile MSDN page. So what's the solution? Does anybody know? It is been 14 months after Denis found this strange behavior.

    Read the article

  • what to do with a flawed C++ skills test

    - by Mike Landis
    In the following gcc.gnu.org post, Nathan Myers says that a C++ skills test at SANS Consulting Services contained three errors in nine questions: Looking around, one of fthe first on-line C++ skills tests I ran across was: http://www.geekinterview.com/question_details/13090 I looked at question 1... find(int x,int y) { return ((x<y)?0:(x-y)):} call find(a,find(a,b)) use to find (a) maximum of a,b (b) minimum of a,b (c) positive difference of a,b (d) sum of a,b ... immediately wondering why would anyone write anything so obtuse. Getting past the absurdity, I didn't really like any of the answers, immediately eliminating (a) and (b) because you can get back zero (which is neither a nor b) in a variety of circumstances. Sum or difference seemed more likely, except that you could also get zero regardless of the magnitudes of a and b. So... I put Matlab to work (code below) and found: when either a or b is negative you get zero; when b a you get a; otherwise you get b, so the answer is (b) min(a,b), if a and b are positive, though strictly speaking the answer should be none of the above because there are no range restrictions on either variable. That forces test takers into a dilemma - choose the best available answer and be wrong in 3 of 4 quadrants, or don't answer, leaving the door open to the conclusion that the grader thinks you couldn't figure it out. The solution for test givers is to fix the test, but in the interim, what's the right course of action for test takers? Complain about the questions? function z = findfunc(x,y) for i=1:length(x) if x(i) < y(i) z(i) = 0; else z(i) = x(i) - y(i); end end end function [b,d1,z] = plotstuff() k = 50; a = [-k:1:k]; b = (2*k+1) * rand(length(a),1) - k; d1 = findfunc(a,b); z = findfunc(a,d1); plot( a, b, 'r.', a, d1, 'g-', a, z, 'b-'); end

    Read the article

  • IE CSS bug: table border showing div with visibility: hidden, position: absolute

    - by Alessandro Vernet
    The issue I have a <div> on a page which is initially hidden with a visibility: hidden; position: absolute. The issue is that if a <div> hidden this way contains a table which uses border-collapse: collapse and has a border set on it cells, that border still shows "through" the hidden <div> on IE. Try this for yourself by running the code below on IE6 or IE7. You should get a white page, but instead you will see: Possible workaround Since this is happening on IE and not on other browsers, I assume that this is an IE bug. One workaround is to add the following code which will override the border: .hide table tr td { border: none; } I am wondering: Is this a known IE bug? Is there a more elegant solution/workaround? The code <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <style type="text/css"> /* Style for tables */ .table tr td { border: 1px solid gray; } .table { border-collapse: collapse; } /* Class used to hide a section */ .hide { visibility: hidden; position: absolute; } </style> </head> <body> <div class="hide"> <table class="table"> <tr> <td>Gaga</td> </tr> </table> </div> </body> </html>

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • How to resize the UIView when CGAffineTransformIdentity

    - by Gowtham
    I am doing an app which has a feature to rotate and re size a view. i have implemented this feature but i do face an issue. My problem The View wil be resized when dragging its four corners, after resizing it i can rotate the view in both directions. Once the rotation is done, if i try again to resize the view by dragging its corner, the view's size gone to unpredictable value and its moving all around the screen. I googled lot finally i got the following solution The frame property is undefined when transform != CGAffineTransformIdentity, as per the docs on UIView I saw one app which has implemented the feature exactly what i wish to implement. How can i resize the UIView after rotation of UIView My code for resize the view Touches Began - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event{ UITouch *touch = [[event allTouches] anyObject]; NSLog(@"[touch view]:::%@",[touch view]); touchStart = [[touches anyObject] locationInView:testVw]; isResizingLR = (testVw.bounds.size.width - touchStart.x < kResizeThumbSize && testVw.bounds.size.height - touchStart.y < kResizeThumbSize); isResizingUL = (touchStart.x <kResizeThumbSize && touchStart.y <kResizeThumbSize); isResizingUR = (testVw.bounds.size.width-touchStart.x < kResizeThumbSize && touchStart.y<kResizeThumbSize); isResizingLL = (touchStart.x <kResizeThumbSize && testVw.bounds.size.height -touchStart.y <kResizeThumbSize); } Touches Moved - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event{ CGPoint touchPoint = [[touches anyObject] locationInView:testVw]; CGPoint previous=[[touches anyObject]previousLocationInView:testVw]; float deltaWidth = touchPoint.x-previous.x; float deltaHeight = touchPoint.y-previous.y; NSLog(@"CVTM:%@",NSStringFromCGRect(testVw.frame)); if (isResizingLR) { testVw.frame = CGRectMake(testVw.frame.origin.x, testVw.frame.origin.y,touchPoint.x + deltaWidth, touchPoint.y + deltaWidth); } if (isResizingUL) { testVw.frame = CGRectMake(testVw.frame.origin.x + deltaWidth, testVw.frame.origin.y + deltaHeight, testVw.frame.size.width - deltaWidth, testVw.frame.size.height - deltaHeight); } if (isResizingUR) { testVw.frame = CGRectMake(testVw.frame.origin.x ,testVw.frame.origin.y + deltaHeight, testVw.frame.size.width + deltaWidth, testVw.frame.size.height - deltaHeight); } if (isResizingLL) { testVw.frame = CGRectMake(testVw.frame.origin.x + deltaWidth ,testVw.frame.origin.y , testVw.frame.size.width - deltaWidth, testVw.frame.size.height + deltaHeight); } if (!isResizingUL && !isResizingLR && !isResizingUR && !isResizingLL) { testVw.center = CGPointMake(testVw.center.x + touchPoint.x - touchStart.x,testVw.center.y + touchPoint.y - touchStart.y); } }

    Read the article

  • How can I send multiple types of objects across Protobuf?

    - by cyclotis04
    I'm implementing a client-server application, and am looking into various ways to serialize and transmit data. I began working with Xml Serializers, which worked rather well, but generate data slowly, and make large objects, especially when they need to be sent over the net. So I started looking into Protobuf, and protobuf-net. My problem lies in the fact that protobuf doesn't sent type information with it. With Xml Serializers, I was able to build a wrapper which would send and receive any various (serializable) object over the same stream, since object serialized into Xml contain the type name of the object. ObjectSocket socket = new ObjectSocket(); socket.AddTypeHandler(typeof(string)); // Tells the socket the types socket.AddTypeHandler(typeof(int)); // of objects we will want socket.AddTypeHandler(typeof(bool)); // to send and receive. socket.AddTypeHandler(typeof(Person)); // When it gets data, it looks for socket.AddTypeHandler(typeof(Address)); // these types in the Xml, then uses // the appropriate serializer. socket.Connect(_host, _port); socket.Send(new Person() { ... }); socket.Send(new Address() { ... }); ... Object o = socket.Read(); Type oType = o.GetType(); if (oType == typeof(Person)) HandlePerson(o as Person); else if (oType == typeof(Address)) HandleAddress(o as Address); ... I've considered a few solutions to this, including creating a master "state" type class, which is the only type of object sent over my socket. This moves away from the functionality I've worked out with Xml Serializers, though, so I'd like to avoid that direction. The second option would be to wrap protobuf objects in some type of wrapper, which defines the type of object. (This wrapper would also include information such as packet ID, and destination.) It seems silly to use protobuf-net to serialize an object, then stick that stream between Xml tags, but I've considered it. Is there an easy way to get this functionality out of protobuf or protobuf-net? I've come up with a third solution, and posted it below, but if you have a better one, please post it too!

    Read the article

  • java double buffering problem

    - by russell
    Whats wrong with my applet code which does not render double buffering correctly.I am trying and trying.But failed to get a solution.Plz Plz someone tell me whats wrong with my code. import java.applet.* ; import java.awt.* ; import java.awt.event.* ; public class Ball extends Applet implements Runnable { // Initialisierung der Variablen int x_pos = 10; // x - Position des Balles int y_pos = 100; // y - Position des Balles int radius = 20; // Radius des Balles Image buffer=null; //Graphics graphic=null; int w,h; public void init() { Dimension d=getSize(); w=d.width; h=d.height; buffer=createImage(w,h); //graphic=buffer.getGraphics(); setBackground (Color.black); } public void start () { // Schaffen eines neuen Threads, in dem das Spiel l?uft Thread th = new Thread (this); // Starten des Threads th.start (); } public void stop() { } public void destroy() { } public void run () { // Erniedrigen der ThreadPriority um zeichnen zu erleichtern Thread.currentThread().setPriority(Thread.MIN_PRIORITY); // Solange true ist l?uft der Thread weiter while (true) { // Ver?ndern der x- Koordinate repaint(); x_pos++; y_pos++; //x2--; //y2--; // Neuzeichnen des Applets if(x_pos>410) x_pos=20; if(y_pos>410) y_pos=20; try { Thread.sleep (30); } catch (InterruptedException ex) { // do nothing } Thread.currentThread().setPriority(Thread.MAX_PRIORITY); } } public void paint (Graphics g) { Graphics screen=null; screen=g; g=buffer.getGraphics(); g.setColor(Color.red); g.fillOval(x_pos - radius, y_pos - radius, 2 * radius, 2 * radius); g.setColor(Color.green); screen.drawImage(buffer,0,0,this); } public void update(Graphics g) { paint(g); } } what change should i make.When offscreen image is drawn the previous image also remain in screen.How to erase the previous image from the screen??

    Read the article

  • Hide jQuery Accordion while loading

    - by zac
    I am testing a site build with a slow connection and I noticed the jQuery Accordion stays expanded for a long time, until the rest of the site is loaded, and then finally collapses. Not very pretty. I was wondering how I could keep it collapsed through the loading process and only expand when clicked. I am working with the standalone 1.6 version of the accordion plugin. The basic structure : <div class="sidebar"> <ul id="navigation" class="ui-accordion-container"> <li><a class="head" href="#">1</a> <ul class="sub"> <li><a href="#">1a</a></li> <li><a href="#">2a</a></li> </ul> </li> </ul> </div> and the script jQuery().ready(function(){ jQuery('#navigation').accordion({ active: 'false', header: '.head', navigation: true, animated: 'easeslide', collapsible: true }); }); I tried to hide the elements in the CSS to keep them from appearing while loading but all that achieved is in having them always hidden. Maybe the problem is in the CSS I have a background image in each of the sub menus: #navigation{ margin:0px; margin-left: 10px; padding:0px; text-indent:0px; font-size: 1.1em; width:200px; text-transform: uppercase; padding-bottom: 30px; } #navigation ul{ border-width:0px; margin:0px; padding:0px; text-indent:0px; } #navigation li{ list-style:none outside none; } #navigation li ul{ height:185px; overflow:auto; } #navigation li ul.sub{ background:url('../images/sub.jpg') no-repeat; dispaly: block; } #navigation li li a{ color:#000000; display:block; text-indent:20px; text-decoration: none; padding: 6px 0; } #navigation li li a:hover{ background-color:#FFFF99; color:#FF0000; } Thanks in advance for any advice on how to have this thing run a little smoother and having the accordion always collapsed. -edit - I forgot to mention that I am also hoping for a solution that will allow the nav to still be accessible for those without javscript.

    Read the article

  • Memory allocation and release for UIImage in iPhone?

    - by rkbang
    Hello all, I am using following code in iPhone to get smaller cropped image as follows: - (UIImage*) getSmallImage:(UIImage*) img { CGSize size = img.size; CGFloat ratio = 0; if (size.width < size.height) { ratio = 36 / size.width; } else { ratio = 36 / size.height; } CGRect rect = CGRectMake(0.0, 0.0, ratio * size.width, ratio * size.height); UIGraphicsBeginImageContext(rect.size); [img drawInRect:rect]; UIImage *tempImg = [UIGraphicsGetImageFromCurrentImageContext() retain]; UIGraphicsEndImageContext(); return [tempImg autorelease]; } - (UIImage*)imageByCropping:(UIImage *)imageToCrop toRect:(CGRect)rect { //create a context to do our clipping in UIGraphicsBeginImageContext(rect.size); CGContextRef currentContext = UIGraphicsGetCurrentContext(); //create a rect with the size we want to crop the image to //the X and Y here are zero so we start at the beginning of our //newly created context CGFloat X = (imageToCrop.size.width - rect.size.width)/2; CGFloat Y = (imageToCrop.size.height - rect.size.height)/2; CGRect clippedRect = CGRectMake(X, Y, rect.size.width, rect.size.height); //CGContextClipToRect( currentContext, clippedRect); //create a rect equivalent to the full size of the image //offset the rect by the X and Y we want to start the crop //from in order to cut off anything before them CGRect drawRect = CGRectMake(0, 0, imageToCrop.size.width, imageToCrop.size.height); CGContextTranslateCTM(currentContext, 0.0, drawRect.size.height); CGContextScaleCTM(currentContext, 1.0, -1.0); //draw the image to our clipped context using our offset rect //CGContextDrawImage(currentContext, drawRect, imageToCrop.CGImage); CGImageRef tmp = CGImageCreateWithImageInRect(imageToCrop.CGImage, clippedRect); //pull the image from our cropped context UIImage *cropped = [UIImage imageWithCGImage:tmp];//UIGraphicsGetImageFromCurrentImageContext(); CGImageRelease(tmp); //pop the context to get back to the default UIGraphicsEndImageContext(); //Note: this is autoreleased*/ return cropped; } I am using following line of code in cellForRowAtIndexPath to update the image of the cell: cell.img.image = [self imageByCropping:[self getSmallImage:[UIImage imageNamed:@"goal_image.png"]] toRect:CGRectMake(0, 0, 36, 36)]; Now when I add this table view and pop it from navigation controller, I see a memory hike.I see no leaks but memory keeps climbing. Please note that the images changes for each row and I am creating the controller using lazy initialization that is I create or alloc it whenever I need it. I saw on internet many people facing the same issue, but very rare good solutions. I have multiple views using the same way and I see almost memory raised to 4MB within 20-25 view transitions. What is the good solution to resolve this issue. tnx.

    Read the article

  • ASP.NET MVC 2: Linq to SQL entity w/ ForeignKey relationship and Default ModelBinder strangeness

    - by Simon
    Once again I'm having trouble with Linq to Sql and the MVC Model Binder. I have Linq to Sql generated classes, to illustrate them they look similar to this: public class Client { public int ClientID { get; set; } public string Name { get; set; } } public class Site { public int SiteID { get; set; } public string Name { get; set; } } public class User { public int UserID { get; set; } public string Name { get; set; } public int? ClientID { get; set; } public EntityRef<Client> Client { get; set; } public int? SiteID { get; set; } public EntityRef<Site> Site { get; set; } } The 'User' has a relationship with the 'Client' and 'Site . The User class has nullable ClientIDs and SiteIDs because the admin users are not bound to a Client or Site. Now I have a view where a user can edit a 'User' object, the view has fields for all the 'User' properties. When the form is submitted, the appropiate 'Save' action is called in my UserController: public ActionResult Save(User user, FormCollection form) { //form['SiteID'] == 1 //user.SiteID == 1 //form['ClientID'] == 1 //user.ClientID == null } The problem here is that the ClientID is never set, it is always null, even though the value is in the FormCollection. To figure out whats going wrong I set breakpoints for the ClientID and SiteID getters and setters in the Linq to Sql designer generated classes. I noticed the following: SiteID is being set, then ClientID is being set, but then the Client EntityRef property is being set with a null value which in turn is setting the ClientID to null too! I don't know why and what is trying to set the Client property, because the Site property setter is never beeing called, only the Client setter is being called. Manually setting the ClientID from the FormCollection like this: user.ClientID = int.Parse(form["ClientID"].ToString()); throws a 'ForeignKeyReferenceAlreadyHasValueException', because it was already set to null before. The only workaround I have found is to extend the generated partial User class with a custom method: Client = default(EntityRef<Client>) but this is not a satisfying solution. I don't think it should work like this? Please enlighten me someone. So far Linq to Sql is driving me crazy! Best regards

    Read the article

  • PHP 5.3: Late static binding doesn't work for properties when defined in parent class while missing in child class

    - by DavidPesta
    Take a look at this example, and notice the outputs indicated. <?php class Mommy { protected static $_data = "Mommy Data"; public static function init( $data ) { static::$_data = $data; } public static function showData() { echo static::$_data . "<br>"; } } class Brother extends Mommy { } class Sister extends Mommy { } Brother::init( "Brother Data" ); Sister::init( "Sister Data" ); Brother::showData(); // Outputs: Sister Data Sister::showData(); // Outputs: Sister Data ?> My understanding was that using the static keyword would refer to the child class, but apparently it magically applies to the parent class whenever it is missing from the child class. (This is kind of a dangerous behavior for PHP, more on that explained below.) I have the following two things in mind for why I want to do this: I don't want the redundancy of defining all of the properties in all of the child classes. I want properties to be defined as defaults in the parent class and I want the child class definition to be able to override these properties wherever needed. The child class needs to exclude properties whenever the defaults are intended, which is why I don't define the properties in the child classes in the above example. However, if we are wanting to override a property at runtime (via the init method), it will override it for the parent class! From that point forward, child classes initialized earlier (as in the case of Brother) unexpectedly change on you. Apparently this is a result of child classes not having their own copy of the static property whenever it isn't explicitly defined inside of the child class--but instead of throwing an error it switches behavior of static to access the parent. Therefore, is there some way that the parent class could dynamically create a property that belongs to the child class without it appearing inside of the child class definition? That way the child class could have its own copy of the static property and the static keyword can refer to it properly, and it can be written to take into account parent property defaults. Or is there some other solution, good, bad, or ugly?

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • OpenGL ES functions not accepting values originating outside of it's view

    - by Josh Elsasser
    I've been unable to figure this out on my own. I currently have an Open GLES setup where a view controller both updates a game world (with a dt), fetches the data I need to render, passes it off to an EAGLView through two structures (built of Apple's ES1Renderer), and draws the scene. Whenever a value originates outside of the Open GL view, it can't be used to either translate objects using glTranslatef, or set up the scene using glOrthof. If I assign a new value to something, it will work - even if it is the exact same number. The two structures I have each contain a variety of floating-point numbers and booleans, along with two arrays. I can log the values from within my renderer - they make it there - but I receive errors from OpenGL if I try to do anything with them. No crashes result, but the glOrthof call doesn't work if I don't set the camera values to anything different. Code used to set up scene: [EAGLContext setCurrentContext:context]; glBindFramebufferOES(GL_FRAMEBUFFER_OES, viewFramebuffer); //clears the color buffer bit glClear(GL_COLOR_BUFFER_BIT); glMatrixMode(GL_PROJECTION); //sets up the scene w/ ortho projection glViewport(0, 0, 320, 480); glLoadIdentity(); glOrthof(320, 0, dynamicData.cam_x2, dynamicData.cam_x1, 1.0, -1.0); glClearColor(1.0, 1.0, 1.0, 1.0); /*error checking code here*/ "dynamicData" (which is replaced every frame) is created within my game simulation. From within my controller, I call a method (w/in my simulation) that returns it, and pass the result on to the EAGLView, which passes it on to the renderer. I haven't been able to come up with a better solution for this - suggestions in this regard would be greatly appreciated as well. Also, this function doesn't work as well (values originate in the same place): glTranslatef(dynamicData.ship_x, dynamicData.ship_y, 0.0); Thanks in advance. Additional Definitions: Structure (declared in a separate header): typedef struct { float ship_x, ship_y; float cam_x1, cam_x2; } dynamicRenderData; Render data getter (and builder) (every frame) - (dynamicData)getDynRenderData { //d_rd is an ivar, zeroed on initialization d_rd.ship_x = mainShip.position.x; d_rd.ship_y = mainShip.position.y; d_rd.cam_x1 = d_rd.ship_x - 30.0f; d_rd.cam_x2 = d_rd.cam_x1 + 480.0f; return d_rd; } Zeroed at start. (d_rd.ship_x = 0;, etc…) Setting up the view. Prototype (GLView): - (void)draw: (dynamicRenderData)dynamicData Prototype (Renderer): - (void)drawView: (dynamicRenderData)dynamicData How it's called w/in the controller: //controller [glview draw: [world getDynRenderData]]; //glview (within draw) [renderer drawView: dynamicData];

    Read the article

  • Schema to support dynamic properties

    - by Johan Fredrik Varen
    Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

    Read the article

  • Best practices for displaying large number of images as thumbnails in c#

    - by andySF
    I got to a point where it's very difficult to get answers by debugging and tracing object, so i need some help. What I'm trying to do: A history form for my screen capture pet project. The history must list all images as thumbnails (ex: picasa). What I've done: I created a HistoryItem:UserControl. This history item has a few buttons, a check box, a label and a picture box. The buttons are for delete/edit/copy image. The check box is used for selecting one or more images and the label is for some info text. The picture box is getting the image from a public property that is a path and a method creates a proportional thumbnail to display it when the control has been loaded. This user control has two public events. One for deleting the image and one for bubbling the events for mouse enter and mouse leave trough all controls. For this I use EventBroadcastProvider. The bubbling is useful because wherever I move the mouse over the control, the buttons appear. The dispose method has been extended and I manually remove the events. All images are loaded by looping a xml file that contains the path of all images. For each image in this XML I create a new HitoryItem that is added (after a little coding to sort and limit the amount of images loaded) to a flow layout panel. The problem: When I lunch the history form, and the flow layout panel is populated with my HistoryItem custom control, my memory usage increases drastically.From 14Mb to around 100MB with 100 images loaded. By closing the history form and disposing whatever I could dispose and even trying to call GC.Collect() the memory increase remain. I search for any object that could not be disposed properly like an image or event but wherever I used them they are disposed. The problem seams to be from multiple sources. One is that the events for bubbling are not disposing properly, and the other is from the picture box itself. All of this i could see by commenting all the code to a limited version when only the custom control without any image processing and even events is loaded. Without the events the memory consumption is reduced by axiomatically 20%. So my real question is if this logic, flow layout panels and custom controls with picture boxes, is the best solution for displaying large amounts of images as thumbnails. Thank you!

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • Rails populate edit form for non-column attributes

    - by Rabbott
    I have the following form: <% form_for(@account, :url => admin_accounts_path) do |f| %> <%= f.error_messages %> <%= render :partial => 'form', :locals => {:f => f} %> <h2>Account Details</h2> <% f.fields_for :customer do |customer_fields| %> <p> <%= customer_fields.label :company %><br /> <%= customer_fields.text_field :company %> </p> <p> <%= customer_fields.label :first_name %><br /> <%= customer_fields.text_field :first_name %> </p> <p> <%= customer_fields.label :last_name %><br /> <%= customer_fields.text_field :last_name %> </p> <p> <%= customer_fields.label :phone %><br /> <%= customer_fields.text_field :phone %> </p> <% end %> <p> <%= f.submit 'Create' %> </p> <% end %> As well as attr_accessor :customer And I have a before_create method for the account model which does not store the customer_fields, but instead uses them to submit data to an API.. The only thing I store are in the form partial.. The problem I'm running into is that when a validation error gets thrown, the page renders the new action (expected) but none of the non-column attributes within the Account Detail form will show? Any ideas as to how I can change this code around a bit to make this work me?? This same solution may be the help I need for the edit form, I have a getter for the data which it asks the API for, but without place a :value = "asdf" within each text box, it doesn't populate the fields either..

    Read the article

  • ActionResult - Service

    - by cem
    I bored, writing same code for service and ui. Then i tried to write a converter for simple actions. This converter, converting Service Results to MVC result, seems like good solution for me but anyway i think this gonna opposite MVC pattern. So here, I need help, what you think about algorithm - is this good or not? Thanks ServiceResult - Base: public abstract class ServiceResult { public static NoPermissionResult Permission() { return new NoPermissionResult(); } public static SuccessResult Success() { return new SuccessResult(); } public static SuccessResult<T> Success<T>(T result) { return new SuccessResult<T>(result); } protected ServiceResult(ServiceResultType serviceResultType) { _resultType = serviceResultType; } private readonly ServiceResultType _resultType; public ServiceResultType ResultType { get { return _resultType; } } } public class SuccessResult<T> : ServiceResult { public SuccessResult(T result) : base(ServiceResultType.Success) { _result = result; } private readonly T _result; public T Result { get { return _result; } } } public class SuccessResult : SuccessResult<object> { public SuccessResult() : this(null) { } public SuccessResult(object o) : base(o) { } } Service - eg. ForumService: public ServiceResult Delete(IVUser user, int id) { Forum forum = Repository.GetDelete(id); if (!Permission.CanDelete(user, forum)) { return ServiceResult.Permission(); } Repository.Delete(forum); return ServiceResult.Success(); } Controller: public class BaseController { public ActionResult GetResult(ServiceResult result) { switch (result.ResultType) { case ServiceResultType.Success: var successResult = (SuccessResult)result; return View(successResult.Result); break; case ServiceResultType.NoPermission: return View("Error"); break; default: return View(); break; } } } [HandleError] public class ForumsController : BaseController { [ValidateAntiForgeryToken] [Transaction] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Delete(int id) { ServiceResult result = ForumService.Delete(WebUser.Current, id); /* Custom result */ if (result.ResultType == ServiceResultType.Success) { TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "The forum was successfully deleted."; return this.RedirectToAction(ec => Index()); } /* Custom result */ /* Execute Permission result etc. */ TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "A problem was encountered preventing the forum from being deleted. " + "Another item likely depends on this forum."; return GetResult(result); } }

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

< Previous Page | 971 972 973 974 975 976 977 978 979 980 981 982  | Next Page >