Search Results

Search found 70655 results on 2827 pages for 'python time'.

Page 131/2827 | < Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >

  • Python grab class in class definition.

    - by epochwolf
    I don't even know how to explain this, so here is the code I'm trying. class Test: type = self.__name__ #self doesn't work, how do I get a reference to Test? class Test2(Test): pass #Test2.type should return "Test2" The reason I'm even trying this is I'm working on creating a base class for an orm I'm using. I want to avoid defining the table name for every model I have. Also knowing what the limits of python is will help me avoid wasting time trying impossible things.

    Read the article

  • Random List of millions of elements in Python Efficiently

    - by eWizardII
    Hello, I have read this answer potentially as the best way to randomize a list of strings in Python. I'm just wondering then if that's the most efficient way to do it because I have a list of about 30 million elements via the following code: import json from sets import Set from random import shuffle a = [] for i in range(0,193): json_data = open("C:/Twitter/user/user_" + str(i) + ".json") data = json.load(json_data) for j in range(0,len(data)): a.append(data[j]['su']) new = list(Set(a)) print "Cleaned length is: " + str(len(new)) ## Take Cleaned List and Randomize it for Analysis shuffle(new) If there is a more efficient way to do it, I'd greatly appreciate any advice on how to do it. Thanks,

    Read the article

  • Time Complexities of recursive algorithms

    - by Peter
    Whenever I see a recursive solution, or I write recursive code for a problem, it is really difficult for me to figure out the time complexity, in most of the cases I just say its exponential? How is it exponential actually? How people say it is 2^n, when it is n!, when it is n^n or n^k. I have some questions in mind, let say find all permutations of a string (O(n!)) find all sequences which sum up to k in an array (exponential, how exactly do I calculate). Find all subsets of size k whose sum is 0 (will k come somewhere in complexity , it should come right?). Can any1 help me how to calculate the exact complexity of such questions, I am able to wrote code for them , but its hard understanding the exact time complexity.

    Read the article

  • Google Application Engine slow in case of Python...

    - by Aftershock
    hi, I am reading a "table" in Python in GAE that has 1000 rows and the program stops because the time limit is reached. (So it takes at least 20 seconds.)( Is that possible that GAE is that slow? Is there a way to fix that? Is this because I use free service and I do not pay for it? Thank you. The code itself is this: for u in userall: # userall has 1000 users for stockname in stocknamesall: # 4 stocks astock= stocksowned() astock.quantity = random.randint(1,100) astock.nameid = u.key() astock.stockid = stockname.key() liststocks.append(astock);

    Read the article

  • how to send data to server using python

    - by Apache
    hi experts, how data can be send to the server, for example i retrieve MAC address, so i want send to the server ( i.e 211.21.24.43:8080/data?mac=00-0C-F1-56-98-AD i found snippet from internet as below from urllib2 import Request, urlopen from binascii import b2a_base64 def b64open(url, postdata): req = Request(url, b2a_base64(postdata), headers={'Content-Transfer-Encoding': 'base64'}) return urlopen(req) conn = b64open("http://211.21.24.43:8080/data","mac=00-0C-F1-56-98-AD") but when run, File "send2.py", line 8 SyntaxError: Non-ASCII character '\xc3' in file send2.py on line 8, but no encoding declared; see http://www.python.org/peps/pep-0263.html for details can anyone help me how send data to the server thanks in advance

    Read the article

  • float change from python 3.0.1 to 3.1.2

    - by Jeremy
    Im trying to learn python. I am using 3.1.2 and the o'reilly book is using 3.0.1 here is my code import urllib.request price = (99.99) while price 4.74: page = urllib.request.urlopen ("http://www.beans-r-us.biz/prices-loyalty.html") text = page.read().decode("utf8") where = text.find('>$') start_of_price = where + 2 end_of_price = start_of_price + 6 price = float(text[start_of_price:end_of_price]) print ("Buy!") - here is my error Traceback (most recent call last): File "/Users/odin/Desktop/Coffe.py", line 14, in price = float(text[start_of_price:end_of_price]) ValueError: invalid literal for float(): 4.59 what is wrong? please help!!

    Read the article

  • Python Parse CSV Correctly

    - by cornerstone
    I am very new to Python. I want to parse a csv file such that it will recognize quoted values - For example 1997,Ford,E350,"Super, luxurious truck" should be split as ('1997', 'Ford', 'E350', 'Super, luxurious truck') and NOT ('1997', 'Ford', 'E350', '"Super', ' luxurious truck"') the above is what I get if I use something like str.split(). How do I do this? Also would it be best to store these values in an array or some other data structure? because after I get these values from the csv I want to be able to easily choose, lets say any two of the columns and store it as another array or some other data structure. Thanks in advance.

    Read the article

  • Python .app doesn't read .txt file like it should

    - by Bambo
    This question relates to this one: Python app which reads and writes into its current working directory as a .app/exe i got the path to the .txt file fine however now when i try to open it and read the contents it seems that it doesn't extract the data properly. Here's my code - http://pastie.org/4876896 These are the errors i'm getting: 30/09/2012 10:28:49.103 [0x0-0x4e04e].org.pythonmac.unspecified.main: for index, item in enumerate( lines ): # iterate through lines 30/09/2012 10:28:49.103 [0x0-0x4e04e].org.pythonmac.unspecified.main: TypeError: 'NoneType' object is not iterable I kind of understand what the errors mean however i'm not sure why they are being flagged up because if i run my script with it not in a .app form it doesn't get these errors and extracts the data fine.

    Read the article

  • Python Tkinter after loop not working fast enough

    - by user2658538
    I am making a simple metronome where it plays a tick sound every few milliseconds depending on the bpm and plays the sound using the winsound module. I use tkinter because there will be a gui component later but for now the metronome code is working, it plays the sound at a constant rate, but even though I set the after loop to play the sound every few milliseconds, it waits longer and the beat is slower than it should be. Is it a problem with the code or a problem with the way I calculate the time? Thanks. Here is my code. from Tkinter import * import winsound,time,threading root=Tk() c=Canvas(root) c.pack() class metronome(): def __init__(self,root,canvas,tempo=100): self.root=root self.root.bind("<1>",self.stop) self.c=canvas self.thread=threading.Thread(target=self.play) self.thread.daemon=True self.pause=False self.tempo=tempo/60.0 self.tempo=1.0/self.tempo self.tempo*=1000 def play(self): winsound.PlaySound("tick.wav",winsound.SND_FILENAME) self.sound=self.c.after(int(self.tempo),self.play) def stop(self,e): self.c.after_cancel(self.sound) beat=metronome(root,c,120) beat.thread.start() root.mainloop()

    Read the article

  • Python list as *args?

    - by Cap
    I have two Python functions, both of which take variable arguments in their function definitions. To give a simple example: def func1(*args): for arg in args: print arg def func2(*args): return [2 * arg for arg in args] I'd like to compose them -- as in func1(func2(3, 4, 5)) -- but I don't want args in func1 to be ([6, 7, 8],), I want it to be (6, 7, 8), as if it was called as func1(6, 7, 8) rather than func1([6, 7, 8]). Normally, I would just use func1(*func2(3, 4, 5)) or have func1 check to see if args[0] was a list. Unfortunately, I can't use the first solution in this particular instance and to apply the second would require doing such a check in many places (there are a lot of functions in the role of func1). Does anybody have an idea how to do this? I imagine some sort of introspection could be used, but I could be wrong.

    Read the article

  • Bash or python for changing spacing in files

    - by Werner
    Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

    Read the article

  • Comment out a python code block

    - by gbarry
    Is there any mechanism to comment out large blocks of Python code? Right now the only ways I can see of commenting out code are to either start every line with a #, or to enclose the code in """ (triple quotes), except that actually makes it show up in various doc tools. Edit--After reading the answers (and referring to the "duplicate"), I have concluded the correct answer is "No". One person said so, and the rest lectured us about editors. Not a bad thing, but I feel it's important to put the answer at the top.

    Read the article

  • Return numerical array in python

    - by khan
    Okay..this is kind of an interesting question. I have a php form through which user enters values for x and y like this: X: [1,3,4] Y: [2,4,5] These values are stored into database as varchars. From there, these are called by a python program which is supposed to use them as numerical (numpy) arrays. However, these are called as plain strings, which means that calculation can not be performed over them. Is there a way to convert them into numerical arrays before processing or is there something else which is wrong? Helpp!!

    Read the article

  • Loading a DB table into nested dictionaries in Python

    - by Hossein
    Hi, I have a table in MySql DB which I want to load it to a dictionary in python. the table columns is as follows: id,url,tag,tagCount tagCount is the number of times that a tag has been repeated for a certain url. So in that case I need a nested dictionary, in other words a dictionary of dictionary, to load this table. Because each url have several tags for which there are different tagCounts.the code that I used is this:( the whole table is about 22,000 records ) cursor.execute( ''' SELECT url,tag,tagCount FROM wtp ''') urlTagCount = cursor.fetchall() d = defaultdict(defaultdict) for url,tag,tagCount in urlTagCount: d[url][tag]=tagCount print d first of all I want to know if this is correct.. and if it is why it takes so much time? Is there any faster solutions? I am loading this table into memory to have fast access to get rid of the hassle of slow database operations, but with this slow speed it has become a bottleneck itself, it is even much slower than DB access. and anyone help? thanks

    Read the article

  • Running a python script in background from a CGI

    - by Cagey
    I have a python CGI which runs some script in the background and shows the stdout in the html page. I run the script when the user clicks some button in the page. My problem is when the script starts running the page becomes busy and the user can't use the other client side features in the page. What I want is: The script should run in background when the user clicks the button and should notify the CGI when run is complete. Then the CGI show should the stdout of the script run. How can this be done?

    Read the article

  • Group MySQL Data into Arbitrarily Sized Time Buckets

    - by Eric J.
    How do I count the number of records in a MySQL table based on a timestamp column per unit of time where the unit of time is arbitrary? Specifically, I want to count how many record's timestamps fell into 15 minute buckets during a given interval. I understand how to do this in buckets of 1 second, 1 minute, 1 hour, 1 day etc. using MySQL date functions, e.g. SELECT YEAR(datefield) Y, MONTH(datefield) M, DAY(datefield) D, COUNT(*) Cnt FROM mytable GROUP BY YEAR(datefield), MONTH(datefield), DAY(datefield) but how can I group by 15 minute buckets?

    Read the article

  • Python Class inherit from all submodules

    - by Dhruv Govil
    I'm currently writing a wrapper in python for a lot of custom company tools. I'm basically going to break each tool into its own py file with a class containing the call to the tool as a method. These will all be contained in a package. Then there'll be a master class that will import all from the package, then inherit from each and every class, so as to appear as one cohesive class. masterClass.py pyPackage - __ init__.py - module1.py --class Module1 ---method tool1 - module2.py --class Module2 ---method tool2 etc Right now, I'm autogenerating the master class file to inherit from the packages modules, but I was wondering if there was a more elegant way to do it? ie from package import * class MasterClass(package.all): pass

    Read the article

  • Python 2.6, 3 abstract base class misunderstanding

    - by Aaron
    I'm not seeing what I expect when I use ABCMeta and abstractmethod. This works fine in python3: from abc import ABCMeta, abstractmethod class Super(metaclass=ABCMeta): @abstractmethod def method(self): pass a = Super() TypeError: Can't instantiate abstract class Super ... And in 2.6: class Super(): __metaclass__ = ABCMeta @abstractmethod def method(self): pass a = Super() TypeError: Can't instantiate abstract class Super ... They both also work fine (I get the expected exception) if I derive Super from object, in addition to ABCMeta. They both "fail" (no exception raised) if I derive Super from list. I want an abstract base class to be a list but abstract, and concrete in sub classes. Am I doing it wrong, or should I not want this in python?

    Read the article

  • Store time of the day in SQL

    - by nute
    How would you store a time or time range in SQL? It won't be a datetime because it will just be let's say 4:30PM (not, January 3rd, 4:30pm). Those would be weekly, or daily meetings. The type of queries that I need are of course be for display, but also later will include complex queries such as avoiding conflicts in schedule. I'd rather pick the best datatype for that now. I'm using MS SQL Server Express 2005. Thanks! Nathan

    Read the article

  • Python - Using "Google AJAX Search" API's Local Search Objects

    - by user330739
    Hi! I've just started using Google's search API to find addresses and the distances between those addresses. I used geopy for this, but, I often had the problem of not getting the correct addresses for my queries. I decided to experiment, therefore, with Google's "Local Search" (http://code.google.com/apis/ajaxsearch/local.html). Anyway, I wanted to ask if I could use the "Local Search" objects provided by the API within python. Something tells me that I can't and that I have to use json. Does anyone know if there is a work around? PS: Im trying to make something like this: http://www.google.com/uds/samples/random/lead.html ... except a matrix type deal where the insides will be filled with distances between the addresses. Thanks for reading!

    Read the article

  • Capturing stdout within the same process in Python

    - by danben
    I've got a python script that calls a bunch of functions, each of which writes output to stdout. Sometimes when I run it, I'd like to send the output in an e-mail (along with a generated file). I'd like to know how I can capture the output in memory so I can use the email module to build the e-mail. My ideas so far were: use a memory-mapped file (but it seems like I have to reserve space on disk for this, and I don't know how long the output will be) bypass all this and pipe the output to sendmail (but this may be difficult if I also want to attach the file)

    Read the article

  • MD5 hash differences between Python and other file hashers

    - by Sam
    I have been doing a bit of programming in Python (still a n00b at it) and came across something odd. I made a small program to find the MD5 hash of a filename passed to it on the command line. I used a function I found here on SO. When I ran it against a file, I got a hash "58a...113". But when I ran Microsoft's FCIV or the md5sum.py in \Python26\Tools\Scripts\, I get a different hash, "591...ae6". The actual hashing part of the md5sum.py in Scripts is m = md5.new() while 1: data = fp.read(bufsize) if not data: break m.update(data) out.write('%s %s\n' % (m.hexdigest(), filename)) This looks functionally identical to the code in the function given in the other answer... What am I missing? (This is my first time posting to stackoverflow, please let me know if I am doing it wrong.)

    Read the article

  • "painting" one array onto another using python / numpy

    - by Nate
    I'm writing a library to process gaze tracking in Python, and I'm rather new to the whole numpy / scipy world. Essentially, I'm looking to take an array of (x,y) values in time and "paint" some shape onto a canvas at those coordinates. For example, the shape might be a blurred circle. The operation I have in mind is more or less identical to using the paintbrush tool in Photoshop. I've got an interative algorithm that trims my "paintbrush" to be within the bounds of my image and adds each point to an accumulator image, but it's slow(!), and it seems like there's probably a fundamentally easier way to do this. Any pointers as to where to start looking?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Problem with literal arguments in the PATTERN string for a python 2to3 fixer

    - by Zxaos
    Hi folks. I'm writing a fixer for the 2to3 tool in python. In my pattern string, I have a section where I'd like to match an empty string as an argument, or an empty unicode string. The relevant chunk of my pattern looks like: (args='""' | args='u""') My issue is the second option never matches. Even if it's alone, it won't match. However, if I simply say args=any and then output args, I can catch cases where args is exactly equal to the second option. Is there some weird unicode handling thing going on? Why won't the second literal option ever match?

    Read the article

< Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >