Search Results

Search found 17029 results on 682 pages for 'python modules'.

Page 132/682 | < Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >

  • Python, web log data mining for frequent patterns

    - by descent
    Hello! I need to develop a tool for web log data mining. Having many sequences of urls, requested in a particular user session (retrieved from web-application logs), I need to figure out the patterns of usage and groups (clusters) of users of the website. I am new to Data Mining, and now examining Google a lot. Found some useful info, i.e. querying Frequent Pattern Mining in Web Log Data seems to point to almost exactly similar studies. So my questions are: Are there any python-based tools that do what I need or at least smth similar? Can Orange toolkit be of any help? Can reading the book Programming Collective Intelligence be of any help? What to Google for, what to read, which relatively simple algorithms to use best? I am very limited in time (to around a week), so any help would be extremely precious. What I need is to point me into the right direction and the advice of how to accomplish the task in the shortest time. Thanks in advance!

    Read the article

  • Python "callable" attribute (pseudo-property)

    - by mgilson
    In python, I can alter the state of an instance by directly assigning to attributes, or by making method calls which alter the state of the attributes: foo.thing = 'baz' or: foo.thing('baz') Is there a nice way to create a class which would accept both of the above forms which scales to large numbers of attributes that behave this way? (Shortly, I'll show an example of an implementation that I don't particularly like.) If you're thinking that this is a stupid API, let me know, but perhaps a more concrete example is in order. Say I have a Document class. Document could have an attribute title. However, title may want to have some state as well (font,fontsize,justification,...), but the average user might be happy enough just setting the title to a string and being done with it ... One way to accomplish this would be to: class Title(object): def __init__(self,text,font='times',size=12): self.text = text self.font = font self.size = size def __call__(self,*text,**kwargs): if(text): self.text = text[0] for k,v in kwargs.items(): setattr(self,k,v) def __str__(self): return '<title font={font}, size={size}>{text}</title>'.format(text=self.text,size=self.size,font=self.font) class Document(object): _special_attr = set(['title']) def __setattr__(self,k,v): if k in self._special_attr and hasattr(self,k): getattr(self,k)(v) else: object.__setattr__(self,k,v) def __init__(self,text="",title=""): self.title = Title(title) self.text = text def __str__(self): return str(self.title)+'<body>'+self.text+'</body>' Now I can use this as follows: doc = Document() doc.title = "Hello World" print (str(doc)) doc.title("Goodbye World",font="Helvetica") print (str(doc)) This implementation seems a little messy though (with __special_attr). Maybe that's because this is a messed up API. I'm not sure. Is there a better way to do this? Or did I leave the beaten path a little too far on this one? I realize I could use @property for this as well, but that wouldn't scale well at all if I had more than just one attribute which is to behave this way -- I'd need to write a getter and setter for each, yuck.

    Read the article

  • python extract from switch output

    - by household2
    I have some info back from a LAN switch as below Vlan 1 is administratively down, line protocol is down Vlan 2 is up, line protocol is up Helper address is 192.168.0.2 Vlan 3 is up, line protocol is up Helper address is not set Vlan 4 is up, line protocol is up Helper address is 192.168.0.2 Vlan 5 is down, line protocol is down Helper address is 192.168.0.2 Vlan 6 is down, line protocol is down Helper address is not set Helper address is not set And the output I'm trying for is Vlan 1,admin down,n/a Vlan 2,up/up, 192.168.0.2 Vlan 3, up/up, not set Vlan 4, up/up, 192.168.0.2 Vlan 5, down/down, 192.168.0.2 Vlan 6, down/down, not set So the helper isn't always there (line 1) sometimes it's set sometimes it isn't, sometimes there are two lines (last Vlan - I only need 1) and the Vlan can have states of admin down, up/up, up/down (not here) and down down. So using Python and pexpect I can get the above output, but I'm having difficulty parsing out the consecutive lines. I've tried enumerate and then use key+1 for the next line, but the fact that there can be 0,1 or 2 lines following the Vlan screws me. Any ideas please?

    Read the article

  • xml filtering with python

    - by saminny
    Hi, I have a following xml document: <node1> <node2 a1="x1"> ... </node2> <node2 a1="x2"> ... </node2> <node2 a1="x1"> ... </node2> </node1> I want to filter out node2 when a1 = x2. The user provides the xpath and attribute values that need to tested and filtered out. I looked at some solutions in python like BeautifulSoup but they are too complicated and dont preserve the case of text. I want to keep the document same as before with some stuff filtered out. Can you recommend a simple and succinct solution? This should not be too complicated from the looks of it. The actual xml document is not as simple as above but idea is the same.

    Read the article

  • Random Loss of precision in Python ReadLine()

    - by jackyouldon
    Hi all, We have a process which takes a very large csv (1.6GB) and breaks it down into pieces (in this case 3). This runs nightly and normally doesn't give us any problems. When it ran last night, however, the first of the output files had lost precision on the numeric fields in the data. The active ingredient in the script are the lines: while lineCounter <= chunk: oOutFile.write(oInFile.readline()) lineCounter = lineCounter + 1 and the normal output might be something like StringField1; StringField2; StringField3; StringField4; 1000000; StringField5; 0.000054454 etc. On this one occasion and in this one output file the numeric fields were all output with 6 zeros at the end i.e. StringField1; StringField2; StringField3; StringField4; 1000000.000000; StringField5; 0.000000 We are using Python v2.6 (and don't want to upgrade unless we really have to) but we can't afford to lose this data. Does anyone have any idea why this might have happened? If the readline is doing some kind of implicit conversion is there a way to do a binary read, because we really just want this data to pass through untouched? It is very wierd to us that this only affected one of the output files generated by the same script, and when it was rerun the output was as expected. thanks Jack

    Read the article

  • Mixing application modules between Silverlight and ASP.NET

    - by jkohlhepp
    Background: I work in a suite of ASP.NET applications that have several different "modules". The applications all share a main menu, so they all link to one-another. The modules are the high-level areas of the application. So, for example, it might be Payments, Orders, Customers, Products, etc. And Payments and Orders are in one app and Products and Customers are in another. Some of these menu links are "deep links", for example it might be a link to a particular page within the Customers module, such as Create New Customer. The issue: We are about to start a project that will add several more modules to this suite, probably as a new .NET application. I'm thinking about doing these new modules in Silverlight (for various reasons that are not material to the question). If I were to do that, I need to make the menu look the same as the menu in ASP.NET, as the users still need to feel like they are inside one "application". My questions: How should I organize the Silverlight project(s) so that I can "deep link" from ASP.NET pages into particular modules in the Silverlight app? What is even the best idea for creating these different Silverlight "modules"? If I had something that would've been a page in ASP.NET (for example - Create Customer), should each one of those be a separate Silverlight app? Or should it be a separate User Control? Or something else? Should I reuse our shared ASP.NET menu, and deep link to different Silverlight "modules" even within the new application? Or should I reimplement the menu in Silverlight for navigation within the app? Are there menu controls for Silverlight that look similar to ASP.NET menus (with flyout submenus in this case)? Could I maybe even share a SiteMap XML file between them? Edit: After looking around a bit more, it seems like PRISM might be the answer for some of my issues. It would allow me to modularize the different chunks of Silverlight that I have. And it would allow me to define a "master page" in Silverlight where I could host the menu. Do I have this right?

    Read the article

  • How to use objetcs as modules/functors in Scala?

    - by Jeff
    Hi. I want to use object instances as modules/functors, more or less as shown below: abstract class Lattice[E] extends Set[E] { val minimum: E val maximum: E def meet(x: E, y: E): E def join(x: E, y: E): E def neg(x: E): E } class Calculus[E](val lat: Lattice[E]) { abstract class Expr case class Var(name: String) extends Expr {...} case class Val(value: E) extends Expr {...} case class Neg(e1: Expr) extends Expr {...} case class Cnj(e1: Expr, e2: Expr) extends Expr {...} case class Dsj(e1: Expr, e2: Expr) extends Expr {...} } So that I can create a different calculus instance for each lattice (the operations I will perform need the information of which are the maximum and minimum values of the lattice). I want to be able to mix expressions of the same calculus but not be allowed to mix expressions of different ones. So far, so good. I can create my calculus instances, but problem is that I can not write functions in other classes that manipulate them. For example, I am trying to create a parser to read expressions from a file and return them; I also was trying to write an random expression generator to use in my tests with ScalaCheck. Turns out that every time a function generates an Expr object I can't use it outside the function. Even if I create the Calculus instance and pass it as an argument to the function that will in turn generate the Expr objects, the return of the function is not recognized as being of the same type of the objects created outside the function. Maybe my english is not clear enough, let me try a toy example of what I would like to do (not the real ScalaCheck generator, but close enough). def genRndExpr[E](c: Calculus[E], level: Int): Calculus[E]#Expr = { if (level > MAX_LEVEL) { val select = util.Random.nextInt(2) select match { case 0 => genRndVar(c) case 1 => genRndVal(c) } } else { val select = util.Random.nextInt(3) select match { case 0 => new c.Neg(genRndExpr(c, level+1)) case 1 => new c.Dsj(genRndExpr(c, level+1), genRndExpr(c, level+1)) case 2 => new c.Cnj(genRndExpr(c, level+1), genRndExpr(c, level+1)) } } } Now, if I try to compile the above code I get lots of error: type mismatch; found : plg.mvfml.Calculus[E]#Expr required: c.Expr case 0 = new c.Neg(genRndExpr(c, level+1)) And the same happens if I try to do something like: val boolCalc = new Calculus(Bool) val e1: boolCalc.Expr = genRndExpr(boolCalc) Please note that the generator itself is not of concern, but I will need to do similar things (i.e. create and manipulate calculus instance expressions) a lot on the rest of the system. Am I doing something wrong? Is it possible to do what I want to do? Help on this matter is highly needed and appreciated. Thanks a lot in advance.

    Read the article

  • A simple Python deployment problem - a whole world of pain

    - by Evgeny
    We have several Python 2.6 applications running on Linux. Some of them are Pylons web applications, others are simply long-running processes that we run from the command line using nohup. We're also using virtualenv, both in development and in production. What is the best way to deploy these applications to a production server? In development we simply get the source tree into any directory, set up a virtualenv and run - easy enough. We could do the same in production and perhaps that really is the most practical solution, but it just feels a bit wrong to run svn update in production. We've also tried fab, but it just never works first time. For every application something else goes wrong. It strikes me that the whole process is just too hard, given that what we're trying to achieve is fundamentally very simple. Here's what we want from a deployment process. We should be able to run one simple command to deploy an updated version of an application. (If the initial deployment involves a bit of extra complexity that's fine.) When we run this command it should copy certain files, either out of a Subversion repository or out of a local working copy, to a specified "environment" on the server, which probably means a different virtualenv. We have both staging and production version of the applications on the same server, so they need to somehow be kept separate. If it installs into site-packages, that's fine too, as long as it works. We have some configuration files on the server that should be preserved (ie. not overwritten or deleted by the deployment process). Some of these applications import modules from other applications, so they need to be able to reference each other as packages somehow. This is the part we've had the most trouble with! I don't care whether it works via relative imports, site-packages or whatever, as long as it works reliably in both development and production. Ideally the deployment process should automatically install external packages that our applications depend on (eg. psycopg2). That's really it! How hard can it be?

    Read the article

  • A Python Wrapper for Shutterfly. Uploading an Image

    - by iJames
    I'm working on a Django app in which I want to order prints through Shutterfly's Open API: http://www.shutterfly.com/documentation/start.sfly So far I've been able to build the appropriate POSTs and GETs using the modules and suggested code snippets including httplib, httplib2, urllib, urllib2, mimetype, etc. But I'm stuck on the image uploading when placing an order (the ordering process is not the same process as uploading images to albums which I haven't tried.) From what I can tell, I'm supposed to basically create the multipart form data by concatenating the HTTP request body together with the binary data of the image. I take the strings: --myuniqueboundary1273149960.175.1 Content-Disposition: form-data; name="AuthenticationID" auniqueauthenticationid --myuniqueboundary1273149960.175.1 Content-Disposition: file; name="Image.Data"; filename="1_41_orig.jpg" Content-Type: image/jpeg and I put this data into it and end with the final boundary: ...\xb5|\xf88\x1dj\t@\xd9\'\x1f\xc6j\x88{\x8a\xc0\x18\x8eGaJG\x03\xe9J-\xd8\x96[\x91T\xc3\x0eTu\xf4\xaa\xa5Ty\x80\x01\x8c\x9f\xe9Z\xad\x8cg\xba# g\x18\xe2\xaa:\x829\x02\xb4["\x17Q\xe7\x801\xea?\xad7j\xfd\xa2\xdf\x81\xd2\x84D\xb6)\xa8\xcb\xc8O\\\x9a\xaf(\x1cqM\x98\x8d*\xb8\'h\xc8+\x8e:u\xaa\xf3*\x9b\x95\x05F8\xedN%\xcb\xe1B2\xa9~Tw\xedF\xc4\xfe\xe8\xfc\xa9\x983\xff\xd9... That ends up making it look like this (when I use print to debug): ... --myuniqueboundary1273149960.175.1 Content-Disposition: file; name="Image.Data"; filename="1_41_orig.jpg" Content-Type: image/jpeg ????q?ExifMM* ? ??(1?2?<??i?b?NIKON CORPORATIONNIKON D40HHQuickTime 7.62009:02:17 13:05:25Mac OS X 10.5.6%??????"?'??0220?????? ???? ? ?|_???,b???50??5 ... --myuniqueboundary1273149960.175.1-- My code for grabbing the binary data is pretty much this: filedata = open('myjpegfile.jpeg','rb').read() Which I then add to the rest of the body. I've see something like this code everywhere. I'm then using this to post the full request (with the headers too): response = urllib2.urlopen(request).read() This seems to me to be the standard way that form POSTS with files happens. Am I missing something here? At some point I might be able to make this into a library worth posting up on github, but this problem has stopped me cold in my tracks. Thanks for any insight!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Lighttpd + fastcgi + python (for django) slow on first request

    - by EagleOne
    I'm having a problem with a django website I host with lighttpd + fastcgi. It works great but it seems that the first request always takes up to 3seconds. Subsequent requests are much faster (<1s). I activated access logs in lighttpd in order to track the issue. But I'm kind of stuck. Here are logs where I 'lose' 4s (from 10:04:17 to 10:04:21): 2012-12-01 10:04:17: (mod_fastcgi.c.3636) handling it in mod_fastcgi 2012-12-01 10:04:17: (response.c.470) -- before doc_root 2012-12-01 10:04:17: (response.c.471) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.472) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.473) Path : 2012-12-01 10:04:17: (response.c.521) -- after doc_root 2012-12-01 10:04:17: (response.c.522) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.523) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.524) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:17: (response.c.541) -- logical -> physical 2012-12-01 10:04:17: (response.c.542) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.543) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.544) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:21: (response.c.128) Response-Header: HTTP/1.1 200 OK Last-Modified: Sat, 01 Dec 2012 09:04:21 GMT Expires: Sat, 01 Dec 2012 09:14:21 GMT Content-Type: text/html; charset=utf-8 Cache-Control: max-age=600 Transfer-Encoding: chunked Date: Sat, 01 Dec 2012 09:04:21 GMT Server: lighttpd/1.4.28 I guess that if there is a problem, it's whith my configuration. So here is the way I launch my django app: python manage.py runfcgi method=threaded host=127.0.0.1 port=3033 And here is my lighttpd conf: server.modules = ( "mod_access", "mod_alias", "mod_compress", "mod_redirect", "mod_rewrite", "mod_fastcgi", "mod_accesslog", ) server.document-root = "/var/www" server.upload-dirs = ( "/var/cache/lighttpd/uploads" ) server.errorlog = "/var/log/lighttpd/error.log" server.pid-file = "/var/run/lighttpd.pid" server.username = "www-data" server.groupname = "www-data" accesslog.filename = "/var/log/lighttpd/access.log" debug.log-request-header = "enable" debug.log-response-header = "enable" debug.log-file-not-found = "enable" debug.log-request-handling = "enable" debug.log-timeouts = "enable" debug.log-ssl-noise = "enable" debug.log-condition-cache-handling = "enable" debug.log-condition-handling = "enable" fastcgi.server = ( "/finderauto.fcgi" => ( "main" => ( # Use host / port instead of socket for TCP fastcgi "host" => "127.0.0.1", "port" => 3033, #"socket" => "/home/finderadmin/finderauto.sock", "check-local" => "disable", "fix-root-scriptname" => "enable", ) ), ) alias.url = ( "/media" => "/home/user/django/contrib/admin/media/", ) url.rewrite-once = ( "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/finderauto.fcgi$1", ) index-file.names = ( "index.php", "index.html", "index.htm", "default.htm", " index.lighttpd.html" ) url.access-deny = ( "~", ".inc" ) static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ## Use ipv6 if available #include_shell "/usr/share/lighttpd/use-ipv6.pl" dir-listing.encoding = "utf-8" server.dir-listing = "enable" compress.cache-dir = "/var/cache/lighttpd/compress/" compress.filetype = ( "application/x-javascript", "text/css", "text/html", "text/plain" ) include_shell "/usr/share/lighttpd/create-mime.assign.pl" include_shell "/usr/share/lighttpd/include-conf-enabled.pl" If any of you could help me finding out where I lose these 3 or 4 s. I would much appreciate. Thanks in advance!

    Read the article

  • Oauth for Google API example using Python / Django

    - by DrDee
    Hi, I am trying to get Oauth working with the Google API using Python. I have tried different oauth libraries such as oauth, oauth2 and djanog-oauth but I cannot get it to work (including the provided examples). For debugging Oauth I use Google's Oauth Playground and I have studied the API and the Oauth documentation With some libraries I am struggling with getting a right signature, with other libraries I am struggling with converting the request token to an authorized token. What would really help me if someone can show me a working example for the Google API using one of the above-mentioned libraries. EDIT: My initial question did not lead to any answers so I have added my code. There are two possible causes of this code not working: 1) Google does not authorize my request token, but not quite sure how to detect this 2) THe signature for the access token is invalid but then I would like to know which oauth parameters Google is expecting as I am able to generate a proper signature in the first phase. This is written using oauth2.py and for Django hence the HttpResponseRedirect. REQUEST_TOKEN_URL = 'https://www.google.com/accounts/OAuthGetRequestToken' AUTHORIZATION_URL = 'https://www.google.com/accounts/OAuthAuthorizeToken' ACCESS_TOKEN_URL = 'https://www.google.com/accounts/OAuthGetAccessToken' CALLBACK = 'http://localhost:8000/mappr/mappr/oauth/' #will become real server when deployed OAUTH_CONSUMER_KEY = 'anonymous' OAUTH_CONSUMER_SECRET = 'anonymous' signature_method = oauth.SignatureMethod_HMAC_SHA1() consumer = oauth.Consumer(key=OAUTH_CONSUMER_KEY, secret=OAUTH_CONSUMER_SECRET) client = oauth.Client(consumer) request_token = oauth.Token('','') #hackish way to be able to access the token in different functions, I know this is bad, but I just want it to get working in the first place :) def authorize(request): if request.GET == {}: tokens = OAuthGetRequestToken() return HttpResponseRedirect(AUTHORIZATION_URL + '?' + tokens) elif request.GET['oauth_verifier'] != '': oauth_token = request.GET['oauth_token'] oauth_verifier = request.GET['oauth_verifier'] OAuthAuthorizeToken(oauth_token) OAuthGetAccessToken(oauth_token, oauth_verifier) #I need to add a Django return object but I am still debugging other phases. def OAuthGetRequestToken(): print '*** OUTPUT OAuthGetRequestToken ***' params = { 'oauth_consumer_key': OAUTH_CONSUMER_KEY, 'oauth_nonce': oauth.generate_nonce(), 'oauth_signature_method': 'HMAC-SHA1', 'oauth_timestamp': int(time.time()), #The timestamp should be expressed in number of seconds after January 1, 1970 00:00:00 GMT. 'scope': 'https://www.google.com/analytics/feeds/', 'oauth_callback': CALLBACK, 'oauth_version': '1.0' } # Sign the request. req = oauth.Request(method="GET", url=REQUEST_TOKEN_URL, parameters=params) req.sign_request(signature_method, consumer, None) tokens =client.request(req.to_url())[1] params = ConvertURLParamstoDictionary(tokens) request_token.key = params['oauth_token'] request_token.secret = params['oauth_token_secret'] return tokens def OAuthAuthorizeToken(oauth_token): print '*** OUTPUT OAuthAuthorizeToken ***' params ={ 'oauth_token' :oauth_token, 'hd': 'default' } req = oauth.Request(method="GET", url=AUTHORIZATION_URL, parameters=params) req.sign_request(signature_method, consumer, request_token) response =client.request(req.to_url()) print response #for debugging purposes def OAuthGetAccessToken(oauth_token, oauth_verifier): print '*** OUTPUT OAuthGetAccessToken ***' params = { 'oauth_consumer_key': OAUTH_CONSUMER_KEY, 'oauth_token': oauth_token, 'oauth_verifier': oauth_verifier, 'oauth_token_secret': request_token.secret, 'oauth_signature_method': 'HMAC-SHA1', 'oauth_timestamp': int(time.time()), 'oauth_nonce': oauth.generate_nonce(), 'oauth_version': '1.0', } req = oauth.Request(method="GET", url=ACCESS_TOKEN_URL, parameters=params) req.sign_request(signature_method, consumer, request_token) response =client.request(req.to_url()) print response return req def ConvertURLParamstoDictionary(tokens): params = {} tokens = tokens.split('&') for token in tokens: token = token.split('=') params[token[0]] = token[1] return params

    Read the article

  • Python Memory leak - Solved, but still puzzled

    - by disappearedng
    Dear everyone, I have successfully debugged my own memory leak problems. However, I have noticed some very strange occurence. for fid, fv in freqDic.iteritems(): outf.write(fid+"\t") #ID for i, term in enumerate(domain): #Vector tfidf = self.tf(term, fv) * self.idf( term, docFreqDic) if i == len(domain) - 1: outf.write("%f\n" % tfidf) else: outf.write("%f\t" % tfidf) outf.flush() print "Memory increased by", int(self.memory_mon.usage()) - startMemory outf.close() def tf(self, term, freqVector): total = freqVector[TOTAL] if total == 0: return 0 if term not in freqVector: ## When you don't have these lines memory leaks occurs return 0 ## return float(freqVector[term]) / freqVector[TOTAL] def idf(self, term, docFrequencyPerTerm): if term not in docFrequencyPerTerm: return 0 return math.log( float(docFrequencyPerTerm[TOTAL])/docFrequencyPerTerm[term]) Basically let me describe my problem: 1) I am doing tfidf calculations 2) I traced that the source of memory leaks is coming from defaultdict. 3) I am using the memory_mon from http://stackoverflow.com/questions/276052/how-to-get-current-cpu-and-ram-usage-in-python 4) The reason for my memory leaks is as follows: a) in self.tf, if the lines: if term not in freqVector: return 0 are not added that will cause the memory leak. (I verified this myself using memory_mon and noticed a sharp increase in memory that kept on increasing) The solution to my problem was 1) since fv is a defaultdict, any reference to it that are not found in fv will create an entry. Over a very large domain, this will cause memory leaks. I decided to use dict instead of default dict and the memory problem did go away. My only puzzle is: since fv is created in "for fid, fv in freqDic.iteritems():" shouldn't fv be destroyed at the end of every for loop? I tried putting gc.collect() at the end of the for loop but gc was not able to collect everything (returns 0). Yes, the hypothesis is right, but the memory should stay fairly consistent with ever for loop if for loops do destroy all temp variables. This is what it looks like with that two line in self.tf: Memory increased by 12 Memory increased by 948 Memory increased by 28 Memory increased by 36 Memory increased by 36 Memory increased by 32 Memory increased by 28 Memory increased by 32 Memory increased by 32 Memory increased by 32 Memory increased by 40 Memory increased by 32 Memory increased by 32 Memory increased by 28 and without the the two line: Memory increased by 1652 Memory increased by 3576 Memory increased by 4220 Memory increased by 5760 Memory increased by 7296 Memory increased by 8840 Memory increased by 10456 Memory increased by 12824 Memory increased by 13460 Memory increased by 15000 Memory increased by 17448 Memory increased by 18084 Memory increased by 19628 Memory increased by 22080 Memory increased by 22708 Memory increased by 24248 Memory increased by 26704 Memory increased by 27332 Memory increased by 28864 Memory increased by 30404 Memory increased by 32856 Memory increased by 33552 Memory increased by 35024 Memory increased by 36564 Memory increased by 39016 Memory increased by 39924 Memory increased by 42104 Memory increased by 42724 Memory increased by 44268 Memory increased by 46720 Memory increased by 47352 Memory increased by 48952 Memory increased by 50428 Memory increased by 51964 Memory increased by 53508 Memory increased by 55960 Memory increased by 56584 Memory increased by 58404 Memory increased by 59668 Memory increased by 61208 Memory increased by 62744 Memory increased by 64400 I look forward to your answer

    Read the article

  • How much customization can you do with djangoforms.ModelForm?

    - by Randell
    I've just started playing with The Django Form Validation Framework on Google App Engine (from google.appengine.ext.db import djangoforms) and I got stuck googling how to customize forms using it. I was wondering whether the following are possible using the package: Add help texts beside/below input/select fields and textareas (e.g. "This field is required", "Example: qwerty123") Add/modify attributes for the input/select fields and textareas (e.g. adding the following attributes: class, id, name, maxlength, minlength, etc.) Add custom validations like checking whether a particular field should be unique or checking a value against a regular expression Modify the error messages Add another column to the table generated by the form Also note that djangoforms.ModelForm is different from django.forms.Form.

    Read the article

  • how to make a function recursive

    - by tom smith
    i have this huge function and i am wondering how to make it recursive. i have the base case which should never come true, so it should always go to else and keep calling itself with the variable t increases. any help would be great thanks def draw(x, y, t, planets): if 'Satellites' in planets["Moon"]: print ("fillcircle", x, y, planets["Moon"]['Radius']*scale) else: while True: print("refresh") print("colour 0 0 0") print("clear") print("colour 255 255 255") print("fillcircle",x,y,planets['Sun']['Radius']*scale) print("text ", "\"Sun\"",x+planets['Sun']['Radius']*scale,y) if "Mercury" in planets: r_Mercury=planets['Mercury']['Orbital Radius']*scale; print("circle",x,y,r_Mercury) r_Xmer=x+math.sin(t*2*math.pi/planets['Mercury']['Period'])*r_Mercury r_Ymer=y+math.cos(t*2*math.pi/planets['Mercury']['Period'])*r_Mercury print("fillcircle",r_Xmer,r_Ymer,3) print("text ", "\"Mercury\"",r_Xmer+planets['Mercury']['Radius']*scale,r_Ymer) if "Venus" in planets: r_Venus=planets['Venus']['Orbital Radius']*scale; print("circle",x,y,r_Venus) r_Xven=x+math.sin(t*2*math.pi/planets['Venus']['Period'])*r_Venus r_Yven=y+math.cos(t*2*math.pi/planets['Venus']['Period'])*r_Venus print("fillcircle",r_Xven,r_Yven,3) print("text ", "\"Venus\"",r_Xven+planets['Venus']['Radius']*scale,r_Yven) if "Earth" in planets: r_Earth=planets['Earth']['Orbital Radius']*scale; print("circle",x,y,r_Earth) r_Xe=x+math.sin(t*2*math.pi/planets['Earth']['Period'])*r_Earth r_Ye=y+math.cos(t*2*math.pi/planets['Earth']['Period'])*r_Earth print("fillcircle",r_Xe,r_Ye,3) print("text ", "\"Earth\"",r_Xe+planets['Earth']['Radius']*scale,r_Ye) if "Moon" in planets: r_Moon=planets['Moon']['Orbital Radius']*scale; print("circle",r_Xe,r_Ye,r_Moon) r_Xm=r_Xe+math.sin(t*2*math.pi/planets['Moon']['Period'])*r_Moon r_Ym=r_Ye+math.cos(t*2*math.pi/planets['Moon']['Period'])*r_Moon print("fillcircle",r_Xm,r_Ym,3) print("text ", "\"Moon\"",r_Xm+planets['Moon']['Radius']*scale,r_Ym) if "Mars" in planets: r_Mars=planets['Mars']['Orbital Radius']*scale; print("circle",x,y,r_Mars) r_Xmar=x+math.sin(t*2*math.pi/planets['Mars']['Period'])*r_Mars r_Ymar=y+math.cos(t*2*math.pi/planets['Mars']['Period'])*r_Mars print("fillcircle",r_Xmar,r_Ymar,3) print("text ", "\"Mars\"",r_Xmar+planets['Mars']['Radius']*scale,r_Ymar) if "Phobos" in planets: r_Phobos=planets['Phobos']['Orbital Radius']*scale; print("circle",r_Xmar,r_Ymar,r_Phobos) r_Xpho=r_Xmar+math.sin(t*2*math.pi/planets['Phobos']['Period'])*r_Phobos r_Ypho=r_Ymar+math.cos(t*2*math.pi/planets['Phobos']['Period'])*r_Phobos print("fillcircle",r_Xpho,r_Ypho,3) print("text ", "\"Phobos\"",r_Xpho+planets['Phobos']['Radius']*scale,r_Ypho) if "Deimos" in planets: r_Deimos=planets['Deimos']['Orbital Radius']*scale; print("circle",r_Xmar,r_Ymar,r_Deimos) r_Xdei=r_Xmar+math.sin(t*2*math.pi/planets['Deimos']['Period'])*r_Deimos r_Ydei=r_Ymar+math.cos(t*2*math.pi/planets['Deimos']['Period'])*r_Deimos print("fillcircle",r_Xdei,r_Ydei,3) print("text ", "\"Deimos\"",r_Xpho+planets['Deimos']['Radius']*scale,r_Ydei) if "Ceres" in planets: r_Ceres=planets['Ceres']['Orbital Radius']*scale; print("circle",x,y,r_Ceres) r_Xcer=x+math.sin(t*2*math.pi/planets['Ceres']['Period'])*r_Ceres r_Ycer=y+math.cos(t*2*math.pi/planets['Ceres']['Period'])*r_Ceres print("fillcircle",r_Xcer,r_Ycer,3) print("text ", "\"Ceres\"",r_Xcer+planets['Ceres']['Radius']*scale,r_Ycer) if "Jupiter" in planets: r_Jupiter=planets['Jupiter']['Orbital Radius']*scale; print("circle",x,y,r_Jupiter) r_Xjup=x+math.sin(t*2*math.pi/planets['Jupiter']['Period'])*r_Jupiter r_Yjup=y+math.cos(t*2*math.pi/planets['Jupiter']['Period'])*r_Jupiter print("fillcircle",r_Xjup,r_Yjup,3) print("text ", "\"Jupiter\"",r_Xjup+planets['Jupiter']['Radius']*scale,r_Yjup) if "Io" in planets: r_Io=planets['Io']['Orbital Radius']*scale; print("circle",r_Xjup,r_Yjup,r_Io) r_Xio=r_Xjup+math.sin(t*2*math.pi/planets['Io']['Period'])*r_Io r_Yio=r_Yjup+math.cos(t*2*math.pi/planets['Io']['Period'])*r_Io print("fillcircle",r_Xio,r_Yio,3) print("text ", "\"Io\"",r_Xio+planets['Io']['Radius']*scale,r_Yio) if "Europa" in planets: r_Europa=planets['Europa']['Orbital Radius']*scale; print("circle",r_Xjup,r_Yjup,r_Europa) r_Xeur=r_Xjup+math.sin(t*2*math.pi/planets['Europa']['Period'])*r_Europa r_Yeur=r_Yjup+math.cos(t*2*math.pi/planets['Europa']['Period'])*r_Europa print("fillcircle",r_Xeur,r_Yeur,3) print("text ", "\"Europa\"",r_Xeur+planets['Europa']['Radius']*scale,r_Yeur) if "Ganymede" in planets: r_Ganymede=planets['Ganymede']['Orbital Radius']*scale; print("circle",r_Xjup,r_Yjup,r_Ganymede) r_Xgan=r_Xjup+math.sin(t*2*math.pi/planets['Ganymede']['Period'])*r_Ganymede r_Ygan=r_Yjup+math.cos(t*2*math.pi/planets['Ganymede']['Period'])*r_Ganymede print("fillcircle",r_Xgan,r_Ygan,3) print("text ", "\"Ganymede\"",r_Xgan+planets['Ganymede']['Radius']*scale,r_Ygan) if "Callisto" in planets: r_Callisto=planets['Callisto']['Orbital Radius']*scale; print("circle",r_Xjup,r_Yjup,r_Callisto) r_Xcal=r_Xjup+math.sin(t*2*math.pi/planets['Callisto']['Period'])*r_Callisto r_Ycal=r_Yjup+math.cos(t*2*math.pi/planets['Callisto']['Period'])*r_Callisto print("fillcircle",r_Xcal,r_Ycal,3) print("text ", "\"Callisto\"",r_Xcal+planets['Callisto']['Radius']*scale,r_Ycal) if "Saturn" in planets: r_Saturn=planets['Saturn']['Orbital Radius']*scale; print("circle",x,y,r_Saturn) r_Xsat=x+math.sin(t*2*math.pi/planets['Saturn']['Period'])*r_Saturn r_Ysat=y+math.cos(t*2*math.pi/planets['Saturn']['Period'])*r_Saturn print("fillcircle",r_Xsat,r_Ysat,3) print("text ", "\"Saturn\"",r_Xsat+planets['Saturn']['Radius']*scale,r_Ysat) if "Mimas" in planets: r_Mimas=planets['Mimas']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Mimas) r_Xmim=r_Xsat+math.sin(t*2*math.pi/planets['Mimas']['Period'])*r_Mimas r_Ymim=r_Ysat+math.cos(t*2*math.pi/planets['Mimas']['Period'])*r_Mimas print("fillcircle",r_Xmim,r_Ymim,3) print("text ", "\"Mimas\"",r_Xmim+planets['Mimas']['Radius']*scale,r_Ymim) if "Enceladus" in planets: r_Enceladus=planets['Enceladus']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Enceladus) r_Xenc=r_Xsat+math.sin(t*2*math.pi/planets['Enceladus']['Period'])*r_Enceladus r_Yenc=r_Ysat+math.cos(t*2*math.pi/planets['Enceladus']['Period'])*r_Enceladus print("fillcircle",r_Xenc,r_Yenc,3) print("text ", "\"Enceladus\"",r_Xenc+planets['Enceladus']['Radius']*scale,r_Yenc) if "Tethys" in planets: r_Tethys=planets['Tethys']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Tethys) r_Xtet=r_Xsat+math.sin(t*2*math.pi/planets['Tethys']['Period'])*r_Tethys r_Ytet=r_Ysat+math.cos(t*2*math.pi/planets['Tethys']['Period'])*r_Tethys print("fillcircle",r_Xtet,r_Ytet,3) print("text ", "\"Tethys\"",r_Xtet+planets['Tethys']['Radius']*scale,r_Ytet) if "Dione" in planets: r_Dione=planets['Dione']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Dione) r_Xdio=r_Xsat+math.sin(t*2*math.pi/planets['Dione']['Period'])*r_Dione r_Ydio=r_Ysat+math.cos(t*2*math.pi/planets['Dione']['Period'])*r_Dione print("fillcircle",r_Xdio,r_Ydio,3) print("text ", "\"Dione\"",r_Xdio+planets['Dione']['Radius']*scale,r_Ydio) if "Rhea" in planets: r_Rhea=planets['Rhea']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Rhea) r_Xrhe=r_Xsat+math.sin(t*2*math.pi/planets['Rhea']['Period'])*r_Rhea r_Yrhe=r_Ysat+math.cos(t*2*math.pi/planets['Rhea']['Period'])*r_Rhea print("fillcircle",r_Xrhe,r_Yrhe,3) print("text ", "\"Rhea\"",r_Xrhe+planets['Rhea']['Radius']*scale,r_Yrhe) if "Titan" in planets: r_Titan=planets['Titan']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Titan) r_Xtit=r_Xsat+math.sin(t*2*math.pi/planets['Titan']['Period'])*r_Titan r_Ytit=r_Ysat+math.cos(t*2*math.pi/planets['Titan']['Period'])*r_Titan print("fillcircle",r_Xtit,r_Ytit,3) print("text ", "\"Titan\"",r_Xtit+planets['Titan']['Radius']*scale,r_Ytit) if "Iapetus" in planets: r_Iapetus=planets['Iapetus']['Orbital Radius']*scale; print("circle",r_Xsat,r_Ysat,r_Iapetus) r_Xiap=r_Xsat+math.sin(t*2*math.pi/planets['Iapetus']['Period'])*r_Iapetus r_Yiap=r_Ysat+math.cos(t*2*math.pi/planets['Iapetus']['Period'])*r_Iapetus print("fillcircle",r_Xiap,r_Yiap,3) print("text ", "\"Iapetus\"",r_Xiap+planets['Iapetus']['Radius']*scale,r_Yiap) if "Uranus" in planets: r_Uranus=planets['Uranus']['Orbital Radius']*scale; print("circle",x,y,r_Uranus) r_Xura=x+math.sin(t*2*math.pi/planets['Uranus']['Period'])*r_Uranus r_Yura=y+math.cos(t*2*math.pi/planets['Uranus']['Period'])*r_Uranus print("fillcircle",r_Xura,r_Yura,3) print("text ", "\"Uranus\"",r_Xura+planets['Uranus']['Radius']*scale,r_Yura) if "Puck" in planets: r_Puck=planets['Puck']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Puck) r_Xpuc=r_Xura+math.sin(t*2*math.pi/planets['Puck']['Period'])*r_Puck r_Ypuc=r_Yura+math.cos(t*2*math.pi/planets['Puck']['Period'])*r_Puck print("fillcircle",r_Xpuc,r_Ypuc,3) print("text ", "\"Puck\"",r_Xpuc+planets['Puck']['Radius']*scale,r_Ypuc) if "Miranda" in planets: r_Miranda=planets['Miranda']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Miranda) r_Xmira=r_Xura+math.sin(t*2*math.pi/planets['Miranda']['Period'])*r_Miranda r_Ymira=r_Yura+math.cos(t*2*math.pi/planets['Miranda']['Period'])*r_Miranda print("fillcircle",r_Xmira,r_Ymira,3) print("text ", "\"Miranda\"",r_Xmira+planets['Miranda']['Radius']*scale,r_Ymira) if "Ariel" in planets: r_Ariel=planets['Ariel']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Ariel) r_Xari=r_Xura+math.sin(t*2*math.pi/planets['Ariel']['Period'])*r_Ariel r_Yari=r_Yura+math.cos(t*2*math.pi/planets['Ariel']['Period'])*r_Ariel print("fillcircle",r_Xari,r_Yari,3) print("text ", "\"Ariel\"",r_Xari+planets['Ariel']['Radius']*scale,r_Yari) if "Umbriel" in planets: r_Umbriel=planets['Umbriel']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Umbriel) r_Xumb=r_Xura+math.sin(t*2*math.pi/planets['Umbriel']['Period'])*r_Umbriel r_Yumb=r_Yura+math.cos(t*2*math.pi/planets['Umbriel']['Period'])*r_Umbriel print("fillcircle",r_Xumb,r_Yumb,3) print("text ", "\"Umbriel\"",r_Xumb+planets['Umbriel']['Radius']*scale,r_Yumb) if "Titania" in planets: r_Titania=planets['Titania']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Titania) r_Xtita=r_Xura+math.sin(t*2*math.pi/planets['Titania']['Period'])*r_Titania r_Ytita=r_Yura+math.cos(t*2*math.pi/planets['Titania']['Period'])*r_Titania print("fillcircle",r_Xtita,r_Ytita,3) print("text ", "\"Titania\"",r_Xtita+planets['Titania']['Radius']*scale,r_Ytita) if "Oberon" in planets: r_Oberon=planets['Oberon']['Orbital Radius']*scale; print("circle",r_Xura,r_Yura,r_Oberon) r_Xober=r_Xura+math.sin(t*2*math.pi/planets['Oberon']['Period'])*r_Oberon r_Yober=r_Yura+math.cos(t*2*math.pi/planets['Oberon']['Period'])*r_Oberon print("fillcircle",r_Xober,r_Yober,3) print("text ", "\"Oberon\"",r_Xober+planets['Oberon']['Radius']*scale,r_Yober) if "Neptune" in planets: r_Neptune=planets['Neptune']['Orbital Radius']*scale; print("circle",x,y,r_Neptune) r_Xnep=x+math.sin(t*2*math.pi/planets['Neptune']['Period'])*r_Neptune r_Ynep=y+math.cos(t*2*math.pi/planets['Neptune']['Period'])*r_Neptune print("fillcircle",r_Xnep,r_Ynep,3) print("text ", "\"Neptune\"",r_Xnep+planets['Neptune']['Radius']*scale,r_Ynep) if "Titan" in planets: r_Titan=planets['Titan']['Orbital Radius']*scale; print("circle",r_Xnep,r_Ynep,r_Titan) r_Xtita=r_Xnep+math.sin(t*2*math.pi/planets['Titan']['Period'])*r_Titan r_Ytita=r_Ynep+math.cos(t*2*math.pi/planets['Titan']['Period'])*r_Titan print("fillcircle",r_Xtita,r_Ytita,3) print("text ", "\"Titan\"",r_Xtita+planets['Titan']['Radius']*scale,r_Ytita) t += 0.003 print(draw(x, y, t, planets))

    Read the article

  • delta-dictionary/dictionary with revision awareness in python?

    - by shabbychef
    I am looking to create a dictionary with 'roll-back' capabilities in python. The dictionary would start with a revision number of 0, and the revision would be bumped up only by explicit method call. I do not need to delete keys, only add and update key,value pairs, and then roll back. I will never need to 'roll forward', that is, when rolling the dictionary back, all the newer revisions can be discarded, and I can start re-reving up again. thus I want behaviour like: >>> rr = rev_dictionary() >>> rr.rev 0 >>> rr["a"] = 17 >>> rr[('b',23)] = 'foo' >>> rr["a"] 17 >>> rr.rev 0 >>> rr.roll_rev() >>> rr.rev 1 >>> rr["a"] 17 >>> rr["a"] = 0 >>> rr["a"] 0 >>> rr[('b',23)] 'foo' >>> rr.roll_to(0) >>> rr.rev 0 >>> rr["a"] 17 >>> rr.roll_to(1) Exception ... Just to be clear, the state associated with a revision is the state of the dictionary just prior to the roll_rev() method call. thus if I can alter the value associated with a key several times 'within' a revision, and only have the last one remembered. I would like a fairly memory-efficient implementation of this: the memory usage should be proportional to the deltas. Thus simply having a list of copies of the dictionary will not scale for my problem. One should assume the keys are in the tens of thousands, and the revisions are in the hundreds of thousands. We can assume the values are immutable, but need not be numeric. For the case where the values are e.g. integers, there is a fairly straightforward implementation (have a list of dictionaries of the numerical delta from revision to revision). I am not sure how to turn this into the general form. Maybe bootstrap the integer version and add on an array of values? all help appreciated.

    Read the article

  • local variable 'sresult' referenced before assignment

    - by user288558
    I have had multiple problems trying to use PP. I am running python2.6 and pp 1.6.0 rc3. Using the following test code: import pp nodes=('mosura02','mosura03','mosura04','mosura05','mosura06', 'mosura09','mosura10','mosura11','mosura12') def pptester(): js=pp.Server(ppservers=nodes) tmp=[] for i in range(200): tmp.append(js.submit(ppworktest,(),(),('os',))) return tmp def ppworktest(): return os.system("uname -a") gives me the following result: In [10]: Exception in thread run_local: Traceback (most recent call last): File "/usr/lib64/python2.6/threading.py", line 525, in __bootstrap_inner self.run() File "/usr/lib64/python2.6/threading.py", line 477, in run self.__target(*self.__args, **self.__kwargs) File "/home/wkerzend/python_coala/lib/python2.6/site-packages/pp.py", line 751, in _run_local job.finalize(sresult) UnboundLocalError: local variable 'sresult' referenced before assignment Exception in thread run_local: Traceback (most recent call last): File "/usr/lib64/python2.6/threading.py", line 525, in __bootstrap_inner self.run() File "/usr/lib64/python2.6/threading.py", line 477, in run self.__target(*self.__args, **self.__kwargs) File "/home/wkerzend/python_coala/lib/python2.6/site-packages/pp.py", line 751, in _run_local job.finalize(sresult) UnboundLocalError: local variable 'sresult' referenced before assignment Exception in thread run_local: Traceback (most recent call last): File "/usr/lib64/python2.6/threading.py", line 525, in __bootstrap_inner self.run() File "/usr/lib64/python2.6/threading.py", line 477, in run self.__target(*self.__args, **self.__kwargs) File "/home/wkerzend/python_coala/lib/python2.6/site-packages/pp.py", line 751, in _run_local job.finalize(sresult) UnboundLocalError: local variable 'sresult' referenced before assignment Exception in thread run_local: Traceback (most recent call last): File "/usr/lib64/python2.6/threading.py", line 525, in __bootstrap_inner self.run() File "/usr/lib64/python2.6/threading.py", line 477, in run self.__target(*self.__args, **self.__kwargs) File "/home/wkerzend/python_coala/lib/python2.6/site-packages/pp.py", line 751, in _run_local job.finalize(sresult) UnboundLocalError: local variable 'sresult' referenced before assignment any help greatly appreciated

    Read the article

  • importing pywiiuse to test out

    - by Patrick Burton
    This is probably a simple problem. But I downloaded the pywiiuse library from here and I also downloaded the examples. However when I try to run one of the examples I end up with import issues. I'm not certain I have everything configured properly to run. One error I receive when trying to run example.py: Press 1&2 Traceback (most recent call last): File "example.py", line 73, in <module> wiimotes = wiiuse.init(nmotes) File "/home/thed0ctor/Descargas/wiiuse-0.12/wiiuse/__init__.py", line 309, in init dll = ctypes.cdll.LoadLibrary('libwiiuse.so') File "/usr/lib/python2.7/ctypes/__init__.py", line 431, in LoadLibrary return self._dlltype(name) File "/usr/lib/python2.7/ctypes/__init__.py", line 353, in __init__ self._handle = _dlopen(self._name, mode) OSError: libwiiuse.so: cannot open shared object file: No such file or directory I'm really just starting out with this library and don't really see any documentation on how to configure pywiiuse so any help is much appreciated.

    Read the article

  • How to create a folder for each item in a directory?

    - by Adrian Andronic
    I'm having trouble making folders that I create go where I want them to go. For each file in a given folder, I want to create a new folder, then put that file in the new folder. My problem is that the new folders I create are being put in the parent directory, not the one I want. My example: def createFolder(): dir_name = 'C:\\Users\\Adrian\\Entertainment\\Coding\\Test Folder' files = os.listdir(dir_name) for i in files: os.mkdir(i) Let's say that my files in that directory are Hello.txt and Goodbye.txt. When I run the script, it makes new folders for these files, but puts them one level above, in 'C:\Users\Adrian\Entertainment\Coding. How do I make it so they are created in the same place as the files, AKA 'C:\Users\Adrian\Entertainment\Coding\Test Folder'?

    Read the article

  • Help finding longest non-repeating path through connected nodes - Python

    - by Jordan Magnuson
    I've been working on this for a couple of days now without success. Basically, I have a bunch of nodes arranged in a 2D matrix. Every node has four neighbors, except for the nodes on the sides and corners of the matrix, which have 3 and 2 neighbors, respectively. Imagine a bunch of square cards laid out side by side in a rectangular area--the project is actually simulating a sort of card/board game. Each node may or may not be connected to the nodes around it. Each node has a function (get_connections()), that returns the nodes immediately around it that it is connected to (so anywhere from 0 to 4 nodes are returned). Each node also has an "index" property, that contains it's position on the board matrix (eg '1, 4' - row 1, col 4). What I am trying to do is find the longest non-repeating path of connected nodes given a particular "start" node. I've uploaded a couple of images that should give a good idea of what I'm trying to do: In both images, the highlighted red cards are supposedly the longest path of connected cards containing the most upper-left card. However, you can see in both images that a couple of cards that should be in the path have been left out (Romania and Maldova in the first image, Greece and Turkey in the second) Here's the recursive function that I am using currently to find the longest path, given a starting node/card: def get_longest_trip(self, board, processed_connections = list(), processed_countries = list()): #Append this country to the processed countries list, #so we don't re-double over it processed_countries.append(self) possible_trips = dict() if self.get_connections(board): for i, card in enumerate(self.get_connections(board)): if card not in processed_countries: processed_connections.append((self, card)) possible_trips[i] = card.get_longest_trip(board, processed_connections, processed_countries) if possible_trips: longest_trip = [] for i, trip in possible_trips.iteritems(): trip_length = len(trip) if trip_length > len(longest_trip): longest_trip = trip longest_trip.append(self) return longest_trip else: print card_list = [] card_list.append(self) return card_list else: #If no connections from start_card, just return the start card #as the longest trip card_list = [] card_list.append(board.start_card) return card_list The problem here has to do with the processed_countries list: if you look at my first screenshot, you can see that what has happened is that when Ukraine came around, it looked at its two possible choices for longest path (Maldova-Romania, or Turkey, Bulgaria), saw that they were both equal, and chose one indiscriminantly. Now when Hungary comes around, it can't attempt to make a path through Romania (where the longest path would actually be), because Romania has been added to the processed_countries list by Ukraine. Any help on this is EXTREMELY appreciated. If you can find me a solution to this, recursive or not, I'd be happy to donate some $$ to you. I've uploaded my full source code (Python 2.6, Pygame 1.9 required) to: http://www.necessarygames.com/junk/planes_trains.zip The relevant code is in src/main.py, which is all set to run.

    Read the article

  • What is the current choice for doing RPC in Python?

    - by edomaur
    Actually, I've done some work with Pyro and RPyC, but there is more RPC implementation than these two. Can we make a list of them? Native Python-based protocols: PyRo (Python Remote Objects) RPyC (Remote Python Call) Circuits JSON-RPC based frameworks: python-symmetric-jsonrpc rpcbd XML-RPC based frameworks: XMLRPC, using the xmlrpclib and SimpleXMLRPCServer modules in the standard library. Others? Twisted Spread

    Read the article

  • Regex to split on successions of newline characters

    - by Beau Martínez
    I'm trying to split a string on newline characters (catering for Windows, OS X, and Unix text file newline characters). If there are any succession of these, I want to split on that too and not include any in the result. So, for when splitting the following: "Foo\r\n\r\nDouble Windows\r\rDouble OS X\n\nDouble Unix\r\nWindows\rOS X\nUnix" The result would be: ['Foo', 'Double Windows', 'Double OS X', 'Double Unix', 'Windows', 'OS X', 'Unix'] What regex should I use?

    Read the article

  • str is not callable error in python .

    - by mekasperasky
    import sys import md5 from TOSSIM import * from RadioCountMsg import * t = Tossim([]) #The Tossim object is defined here m = t.mac()#The mac layer is defined here , in which the communication takes place r = t.radio()#The radio communication link object is defined here , as the communication needs Rf frequency to transfer t.addChannel("RadioCountToLedsC", sys.stdout)# The various channels through which communication will take place t.addChannel("LedsC", sys.stdout) #The no of nodes that would be required in the simulation has to be entered here print("enter the no of nodes you want ") n=input() for i in range(0, n): m = t.getNode(i) m.bootAtTime((31 + t.ticksPerSecond() / 10) * i + 1) #The booting time is defined so that the time at which the node would be booted is given f = open("topo.txt", "r") #The topography is defined in topo.txt so that the RF frequencies of the transmission between nodes are are set lines = f.readlines() for line in lines: s = line.split() if (len(s) > 0): if (s[0] == "gain"): r.add(int(s[1]), int(s[2]), float(s[3])) #The topogrography is added to the radio object noise = open("meyer-heavy.txt", "r") #The noise model is defined for the nodes lines = noise.readlines() for line in lines: str = line.strip() if (str != ""): val = int(str) for i in range(0, 4): t.getNode(i).addNoiseTraceReading(val) for i in range (0, n): t.getNode(i).createNoiseModel() #The noise model is created for each node for i in range(0,n): t.runNextEvent() fk=open("key.txt","w") for i in range(0,n): if i ==0 : key=raw_input() fk.write(key) ak=key key=md5.new() key.update(str(ak)) ak=key.digest() fk.write(ak) fk.close() fk=open("key.txt","w") plaint=open("pt.txt") for i in range(0,n): msg = RadioCountMsg() msg.set_counter(7) pkt = t.newPacket()#A packet is defined according to a certain format print("enter message to be transported") ms=raw_input()#The message to be transported is taken as input #The RC5 encryption has to be done here plaint.write(ms) pkt.setData(msg.data) pkt.setType(msg.get_amType()) pkt.setDestination(i+1)#The destination to which the packet will be sent is set print "Delivering " + " to" ,i+1 pkt.deliver(i+1, t.time() + 3) fk.close() print "the key to be displayed" ki=raw_input() fk=open("key.txt") for i in range(0,n): if i==ki: ms=fk.readline() for i in range(0,n): msg=RadioCountMsg() msg.set_counter(7) pkt=t.newPacket() msg.data=ms pkt.setData(msg.data) pkt.setType(msg.get_amType()) pkt.setDestination(i+1) pkt.deliver(i+1,t.time()+3) #The key has to be broadcasted here so that the decryption can take place for i in range(0, n): t.runNextEvent(); this code gives me error here key.update(str(ak)) . when i run a similar code on the python terminal there is no such error but this code pops up an error . why so?

    Read the article

  • Python form POST using urllib2 (also question on saving/using cookies)

    - by morpheous
    I am trying to write a function to post form data and save returned cookie info in a file so that the next time the page is visited, the cookie information is sent to the server (i.e. normal browser behavior). I wrote this relatively easily in C++ using curlib, but have spent almost an entire day trying to write this in Python, using urllib2 - and still no success. This is what I have so far: import urllib, urllib2 import logging # the path and filename to save your cookies in COOKIEFILE = 'cookies.lwp' cj = None ClientCookie = None cookielib = None logger = logging.getLogger(__name__) # Let's see if cookielib is available try: import cookielib except ImportError: logger.debug('importing cookielib failed. Trying ClientCookie') try: import ClientCookie except ImportError: logger.debug('ClientCookie isn\'t available either') urlopen = urllib2.urlopen Request = urllib2.Request else: logger.debug('imported ClientCookie succesfully') urlopen = ClientCookie.urlopen Request = ClientCookie.Request cj = ClientCookie.LWPCookieJar() else: logger.debug('Successfully imported cookielib') urlopen = urllib2.urlopen Request = urllib2.Request # This is a subclass of FileCookieJar # that has useful load and save methods cj = cookielib.LWPCookieJar() login_params = {'name': 'anon', 'password': 'pass' } def login(theurl, login_params): init_cookies(); data = urllib.urlencode(login_params) txheaders = {'User-agent' : 'Mozilla/4.0 (compatible; MSIE 5.5; Windows NT)'} try: # create a request object req = Request(theurl, data, txheaders) # and open it to return a handle on the url handle = urlopen(req) except IOError, e: log.debug('Failed to open "%s".' % theurl) if hasattr(e, 'code'): log.debug('Failed with error code - %s.' % e.code) elif hasattr(e, 'reason'): log.debug("The error object has the following 'reason' attribute :"+e.reason) sys.exit() else: if cj is None: log.debug('We don\'t have a cookie library available - sorry.') else: print 'These are the cookies we have received so far :' for index, cookie in enumerate(cj): print index, ' : ', cookie # save the cookies again cj.save(COOKIEFILE) #return the data return handle.read() # FIXME: I need to fix this so that it takes into account any cookie data we may have stored def get_page(*args, **query): if len(args) != 1: raise ValueError( "post_page() takes exactly 1 argument (%d given)" % len(args) ) url = args[0] query = urllib.urlencode(list(query.iteritems())) if not url.endswith('/') and query: url += '/' if query: url += "?" + query resource = urllib.urlopen(url) logger.debug('GET url "%s" => "%s", code %d' % (url, resource.url, resource.code)) return resource.read() When I attempt to log in, I pass the correct username and pwd,. yet the login fails, and no cookie data is saved. My two questions are: can anyone see whats wrong with the login() function, and how may I fix it? how may I modify the get_page() function to make use of any cookie info I have saved ?

    Read the article

  • GAE - Getting TypeError requiring class instance be passed to class's own method...

    - by Spencer Leland
    I'm really new to programming... I set up a class to give supporting information for Google's User API user object. I store this info in the datastore using db.model. When I call the okstatus method of my user_info class using this code: elif user_info.okstatus(user): self.response.out.write("user allowed") I get this error: unbound method okstatus() must be called with user_info instance as first argument (got User instance instead) Here is my user_info class. class user_info: def auth_ctrlr(self, user): if self.status(user) == status_allowed: return ("<a href=\"%s\">Sign Out</a>)" % (users.create_login_url("/"))) else: return ("<a href=\"%s\">Sign In or Get an Account</a>)" % (users.create_logout_url("/"))) def status(self, user): match = sub_user.gql(qu_by_user_id, user.user_id) return match.string_status def group(self, user): match = sub_user.gql(qu_by_user_id, user.user_id) grp = group_names.gql(qu_by_user_id, match.groupID) return grp def okstatus(self, user): match = self.status(user) if match == status_allowed: return True My understanding is that the argument "self" inside the method's calling arguments describes it as a child to the class. I've tried everything I can think of and can't find any related info online. Can someone please tell me what I'm doing wrong? Thanks

    Read the article

< Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >