Search Results

Search found 9016 results on 361 pages for 'regex libraries'.

Page 144/361 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

• Regular expression - starting and ending with a letter, accepting only letters, numbers and _

  - by jreid9001

  I'm trying to write a regular expression which specifies that text should start with a letter, every character should be a letter, number or underscore, there should not be 2 underscores in a row and it should end with a letter or number. At the moment, the only thing I have is ^[a-zA-Z]\w[a-zA-Z1-9_] but this doesn't seem to work properly since it only ever matches 3 characters, and allows repeated underscores. I also don't know how to specify requirements for the last character.

  Read the article

• actionscript find and convert text to url

  - by gravesit

  I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

  Read the article

• Sed: regular expression match lines without <!--

  - by sixtyfootersdude

  I have a sed command to comment out xml commands sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml Takes: <a> <!-- Comment --> <b> bla </b> </a> Produces: <!-- Security: <a> --> <!-- Security: <!-- Comment --> --> // NOTE: there are two end comments. <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> Ideally I would like to not use my sed script to comment things that are already commented. Ie: <!-- Security: <a> --> <!-- Comment --> <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> I could do something like this: sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml sed 's/^[ \t]*<!-- Security: \(<!--.*-->\) -->/\1/' web.xml but I think a one liner is cleaner (?) This is pretty similar: http://stackoverflow.com/questions/436850/matching-a-line-that-doesnt-contain-specific-text-with-regular-expressions

  Read the article

• Whats the regular expression for finding string between " "

  - by chitresh

  Hi all, I have a string as below: "http:172.1." = (10, 1,3); "http:192.168." = (15, 2,6); "http:192.168.1.100" = (1, 2,8); The string inside " " is a Tag and inside () is the value for preceding tag. What is the regular expression that will return me: Tag: http:172.1. Value: 10, 1,3

  Read the article

• Match Phrases (in array) in text string

  - by Tim Hanssen

  I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

  Read the article

• JavaScript: add or subtract from number in string

  - by yoavf

  I have a string that looks like "(3) New stuff" where 3 can be any number. I would like to add or subtract to this number. I figured out the following way: var thenumber = string.match((/\d+/)); thenumber++; string = string.replace(/\(\d+\)/ ,'('+ thenumber +')'); Is there a more elegant way to do it?

  Read the article

• what is the regular expression for this

  - by bn

  I want to parse this (adv) much (thanks) I want to eliminate the words and the bracket (adv) but not (thanks) the condition is: inside bracket, and word length inside bracket is 1-5 characters I am using preg_match in PHP Thank You

  Read the article

• Elegant way to distinct Path or Entry key

  - by sum1stolemyname

  I have an application loading CAD data (Custom format), either from the local filesystem specifing an absolute path to a drawing or from a database. Database access is realized through a library function taking the drawings identifier as a parameter. the identifiers have a format like ABC 01234T56-T, while my paths a typical windows Paths (eg x:\Data\cadfiles\cadfile001.bin). I would like to write a wrapper function Taking a String as an argument which can be either a path or an identifier which calls the appropriate functions to load my data. Like this: Function CadLoader(nameOrPath : String):TCadData; My Question: How can I elegantly decide wether my string is an idnetifier or a Path to a file? Use A regexp? Or just search for '\' and ':', which are not appearing in the Identifiers?

  Read the article

• Censoring selected words (replacing them with ****) using a single replaceAll?

  - by aioobe

  I'd like to censor some words in a string by replacing each character in the word with a "*". Basically I would want to do String s = "lorem ipsum dolor sit"; s = s.replaceAll("ipsum|sit", $0.length() number of *)); so that the resulting s equals "lorem ***** dolor ***". I know how to do this with repeated replaceAll invokations, but I'm wondering, is this possible to do with a single replaceAll?

  Read the article

• groovy or java: how can replace '\' with '\\' 'C:\www\web-app\StudyReports\test.bat'

  - by john

  hi, this might be trivial (please forgive me for that) but my eventual goal is to have a string like def newline= 'C:\\www\web-app\StudyReports\\test.bat' but my old line only have one '\', i tried different ways of using the following def newline=oldline.replaceAll(/\\/,'//') but did not work at ... could someone help me out.

  Read the article

• Apply a class to a <h1> based on the site url

  - by user1870639

  I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

  Read the article

• How to match a variable list of items separated by commas

  - by user261915

  I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

  Read the article

• Finding C#-style unescaped strings using regular expressions

  - by possan

  I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

  Read the article

• extracting multiple fields from a text file using php

  - by Dave

  Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

  Read the article

• How can I test if an input field contains foreign characters?

  - by zeckdude

  I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

  Read the article

• PHP: Return string between two characters

  - by Nic Hubbard

  I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

  Read the article

• Need to add specific characters to regular expression

  - by lordryan

  i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

  Read the article

• How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

  - by Steve

  I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

  Read the article

• javascript split string on space or on quotes to array

  - by Boriz

  var str = 'single words "fixed string of words"'; var astr = str.split(" "); // need fix i want the array to be like: single, words, fixed string of words.

  Read the article

• How to determine that there is date in the string or not with different date format ?

  - by Harikrishna

  I have a need of checking whether there is the date in the string or not. FUTIDX 26FEB2009 NIFTY 0 -- There is date in the string. FUTIDX MINIFTY 30 Jul 2009 -- There is date in the string. FUTSTK ONGC 27 Mar 2008 -- There is date in the string. How can I do that ?

  Read the article

• Next line matching the regex in bash

  - by Lin_freak

  I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

  Read the article

• Regular expression to match text that doesn't start with substring?

  - by Steven

  I have text with file names scattered throughout. The filenames appear in the text like this: |test.txt| |usr01.txt| |usr02.txt| |foo.txt| I want to match the filenames that don't start with usr. I came up with (?<=\|).*\.txt(?=\|) to match the filenames, but it doesn't exclude the ones starting with usr. Is this possible with regular expressions?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How do you use grep to find terms that are n characters long?

  - by Brian

  I'm using grep to filter the Mac OS X dictionary words file (by default located at /usr/share/dict/words). I want to use grep to retrieve all words four characters long. How do I do this? My best guess for how to do this was: grep [:alpha:]{4} words But that returns zero results.

  Read the article

• Regular Expression repetition of class

  - by codersarepeople

  I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

  Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >