Search Results

Search found 12753 results on 511 pages for 'small'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 181/511 | < Previous Page | 177 178 179 180 181 182 183 184 185 186 187 188  | Next Page >

  • Multicore programming: what's necessary to do it?

    - by Casey
    I have a quadcore processor and I would really like to take advantage of all those cores when I'm running quick simulations. The problem is I'm only familiar with the small Linux cluster we have in the lab and I'm using Vista at home. What sort of things do I want to look into for multicore programming with C or Java? What is the lingo that I want to google? Thanks for the help.

    Read the article

  • Run javascript function after Server-Side validation is complete.

    - by Ed Woodcock
    Ok, I've got a lightbox with a small form (2 fields) in it, inside an UpdatePanel, and I want to close this lightbox (must be done via javascript) when the 'Save' button is pressed. However, there is a need to have a server-side CustomValidator on the page, and I only want to close the lightbox if this returns as valid. Does anyone know a way to trigger javascript (or jQuery) code from a server-side validator?

    Read the article

  • On a local network, are you able to password protect certain folders and how (in windows xp)?

    - by Derek
    I have a local network set up for my small office which consists of me, the manager, my wife, the secretary, and a few sales people/others. I would like to share passwords over the network and other such things privately to my wife, the secretary, but would not like the sales people and others to have access to it, yet I need the others to have access to other folders/documents that I'd like to share. How would I go about doing this if not by password? Thanks in advance

    Read the article

  • Documentation on System.Deployment

    - by krisnam
    I have a Win Application which is publish using ClickOnce deployment (go though VS IDE). I want to develop another small application (Web) to do this deployment process without going though VS IDE. I heard about System.Deployment and Microsoft.Build.BuildEngine name spaces. But I count find good doc to solve my problem. If you have one please send me any references.

    Read the article

  • Background Activity for Map in Android started again if phone orientation is changed

    - by Dave
    Hi, i've developed an android app that's fetches an xml file and displays this data via several markers on the map. This works fine so far. The problem right now is that when i switch the orientation of the phone (portrait-landscape or vice versa) the markers disappear for a small moment, the xml processing is started again and then they reappear. Is there a way to prevent this re-loading of the file? It only takes about 2-3 seconds..so no big deal, but still disturbing

    Read the article

  • Why should I use "Web 2.0"-style URLs?

    - by hydrapheetz
    In short, why use something like http://stackoverflow.com/badges/6/supporter instead of something "simpler" (and subjectively, at that) like http://stackoverflow.com/badges/6/. Even on my own site I've just been using /post/6/ to reference posts (by IDs, even though I still store a slug.) Instead of /post/6/small-rant-on-urls, and in some cases, they can get even more absurd, much more so than is really necessary.

    Read the article

  • Where can I get a theme/template suitable for a webapp?

    - by swisstony
    I'm building a simple web application that is mainly going to be displaying small tables of data back to the user. The problem is I can't do design to save my life. I need a simple web 2.0 style template that is CSS/HTML compliant. I know about http://themeforest.net and http://www.oswd.org/. Just wondering if there are any other sites that have a good selection of templates suitable for web apps.

    Read the article

  • Is it reasonable to use OpenGL for desktop applications?

    - by JamesK89
    I've been writing a small desktop gadget-type application that displays scrolling text along the bottom of the screen (Similar to the old CNN news ticker), however the performance of GDI is just unsatisfactory (As high as 8-12% on a quad core and 20% on a single core) even after I've attempted to clean out bottlenecks. I was considering using OpenGL instead to render everything, but I don't know if that is a reasonable option to require users to have hardware acceleration for a tiny app like this. Does anybody have any input on this?

    Read the article

  • Why is a c++ reference considered safer than a pointer?

    - by anand.arumug
    When the c++ compiler generates very similar assembler code for a reference and pointer, why is using references preferred (and considered safer) compared to pointers? I did see Difference between pointer variable and reference variable in C++ which discusses the differences between them. EDIT-1: I was looking at the assembler code generated by g++ for this small program: int main(int argc, char* argv[]) { int a; int &ra = a; int *pa = &a; }

    Read the article

  • executing null values records

    - by jjj
    i am trying to execute the records that have TotalTime null value from the table NewTimeAttendance...TotalTime datatype nchar(10) select * from newtimeattendance where TotalTime = 'NULL' ....nothing select * from newtimeattendance where TotalTime = 'null' ....nothing select * from newtimeattendance where TotalTime = 'Null' ....nothing select * from newtimeattendance where TotalTime = null ....nothing select * from newtimeattendance where TotalTime = Null ....nothing select * from newtimeattendance where TotalTime = NULL ....nothing when i select the whole table i can see that there is some NULL TotalTime values..!! it is small select statment ..why doesn't it work ? is there a way (special way ) to execute the 'NULL' with nchar type ?! thanks in advance

    Read the article

  • What is a good CPU/PC setup to speed up intensive C++/templates compilation?

    - by ApplePieIsGood
    I currently have a machine with an Opteron 275 (2.2Ghz), which is a dual core CPU, and 4GB of RAM, along with a very fast hard drive. I find that when compiling even somewhat simple projects that use C++ templates (think boost, etc.), my compile times can take quite a while (minutes for small things, much longer for bigger projects). Unfortunately only one of the cores is pegged at 100%, so I know it's not the I/O, and it would seem that there is no way to take advantage of the other core for C++ compilation?

    Read the article

  • Executing JavaScript with Python without X.

    - by Thomas
    I want to parse a html-page that unfortunately requires JavaScript to show any content. In order to do so I use a small python-script that pulls the html-code of the page, but after that I have to execute the JavaScript in a DOM-context which seems pretty hard. To make it even harder I want to use it in a server environment that has no X11-server. Note: I already read about http://code.google.com/p/pywebkitgtk/ but it seems to need a X-server.

    Read the article

  • Any way to make dialogs appear/disappear with a transition in MFC?

    - by John
    For instance I have a main dialog, when I click a button a smaller dialog appears next to it. But it would be neat if the small one could somehow transition in, rather than simply appear. For instance using transparency, or zooming in, or sliding in from width=0 - full-width. Making an actual dialog do such things isn't too hard, but what about the controls within it? How might we approach this in a way that is reusable on different dialogs?

    Read the article

  • MS Stack web host with HIPAA expertice?

    - by AndrewCr
    I'm a consultant, helping a provider of small medical practice management software move to the web. We're looking for a host that has experience with HIPAA-compliance, and supports the MS Web stack (IIS / .net / SQL Server) Can anyone here provide a recommendation of such a hosting company? Thanks, Andrew

    Read the article

  • What are the drawbacks with Jasper Reports?

    - by Jonas
    I'm evaluating report engines for a Java desktop application. I need to print receipts, invoices and reports. I'm looking at Jasper Reports since it seem to be the most popular reporting engine in the Java world. Are there any big drawbacks or disadvantages with using it in a small business system?

    Read the article

  • How to create a WebKit browser plugin in C#?

    - by Superior0
    I want to create C# plugin for some 3d + Music editing stuff. I want to be able to run my files inside browsers pages (so to see HTML some Flash content and some content which is rant by my plugin) using something like HTML tag or some JavaScript. (So my plugin will be small, powerfull and i want it to run at least on Windows and Mac firefox and safary and Chrome)(If it'll be runing on Linux itll be grate))) I'ma beginner so any helpfull info will be appriciated

    Read the article

  • Comparison of free open source ecommerce solutions

    - by nute
    I want to launch a small online shop. I've heard of several open source ecommerce solutions out there. Is there a website, page, or something that could help me choose the right one? I've heard of osCommerce, magento, joomla+ecommerce ... I'm looking for a free solution, preferably in PHP so I can tweak it if needed. Thanks!

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Should I begin Learning C# with C# 3 or C# 4 ?

    - by Naughty.Coder
    Should I learn C#3 or C#4 !? there are alot more books on C#3 than C#4 , would my programming abilities be outdated if I learned C#3 !? And another small question : there are books like : beginning Visual C# 2008 , and Illustrated C# 2008 . The question is : Do they mean the IDE when they mention Visual C# 2008 ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 177 178 179 180 181 182 183 184 185 186 187 188  | Next Page >