Search Results

Search found 13293 results on 532 pages for 'small ticket'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 201/532 | < Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >

  • Any way to make dialogs appear/disappear with a transition in MFC?

    - by John
    For instance I have a main dialog, when I click a button a smaller dialog appears next to it. But it would be neat if the small one could somehow transition in, rather than simply appear. For instance using transparency, or zooming in, or sliding in from width=0 - full-width. Making an actual dialog do such things isn't too hard, but what about the controls within it? How might we approach this in a way that is reusable on different dialogs?

    Read the article

  • Comparison of free open source ecommerce solutions

    - by nute
    I want to launch a small online shop. I've heard of several open source ecommerce solutions out there. Is there a website, page, or something that could help me choose the right one? I've heard of osCommerce, magento, joomla+ecommerce ... I'm looking for a free solution, preferably in PHP so I can tweak it if needed. Thanks!

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • Executing JavaScript with Python without X.

    - by Thomas
    I want to parse a html-page that unfortunately requires JavaScript to show any content. In order to do so I use a small python-script that pulls the html-code of the page, but after that I have to execute the JavaScript in a DOM-context which seems pretty hard. To make it even harder I want to use it in a server environment that has no X11-server. Note: I already read about http://code.google.com/p/pywebkitgtk/ but it seems to need a X-server.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Running on Windows CE 6 'and' Windows XP

    - by Psychic
    Is it possible to create a small program that will run, without recompiling and without emulators, on both Windows CE 6 AND Windows XP SP3? From my knowledge, this isn't possible. Source code needs to be recompiled for the target platform. However, a hardware manufacturer for embedded boards is claiming otherwise. The application isn't anything complex, just a simple benchmarking tool analysing floating point operations, CPU ticks etc, and displaying the results on a plain GUI.

    Read the article

  • iPhone SQLite connection in domain object - close each time?

    - by BahaiResearch.com
    I have what I would consider a small sized iPhone app that uses SQLite. There is a singleton domain object which gets data from a SQLite database. Is it better to create and open the SQLite connection for each request, or to open the DB once and hold on to it for the duration of the app. The app's reason for being is the domain object so other objects will not need the DB.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to store a 2D game world in mysql

    - by monthon1
    I am making a 2D game in javascript/ajax, that will be using data stored in mysql database. Every user have got his own "area" made of small squares that can have some values. But I have no idea, how to store values of each square in mysql, when each user can have area with different width or height. Do you have some idea?

    Read the article

  • Redirection in Rails

    - by Cyborgo
    Hi, I have a small question regarding rails. I have a search controller which searches for a name in database, if found shows the details about it or else I am redirecting to the new name page. Is there anyway after redirection that the name searched for to automatically appear in the new form page? Thanks in advance.

    Read the article

  • Should I begin Learning C# with C# 3 or C# 4 ?

    - by Naughty.Coder
    Should I learn C#3 or C#4 !? there are alot more books on C#3 than C#4 , would my programming abilities be outdated if I learned C#3 !? And another small question : there are books like : beginning Visual C# 2008 , and Illustrated C# 2008 . The question is : Do they mean the IDE when they mention Visual C# 2008 ?

    Read the article

  • What are some good usability guidelines an average developer should follow?

    - by Allain Lalonde
    I'm not a usability specialist, and I really don't care to be one. I just want a small set of rules of thumb that I can follow while coding my User Interfaces so that my product has decent usability. At first I thought that this question would be easy to answer "Use your common sense", but if it's so common among us developers we wouldn't, as a group, have a reputation for our horrible interfaces. Any Suggestions?

    Read the article

  • Building vs. Compiling (Java)

    - by sixtyfootersdude
    Thinking that the answer to this is pretty obvious but here it goes: When I am working on a small project for school (in java) I "compile" it. On my coop we are using ant to "build" our project. I think that compiling is a subset of building. Is this correct? What is the difference between building and compiling?

    Read the article

  • Image upload storage strategies

    - by MatW
    When a user uploads an image to my site, the image goes through this process; user uploads pic store pic metadata in db, giving the image a unique id async image processing (thumbnail creation, cropping, etc) all images are stored in the same uploads folder So far the site is pretty small, and there are only ~200,000 images in the uploads directory. I realise I'm nowhere near the physical limit of files within a directory, but this approach clearly won't scale, so I was wondering if anyone had any advice on upload / storage strategies for handling large volumes of image uploads.

    Read the article

  • Bash: easy way to put a configurable load on a system?

    - by WizardOfOdds
    In order to test how a program reacts when system resources become scarce (mainly the CPU but I'm interested in disk I/O too), I'd like to put an arbitrary load on the system. Currently I'm doing something like this: #!/bin/bash while true do echo "a" >> a.txt md5 a.txt done I could also start mp3-encoding audio files, or whatever. What would be an easy and small Bash script that could be used to simulate an arbitrary load, ideally configurable using parameter(s)?

    Read the article

  • Using $this when not in object context

    - by Ken
    I'm creating a function to show blog's. So I made a show blog function but it keeps giving "Using $this when not in object context" error Class Blog{ public function getLatestBlogsBig($cat = null){ $sqlString = "SELECT blog_id FROM jab_blog"; if($cat != null) $sqlString .= " WHERE blog_cat = " . $cat; $sqlString .= " ORDER BY blog_id DESC LIMIT 5"; $blog = mysql_query($sqlString); while($id = mysql_result($blog,"blog_id")){ $this->showBlog($id); //Error is on this line } } function showBlog($id,$small = false){ $sqlString = "SELECT blog_id FROM jab_blog WHERE blog_id=" . $id . ";"; $blog = mysql_query($sqlString); if($small = true){ echo "<ul>"; while($blogItem = mysql_fetch_array($blog)){ echo '<a href="' . $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']) .'">' . $blogItem['blog_title'] . '</a></li>'; } echo "</ul>"; }else{ while($blogItem = mysql_fetch_array($blog)){ ?> <div class="post"> <h2 class="title"><a href="<?php echo $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']);?>"><?php echo $blogItem['blog_title'];?></a></h2> <p class="meta"><span class="date">The date implement</span><span class="posted">Posted by <a href="#">Someone</a></span></p> <div style="clear: both;">&nbsp;</div> <div class="entry"> <?php echo $blogItem['blog_content'];?> </div> </div> <?php } } } }

    Read the article

  • Change size of a custom page in Inno Setup

    - by Paja
    The following image shows the size of a standard custom page: I've intentionally removed the panel on top, where you usually see Caption, Description and Logo. So you can see that the actual size of the page is quite small - there are gaps on top, left and right sides. Is there any way to resize the page, so there are no gaps? I want the image to take the whole space. I create the page using CreateCustomPage function.

    Read the article

  • LAMP v/s WAMP in PHP

    - by Ajith
    I have a small server problem when working with LAMPP and WAMP server in PHP.I am using LAMPP server for local development and I need to host in WAMP server.When try to read an image from a dynamic created pdf file in LAMPP, it is working perfectly but, the same one not compact able with WAMP server.What will be the problem?Any additional feature need to configure in WAMP.Please help me to go forward.Please........

    Read the article

  • Good TFS Hosting Provider

    - by JonnyD
    I'm looking for a good 3rd party host for Team Foundation Server. Have any of you had good or bad experiences in the past? Will be working on a small .NET project with several other guys in different locations. Are there any performance problems or any other "gotchas" with 3rd party hosting?

    Read the article

  • What is the recommended approach to add static subdomains to a website?

    - by shg
    I would like to create a few static subdomains like: mycategory.mydomain.com in a rather small website and would like it to point to the folder: mydomain.com/mycategory without showing such redirection in browser address bar. What is an easiest way to achieve it? I can do it in either IIS settings, asp.net, C# code, etc I guess there are better ways then creating a few separate Sites in IIS - one for each subdomain.

    Read the article

  • Why won't the following haskell code compile?

    - by voxcogitatio
    I'm in the process of writing a small lisp interpreter in haskell. In the process i defined this datatype, to get a less typed number; data Number = _Int Integer | _Rational Rational | _Float Double deriving(Eq,Show) Compiling this fails with the following error: ERROR "types.hs":16 - Syntax error in data type declaration (unexpected `|') Line 16 is the line w. the first '|' in the code above.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >