Search Results

Search found 10860 results on 435 pages for 'bad blocks'.

Page 209/435 | < Previous Page | 205 206 207 208 209 210 211 212 213 214 215 216  | Next Page >

  • How to remove request blocking on apache reverse proxy after failure of backend before asking backen

    - by matnagel
    I am working on an apache2 reverse proxy vhost. When the server behind apache is down, the first request to apache shows the error page of course. But at subsequent requests it seems apache delays for some time before asking the backend server again. During all this time (which is short but in development I don't want a delay at all) only the apache error page is shown to the browser, although the backend server is already up. Where is this setting in apache, what is this behaviour, and how can I set the delay time to zero? Edit: I am not trying to change the timeout for a single request. I want to change the blocking time. It is my experience that apache blocks further requests for a certain time before asking a backend server again that has failed once. Edit2: This is what apache delivers: Service Temporarily Unavailable The server is temporarily unable to service your request due to maintenance downtime or capacity problems. Please try again later. Apache/2.2.8 (Ubuntu) PHP/5.2.4-2ubuntu5.7 with Suhosin-Patch proxy_html/3.0.0 Server at localhost Port 80 After hitting Ctrl-R in firefox for 60 seconds the page finally appears.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Rsync Push files from linux to windoes. ssh issue - connection refused

    - by piyush c
    For some reason I want to run a script to move files from Linux machine to Windows. I have installed cwRsync on my windows machine and able to connect to linux machine. When i execute following command: rsync -e "ssh -l "piyush"" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" Where 10.0.0.60 is my widows machine and I am running above command on Linux - CentOS 5.5. After running command I get following error message: ssh: connect to host 10.0.0.60 port 22: Connection refused rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: error in rsync protocol data stream (code 12) at io.c(463) [sender=2.6.8] [root@localhost sync]# ssh [email protected] ssh: connect to host 10.0.0.60 port 22: Connection refused I have modified my firewall settings on widows to allow all ports. I think this issue is due to SSH Daemon not present on my windows machine. So I tried installing OpenSSH on my machine and running ssh-agent but didn't helped. I tried similar command to run on my widows machine to pull files from Linux and its working fine. For some reason I want command for Linux machine so that I can embed it in a shell script. Can you suggest me if I am missing anything. I am already having cwRsync installed on my widows and running it in daemon mode using --damemon option. And I am able to login using ssh from windows machine to linux machine. When I issue bellow command, it just blocks for 120 seconds (timeout I specified in command) and exits saying there is timeout. rsync -e "ssh -l piyush" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" After starting rsync on widows, I checked, rsyc is running. And widows firewall setting are set to minimal, and on Linux machine stopped iptables service so that port 873 (default rsync port) is not blocked. What can be the possible reason that Linux machine is not able to connect to rsync-daemon on windows machine?

    Read the article

  • Why is mkfs overwriting the LUKS encryption header on LVM on RAID partitions on Ubuntu 12.04?

    - by Starchy
    I'm trying to setup a couple of LUKS-encrypted partitions to be mounted after boot-time on a new Ubuntu server which was installed with LVM on top of software RAID. After running cryptsetup luksFormat, the LUKS header is clearly visible on the volume. After running any flavor of mkfs, the header is overwritten (which does not happen on other systems that were setup without LVM), and cryptsetup will no longer recognize the device as a LUKS device. # cryptsetup -y --cipher aes-cbc-essiv:sha256 --key-size 256 luksFormat /dev/dm-1 WARNING! ======== This will overwrite data on /dev/dm-1 irrevocably. Are you sure? (Type uppercase yes): YES Enter LUKS passphrase: Verify passphrase: # hexdump -C /dev/dm-1|head -n5 00000000 4c 55 4b 53 ba be 00 01 61 65 73 00 00 00 00 00 |LUKS....aes.....| 00000010 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................| 00000020 00 00 00 00 00 00 00 00 63 62 63 2d 65 73 73 69 |........cbc-essi| 00000030 76 3a 73 68 61 32 35 36 00 00 00 00 00 00 00 00 |v:sha256........| 00000040 00 00 00 00 00 00 00 00 73 68 61 31 00 00 00 00 |........sha1....| # cryptsetup luksOpen /dev/dm-1 web2-var # mkfs.ext4 /dev/mapper/web2-var [..snip..] Creating journal (32768 blocks): done Writing superblocks and filesystem accounting information: done # hexdump -C /dev/dm-1|head -n5 # cryptsetup luksClose /dev/mapper/web2-var 00000000 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................| * 00000400 00 40 5d 00 00 88 74 01 66 a0 12 00 17 f2 6d 01 |.@]...t.f.....m.| 00000410 f5 3f 5d 00 00 00 00 00 02 00 00 00 02 00 00 00 |.?].............| 00000420 00 80 00 00 00 80 00 00 00 20 00 00 00 00 00 00 |......... ......| # cryptsetup luksOpen /dev/dm-1 web2-var Device /dev/dm-1 is not a valid LUKS device. I have also tried mkfs.ext2 with the same result. Based on setups I've done successfully on Debian and Ubuntu (but not LVM or Ubuntu 12.04), it's hard to see why this is failing.

    Read the article

  • Expected IOPS for log writing on PS6000X SAN?

    - by dssz
    Customer is experiencing poor Sybase ASE 15 performance on a PS6000X SAN with 16 X 450GB 10K in RAID-50. The server is a Dell R710 running 2003 server R2 64bit in ESX 4.0.0,256968 I've used sqlio to benchmark the sequential write performance of 4KB blocks on the drive. sqlio -kW -t1 -s600 -dE -o1 -fsequential -b4 -BH -LS sqliotestfile.dat Result is 1900 IOPS. However, when Sybase is running a sustained workload of small inserts SAN HQ shows a consistent 590 IOPS (and 100% 4K write activity). It also shows that the write latency increases to 1.2ms from <1ms. Monitoring and tests in Sybase demonstrate the performance problem is IO related and in particular there is a lot of wait time writing to the log. The SAN indicates that write caching is enabled. What IOPS should the SAN be capable of for 4k sequential write activity? Also, with write caching enabled, shouldn't the controller be batching up the 4K writes into something more efficient? Also, any tips on Sybase on ESX would be appreciated.

    Read the article

  • Can't find disk usage in one directory

    - by Xster
    Similar questions are asked frequently but no suggested answers solved my issue. I have some disk space usage that I can't find as well. In df Filesystem 1K-blocks Used Available Use% Mounted on /dev/sda1 144183992 136857180 2652 100% / udev 2013316 4 2013312 1% /dev tmpfs 808848 876 807972 1% /run none 5120 0 5120 0% /run/lock none 2022116 76 2022040 1% /run/shm overflow 1024 0 1024 0% /tmp I checked the inodes, I checked lsof for +L1 or deleted files, I rebooted, I checked for files hidden behind mounts but none of them were the issue. It grows periodically and I'm running out of things to delete to feed the beast. It's all in the home directory of the only user I have. In du in ~ du -h --max-depth=1 192K ./.nv 2.1M ./.gconf 12K ./Pictures 1.6M ./.launchpadlib 12K ./Public 24K ./.TemporaryItems 8.9M ./.cache 12K ./Network Trash Folder 28K ./.vnc 11M ./.AppleDB 48K ./.subversion 1.9G ./.xbmc 8.0K ./.AppleDesktop 12K ./.dbus 81M ./.mozilla 12K ./Music 160K ./.gnome2 44K ./Downloads 692K ./.zsh 236K ./.AppleDouble 64K ./.pulse 4.0K ./.gvfs 1.4M ./.adobe 44K ./.pki 44K ./.compiz-1 168K ./.config 1.4M ./.thumbnails 12K ./Templates 912K ./.gstreamer-0.10 8.0K ./.emacs.d 92K ./Desktop 1.3M ./.local 12K ./Ubuntu One 12K ./Documents 296K ./.fontconfig 12K ./.qt 12K ./.gnome2_private 20K ./.ssh 20K ./.mission-control 12K ./Videos 12K ./Temporary Items 640K ./.macromedia 124G . I can't find a way to figure out how it got to that 124G in that directory. There are no mount points in home.

    Read the article

  • Ubuntu raid 1 write errors

    - by Micah
    I have an Ubuntu server set up with two SATA drives in a RAID 1 configuration with MDADM. The machine is used to record raw video, which involves a lot of writing to the disk. Sometimes during video recording the computer will crash, will the following errors in kern.log: Mar 15 10:39:41 video kernel: [414501.629864] ata2.00: exception Emask 0x10 SAct 0x0 SErr 0x400100 action 0x6 Mar 15 10:39:41 video kernel: [414501.629870] ata2.00: BMDMA stat 0x26 Mar 15 10:39:41 video kernel: [414501.629875] ata2.00: SError: { UnrecovData Handshk } Mar 15 10:39:41 video kernel: [414501.629880] ata2.00: failed command: WRITE DMA EXT Mar 15 10:39:41 video kernel: [414501.629889] ata2.00: cmd 35/00:00:28:6d:f6/00:04:06:00:00/e0 tag 0 dma 524288 out Mar 15 10:39:41 video kernel: [414501.629891] res 51/84:b1:77:6e:f6/84:02:06:00:00/e0 Emask 0x30 (host bus error) Mar 15 10:39:41 video kernel: [414501.629896] ata2.00: status: { DRDY ERR } Mar 15 10:39:41 video kernel: [414501.629899] ata2.00: error: { ICRC ABRT } Mar 15 10:39:41 video kernel: [414501.629910] ata2.00: hard resetting link Mar 15 10:39:41 video kernel: [414501.973009] ata2.01: hard resetting link Mar 15 10:39:41 video kernel: [414502.482642] ata2.00: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Mar 15 10:39:41 video kernel: [414502.482658] ata2.01: SATA link down (SStatus 0 SControl 300) Mar 15 10:39:41 video kernel: [414502.546160] ata2.00: configured for UDMA/133 Mar 15 10:39:41 video kernel: [414502.546203] ata2: EH complete Is this the result of faulty drives? Is software RAID just not performant enough for data rates ~15 MB/s, even with a quad-core i7? Thanks for your help. Edit: cat /proc/mdstat returns this: Personalities : [linear] [multipath] [raid0] [raid1] [raid6] [raid5] [raid4] [raid10] md0 : active raid1 sdb1[1] sda1[0] 976760768 blocks [2/2] [UU] unused devices: <none>

    Read the article

  • Error with procmail script to use Maildir format

    - by bradlis7
    I have this code in /etc/procmailrc: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code to the sending user as well. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user. Sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Do I need a space between the two blocks? Thanks for the help.

    Read the article

  • Installing VirtualBox on BackTrack 5

    - by m0skit0
    I'm getting this error when running VirtualBox's installation script: $ sudo ~/Downloads/VirtualBox-4.1.14-77440-Linux_x86.run Verifying archive integrity... All good. Uncompressing VirtualBox for Linux installation........... VirtualBox Version 4.1.14 r77440 (2012-04-12T16:20:44Z) installer Removing previous installation of VirtualBox 4.1.14 r77440 from /opt/VirtualBox Installing VirtualBox to /opt/VirtualBox tar: Record size = 8 blocks Python found: python, installing bindings... Building the VirtualBox kernel modules Error! Bad return status for module build on kernel: 3.2.6 (i686) Consult the make.log in the build directory /var/lib/dkms/vboxhost/4.1.14/build/ for more information. ERROR: binary package for vboxhost: 4.1.14 not found Here's the log: $ cat /var/lib/dkms/vboxhost/4.1.14/build/make.log DKMS make.log for vboxhost-4.1.14 for kernel 3.2.6 (i686) Sun May 13 14:32:52 CEST 2012 make: Entering directory `/usr/src/linux-headers-3.2.6' /usr/src/linux-headers-3.2.6/arch/x86/Makefile:39: /usr/src/linux-headers-3.2.6/arch/x86/Makefile_32.cpu: No such file or directory make: *** No rule to make target `/usr/src/linux-headers-3.2.6/arch/x86/Makefile_32.cpu'. Stop. make: Leaving directory `/usr/src/linux-headers-3.2.6' /usr/src/linux-headers-3.2.6/arch/x86/ directory: $ ls /usr/src/linux-headers-3.2.6/arch/x86/ Kconfig Makefile ia32 lguest mm pci tools video Kconfig.cpu boot kernel lib net platform um xen Kconfig.debug crypto kvm math-emu oprofile power vdso Makefile references on "cpu" $ cat /usr/src/linux-headers-3.2.6/arch/x86/Makefile | grep cpu include $(srctree)/arch/x86/Makefile_32.cpu # FIXME - should be integrated in Makefile.cpu (Makefile_32.cpu) Before upgrading to 3.X I didn't have this problem, the script would install VB correctly. Any ideas on what might be causing this? Thanks in advance!

    Read the article

  • how to uninstall ubuntu 8 from ubuntu 10 dual boot

    - by umar
    I have ubuntu 8.04 and ubuntu 10.04 on my laptop, and i want to reclaim all the ubuntu 8 space so that i have just one operating system on my laptop. how can i do it? the output of sudo fdisk -l is as follows: sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x31a431a3 Device Boot Start End Blocks Id System /dev/sda1 * 1 4959 39833136 83 Linux /dev/sda2 4960 5233 2200905 82 Linux swap / Solaris /dev/sda3 5234 12852 61192552 83 Linux /dev/sda4 12852 19458 53062657 5 Extended /dev/sda5 12852 19182 50847744 83 Linux /dev/sda6 19182 19458 2213888 82 Linux swap / Solaris i dont know which of sda1, ..., sda 6 etc ubuntu 8 is on. how can i find that out? The actual task is that i think a lot of space is devoted to ubuntu 8, if there is no easy way to get rid of it, then i want to repartition the disk so that about 50 GB of hard disk space is given to ubuntu 10's home folder from the ubuntu 8's home folder. but i hope that there is an easy way to get rid of ubuntu 8 alrogether and just have ubuntu 10 on my system.

    Read the article

  • Dual booting Linux/Win7, Grub refuses to load Win7

    - by JohnB
    Decided to give Linux Mint a try (Ubuntu's interface annoys me), so I installed it with the intention of dual booting with Windows 7. Installation went fine, but now I can only boot into Linux Mint. Grub lists two Windows 7 menu options, but selecting either of them causes an "unknown file system" error and dumps me into a Grub recovery prompt. There, I have to manually reset the root and prefix options, as they reset hd0,msdos6 when they should be hd0,msdos5. I ran Boot Repair twice, once to fix grub errors, once to rebuild the MBR, but it didn't fix anything. Here is the log: http://paste.ubuntu.com/1029675/ fdisk output: Device Boot Start End Blocks Id System /dev/sda1 * 2048 206847 102400 7 HPFS/NTFS/exFAT /dev/sda2 206848 1486249145 743021149 7 HPFS/NTFS/exFAT /dev/sda3 1486249982 1953523711 233636865 5 Extended /dev/sda5 1486249984 1945141247 229445632 83 Linux /dev/sda6 1945143296 1953523711 4190208 82 Linux swap / Solaris grub.cfg: ### BEGIN /etc/grub.d/30_os-prober ### menuentry "Windows 7 (loader) (on /dev/sda1)" --class windows --class os { insmod part_msdos insmod ntfs set root='(hd0,msdos1)' search --no-floppy --fs-uuid --set=root 86184D18184D091F chainloader +1 } menuentry "Windows 7 (loader) (on /dev/sda2)" --class windows --class os { insmod part_msdos insmod ntfs set root='(hd0,msdos2)' search --no-floppy --fs-uuid --set=root 56D84F84D84F60FB chainloader +1 } ### END /etc/grub.d/30_os-prober ### I have found a few similar troubleshooting guides so far, but so far no amount of updating/configuring Grub has been successful. Last resort is, I suppose, use the W7 recovery disc and start over. Thanks in advance! Linux Mint 13 Maya, 64-bit Windows 7 Home Edition, 64-bit

    Read the article

  • Data recovery on a corrupted 3TB disk

    - by Mark K Cowan
    Short version I probably need software to run a deep-scan recovery (ideally on Linux) to find files on NTFS filesystem. The file data is intact, but the references are no longer present. Analogous to recovering data from a "quick-formatted" partition. Hopefully there is a smarter way available than deep-scan, one which would recover filenames and possibly paths. Long version I have a 3TB disk containing a load of backups. Windows 7 SP1 refused to detect the disk when plugged in directly via SATA, so I put it on a USB/SATA adaptor which seemed to work at first. The SATA/USB adaptor probably does not support disks over 2.2TB though. Windows first asked me if I wanted to 'format' the disk, then later showed me most of the contents but some folder were inaccessible. I stupidly decided to run a CHKDSK on my backup disk, which made the folders accessible but also left them empty. I connected this disk via SATA to my main PC (Arch Linux). I tried: testdisk ntfsundelete ntfsfix --no-action (to look for diagnostically relevant faults, disk was "OK" though) to no avail as the files references in the tables had presumably been zeroed out by CHKDSK, rather than using a typical journal'd deletion). If it is useful at all, a majority of the files that I want to recover are JPEG, Photoshop PSD, and MPEG-3/MPEG-4/AVI/MKV files. If worst comes to worst, I'll just design my own sector scanner and use some simple heuristic-driven analysis to recover raw binary blocks of data from the disk which appears to match the structures of the above file types. I am unfamiliar with the exact workings of NTFS but used to be proficient at recovering FAT32 systems with just a hex-editor, so I can provide any useful diagnostic information if you let me know how to find it! My priorities in ascending order of importance for choosing the accepted answer: Restores directory structure Recovers many filenames in addition to the file data Is free / very cheap Runs on Linux Recovers a majority of file data The last point is the most important, but the more of the higher points you match the more rep you'll probably get :)

    Read the article

  • Opera 10.5 RAM usage and Google Reader?

    - by David
    Hi all, Today I upgraded to Opera 10.5 from Google Chrome and I have two really important questions about it. 1) Is it normal for it to use SO MUCH RAM!!!!? Closing tabs doesn't help, but opening new ones add on to the usage. I can have just 4 tabs open and it goes up to the 300MB mark and I only have 1.5GB in my laptop, 596MB of it used by the graphics card so this really unacceptable. Is there a way to fix it? 2) Why does Google Reader feel so slow and unresponsive on it? It lags so bad when I just try scrolling through the page. I know Opera is known for being really smooth while scrolling through pages. There's also a white bar at the bottom of the page that I can get rid of. It blocks the "Next" and "Previous" buttons. The test between articles is also sort of intersecting each other and that just looks completely unattractive and that's something i'm not used with any web browser. I realize there's a built-in RSS reader, but it doesn't sync across multiple computers and is very late at updating. Here are my specs: Windows 7 Ultimate (x86), Intel Pentium M 1.86 GHz, 1.5GB RAM, ATI Mobility Radeon X600 (64MB dedicated, 596MB shared)

    Read the article

  • SQL transaction log backups conflicting with full backups?

    - by BradC
    On our SQL servers (2000, 2005, and 2008), we run full backups once a day in the evening, and transaction log backups every 2 hrs. We haven't really worried about these two processes conflicting, but lately we've run into some of the following issues: On one server, the trans log backup occasionally blocks the full backup, and must be manually stopped before the full backup can complete We sometimes end up with a massively-sized trans log backup file (sometimes larger than the full backup!) that seems to occur at the same time the full backup is running. I found a reference that indicate that these are "not allowed" to run at the same time, whatever that means: SQL 2000 Books Online and SQL 2005 Books Online. I'm not sure whether that means that the server will simply prevent them from running simultaneously, or if we ought to be explicitly stopping the log backups while the full backups are running. So are there known conflicts/issues between these? Does the answer differ between SQL versions? Should I have the trans log backup job check to see if the full backup is running before it executes? (and how do I do that...?)

    Read the article

  • Chipset fan on the frtiz - compressed air hasn't fixed anything - is there anything I can do?

    - by Anthony
    Yesterday, my computer started to make an annoying whining noise. Knowing that this is likely a fan issue, I opened the case and proceeded to determine which fan was causing the issue. I got some compressed air and tried cleaning out the dust around it (and the rest of the computer while I was at it). This hasn't seemed to fix the issue. Now, if it were just any fan, I would probably just replace the fan - they're relatively cheap after all. However, this is a special fan. Aside: For what its worth, I feel bad that the graphics card blocks part of the fan, but it is the only slot the graphics card fits, so I had no choice. After pulling out my motherboard user guide, it looks like this is a fan placed directly on top of the chipset. To be perfectly honest, I have no clue what the purpose of the chipset is - but it sounds important. After some quick research, I see that it is responsible for providing the bridge between my CPU, RAM and graphics, among other things. Just a quick search at Newegg tells me that chipset fans can be purchased at pretty reasonable prices (< 20 dollars). Is it practical to replace this fan? It is an old computer as computers go and I wouldn't be terribly upset to upgrade the motherboard and processor, so perhaps this is a sign. Hardware Specs: Motherboard: Asus A8N-E Chipset: NVIDIA nForce4 Ultra

    Read the article

  • Redundant OpenVPN connections with advanced Linux routing over an unreliable network

    - by konrad
    I am currently living in a country that blocks many websites and has unreliable network connections to the outside world. I have two OpenVPN endpoints (say: vpn1 and vpn2) on Linux servers that I use to circumvent the firewall. I have full access to these servers. This works quite well, except for the high package loss on my VPN connections. This packet loss varies between 1% and 30% depending on time and seems to have a low correlation, most of the time it seems random. I am thinking about setting up a home router (also on Linux) that maintains OpenVPN connections to both endpoints and sends all packets twice, to both endpoints. vpn2 would send all packets from home to vpn1. Return trafic would be send both directly from vpn1 to home, and also through vpn2. +------------+ | home | +------------+ | | | OpenVPN | | links | | | ~~~~~~~~~~~~~~~~~~ unreliable connection | | +----------+ +----------+ | vpn1 |---| vpn2 | +----------+ +----------+ | +------------+ | HTTP proxy | +------------+ | (internet) For clarity: all packets between home and the HTTP proxy will be duplicated and sent over different paths, to increase the chances one of them will arrive. If both arrive, the first second one can be silently discarded. Bandwidth usage is not an issue, both on the home side and endpoint side. vpn1 and vpn2 are close to each other (3ms ping) and have a reliable connection. Any pointers on how this could be achieved using the advanced routing policies available in Linux?

    Read the article

  • Bounce backs from web-generated e-mails are missing

    - by JerSchneid
    We use Google Apps to host my company's mail. On our website, we send some e-mails on behalf of our users. In those e-mails we include lines like this: Return-Path: <[email protected]> Sender: <[email protected]> Sending the messages works great (passes SPF tests), but in the case that the message is sent TO an invalid e-mail address, we expect to get a bounce back message sent to "[email protected]". That message never arrives. (If we send an e-mail manually from within the gmail interface to the same bad e-mail, the message does arrive). We used to receive the bounce back messages as expected, but it seems like they are always quietly blocked now (not in spam or anything). Is there a new policy that blocks bounce backs when the "From" does not match the "Return-Path" or something? We would really like to get these bounce-backs to verify the delivery of the messages. Is there any way to prevent them from being blocked?! Thank you!

    Read the article

  • What's up with stat on Mac OS X/Darwin? Or filesystems without names...

    - by Charles Stewart
    In response to a question I asked on SO, Give the mount point of a path, one respondant suggested using stat to get the device name associated with the volume of a given path. This works nicely on Linux, but gives crazy results on Mac OS X 10.4. For my system, df and mount give: cas cas$ df Filesystem 512-blocks Used Avail Capacity Mounted on /dev/disk0s3 58342896 49924456 7906440 86% / devfs 194 194 0 100% /dev fdesc 2 2 0 100% /dev <volfs> 1024 1024 0 100% /.vol automount -nsl [166] 0 0 0 100% /Network automount -fstab [170] 0 0 0 100% /automount/Servers automount -static [170] 0 0 0 100% /automount/static /dev/disk2s1 163577856 23225520 140352336 14% /Volumes/Snapshot /dev/disk2s2 409404102 5745938 383187960 1% /Volumes/Sparse cas cas$ mount /dev/disk0s3 on / (local, journaled) devfs on /dev (local) fdesc on /dev (union) <volfs> on /.vol automount -nsl [166] on /Network (automounted) automount -fstab [170] on /automount/Servers (automounted) automount -static [170] on /automount/static (automounted) /dev/disk2s1 on /Volumes/Snapshot (local, nodev, nosuid, journaled) /dev/disk2s2 on /Volumes/Sparse (asynchronous, local, nodev, nosuid) Trying to get the devices from the mount points, though: cas cas$ df | grep -e/ | awk '{print $NF}' | while read line; do echo $line $(stat -f"%Sdr" $line); done / disk0s3r /dev ???r /dev ???r /.vol ???r /Network ???r /automount/Servers ???r /automount/static ???r /Volumes/Snapshot disk2s1r /Volumes/Sparse disk2s2r Here, I'm feeding each of the mount points scraped from df to stat, outputting the results of the "%Sdr" format string, which is supposed to be the device name: Cf. stat(1) man page: The special output specifier S may be used to indicate that the output, if applicable, should be in string format. May be used in combination with: ... dr Display actual device name. What's going on? Is it a bug in stat, or some Darwin VFS weirdness? Postscript Per Andrew McGregor, try passing "%Sd" to stat for more weirdness. It lists some apparently arbitrary subset of files from CWD...

    Read the article

  • What's up with stat on Macos/Darwin? Or filesystems without names...

    - by Charles Stewart
    In response to a question I asked on SO, Give the mount point of a path, one respondant suggested using stat to get the device name associated with the volume of a given path. This works nicely on Linux, but gives crazy results on Macos 10.4. For my system, df and mount give: cas cas$ df Filesystem 512-blocks Used Avail Capacity Mounted on /dev/disk0s3 58342896 49924456 7906440 86% / devfs 194 194 0 100% /dev fdesc 2 2 0 100% /dev 1024 1024 0 100% /.vol automount -nsl [166] 0 0 0 100% /Network automount -fstab [170] 0 0 0 100% /automount/Servers automount -static [170] 0 0 0 100% /automount/static /dev/disk2s1 163577856 23225520 140352336 14% /Volumes/Snapshot /dev/disk2s2 409404102 5745938 383187960 1% /Volumes/Sparse cas cas$ mount /dev/disk0s3 on / (local, journaled) devfs on /dev (local) fdesc on /dev (union) on /.vol automount -nsl [166] on /Network (automounted) automount -fstab [170] on /automount/Servers (automounted) automount -static [170] on /automount/static (automounted) /dev/disk2s1 on /Volumes/Snapshot (local, nodev, nosuid, journaled) /dev/disk2s2 on /Volumes/Sparse (asynchronous, local, nodev, nosuid) Trying to get the devices from the mount points, though: cas cas$ df | grep -e/ | awk '{print $NF}' | while read line; do echo $line $(stat -f"%Sdr" $line); done / disk0s3r /dev ???r /dev ???r /.vol ???r /Network ???r /automount/Servers ???r /automount/static ???r /Volumes/Snapshot disk2s1r /Volumes/Sparse disk2s2r Here, I'm feeding each of the mount points scraped from df to stat, outputing the results of the "%Sdr" format string, which is supposed to be the device name: Cf. stat(1) man page: The special output specifier S may be used to indicate that the output, if applicable, should be in string format. May be used in combination with: ... dr Display actual device name. What's going on? Is it a bug in stat, or some Darwin VFS weirdness? Postscript Per Andrew McGregor, try passing "%Sd" to stat for more weirdness. It lists some apparently arbitrary subset of files from CWD...

    Read the article

  • how to correctly mount fat32 partition in Ubuntu in order to preserve case

    - by Dean
    I've found there are couple of problems might be related how my FAT32 partition was mounted. I hope you can help me to solve the problem. I also included the command I used to help others when they find this post, sorry to those might feel I should use less space. I've the following file structures on my disk dean@notebook:~$ sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Disk identifier: 0x08860886 Device Boot Start End Blocks Id System /dev/sda1 * 1 13 102400 7 HPFS/NTFS Partition 1 does not end on cylinder boundary. /dev/sda2 13 5737 45978624 7 HPFS/NTFS /dev/sda3 5738 10600 39062047+ 83 Linux /dev/sda4 10601 19457 71143852+ 5 Extended /dev/sda5 10601 11208 4883728+ 82 Linux swap / Solaris /dev/sda6 11209 15033 30720000 b W95 FAT32 /dev/sda7 15033 19457 35537920 7 HPFS/NTFS In the etc/fstab I've got UUID=91c57a65-dc53-476b-b219-28dac3682d31 / ext4 defaults 0 1 UUID=BEA2A8AFA2A86D99 /media/NTFS ntfs-3g quiet,defaults,locale=en_US.utf8,umask=0 0 0 UUID=0C0C-9BB3 /media/FAT32 vfat user,auto,utf8,fmask=0111,dmask=0000,uid=1000 0 0 /dev/sda5 swap swap sw 0 0 /dev/sda1 /media/sda1 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 /dev/sda2 /media/sda2 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 I checked my id using id and I've got dean@notebook:~$ id uid=1000(dean) gid=1000(dean) groups=4(adm),20(dialout),24(cdrom),46(plugdev),103(fuse),104(lpadmin),115(admin),120(sambashare),1000(dean) I don't know why with these settings I still have problem of using svn like in this one Thank you for your help!

    Read the article

  • Can't mount FAT32 drive under Ubuntu Linux

    - by Josh
    I have a 320GB USB drive with a single large FAT32 partition. The volume mounts perfectly fine on my Mac OS X 10.5.8 machine and Disk Utility on the mac reports no issues with the volume. I can read/write all data on the drive. However when I connect the drive to my Ubuntu 9.10 Karmic system, the partition does not mount. dmesg|tail says: [ 2752.334822] scsi3 : SCSI emulation for USB Mass Storage devices [ 2752.335040] usb-storage: device found at 3 [ 2752.335044] usb-storage: waiting for device to settle before scanning [ 2757.330301] usb-storage: device scan complete [ 2757.331005] scsi 3:0:0:0: Direct-Access WD 3200AAK External 1.65 PQ: 0 ANSI: 0 [ 2757.331772] sd 3:0:0:0: Attached scsi generic sg2 type 0 [ 2757.355647] sd 3:0:0:0: [sdb] 625142448 512-byte logical blocks: (320 GB/298 GiB) [ 2757.360737] sd 3:0:0:0: [sdb] Write Protect is off [ 2757.360749] sd 3:0:0:0: [sdb] Mode Sense: 00 00 00 00 [ 2757.360755] sd 3:0:0:0: [sdb] Assuming drive cache: write through [ 2757.367618] sd 3:0:0:0: [sdb] Assuming drive cache: write through [ 2757.367631] sdb: sdb1 [ 2762.797622] sd 3:0:0:0: [sdb] Assuming drive cache: write through [ 2762.797636] sd 3:0:0:0: [sdb] Attached SCSI disk [ 2822.866228] FAT: bogus number of reserved sectors [ 2822.866237] VFS: Can't find a valid FAT filesystem on dev sdb1. When I run fsck.vfat -a /dev/sdb1 I get: root@cartman:~# fsck.vfat -a /dev/sdb1 dosfsck 3.0.3, 18 May 2009, FAT32, LFN Logical sector size is zero. Googling "vfat Logical sector size is zero" produced no consensus as to the solution. I would prefer not to have to completely reformat the disk if possible because it contains about 280GB of data I would rather not have to find a temporary home for. Any suggestions?

    Read the article

  • Move an existing RAID 5 array from Ubuntu to Gentoo

    - by Cocoabean
    I have a 64-bit Ubuntu machine with a 4-disk RAID 5 using software raid (md). I've been able to boot an Ubuntu LiveCD and recognize the array with a simple mdadm -A /dev/md0. It was easy to mount after that and nothing had to rebuild. I'm installing Gentoo on this box now (multi-boot, non-RAID root partition) and I have md auto-detect turned on in the kernel. When I boot Gentoo I get: "invalid superblock magic on sdd" for each of the drives in the array. I boot back to Ubuntu and they mount no problem. I tried copying the mdadm.conf that works in Ubuntu to Gentoo, and then ran mdadm -A /dev/md0 but it reports that there is no array named md0. I don't want to lose data (obviously) and I don't want to have to let the RAID rebuild every time I switch between OSes. Any help is appreciated. Both are using mdadm 3.1.4 Both are running 64-bit kernels. mdadm -D /dev/md0 from Ubuntu yields: http://pastebin.com/5gj2QNkV UPDATE: After rebooting I noticed that it still complains about invalid blocks, but cat /proc/mdstat shows an inactive /dev/md127 with the same disks as my raid. I want to mount it but I don't want to get stuck waiting for a rebuild or destroying it inadvertently. mdadm -D /dev/md127 Here is pastebin of mdadm -D /dev/md127 on gentoo: http://pastebin.com/gDCWn0Rn UPDATE II: dmesg output about 'invalid raid superblocks' http://paste.ubuntu.com/885471/ fdisk -l from Ubuntu, /dev/md0 does not have any partitions but I do have it mounted and accessible: http://paste.ubuntu.com/885475/

    Read the article

  • Apache ProxyPass with SSL

    - by BBonifield
    I have a QA setup that consists of multiple internal development servers and one world-accessible provisioning machine that is setup to proxy pass the web traffic. Everything works fine for non-SSL requests, but I'm having a hard time getting the SSL logic working as well. Here's a few example vhost blocks. <VirtualHost 192.168.168.101:443> ProxyPreserveHost On SSLProxyEngine On ProxyPass / https://192.168.168.111/ ServerName dev1.site.com </VirtualHost> <VirtualHost 192.168.168.101:80> ProxyPreserveHost On ProxyPass / http://192.168.168.111/ ServerName dev1.site.com </VirtualHost> <VirtualHost 192.168.168.101:443> ProxyPreserveHost On SSLProxyEngine On ProxyPass / https://192.168.168.111/ ServerName dev2.site.com </VirtualHost> <VirtualHost 192.168.168.101:80> ProxyPreserveHost On ProxyPass / http://192.168.168.111/ ServerName dev2.site.com </VirtualHost> I end up seeing the following error in the provisioner's error log. [Fri Jan 28 12:50:59 2011] [warn] [client 1.2.3.4] proxy: no HTTP 0.9 request (with no host line) on incoming request and preserve host set forcing hostname to be dev1.site.com for uri / As well as the following entry in the destination QA machine's access log. 192.168.168.101 - - [22/Feb/2011:08:34:56 -0600] "\x16\x03\x01 / HTTP/1.1" 301 326 "-" "-"

    Read the article

  • CentOS OpenVZ fail to boot after kernel update

    - by SkechBoy
    After upgrading to latest OpenVZ kernel CentOS server won't boot. When i try go boot the latest kernel server is stuck at this point: (note that images are taken from virtual kvm) http://i.stack.imgur.com/4lusz.jpg Then i try to start the server on some old kernels and than i get this error message: kernel panic - not syncing - attempted to kill init better shown on this image: http://i.stack.imgur.com/2SReF.jpg Here is some useful information fdisk -l WARNING: GPT (GUID Partition Table) detected on '/dev/sda'! The util fdisk doesn't support GPT. Use GNU Parted. Disk /dev/sda: 2995.7 GB, 2995739688960 bytes 255 heads, 63 sectors/track, 364211 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x0004c4e4 Device Boot Start End Blocks Id System /dev/sda1 1 523 4199044+ 82 Linux swap / Solaris /dev/sda2 524 785 2104515 83 Linux /dev/sda3 786 261869 2097157230 83 Linux /dev/sda4 261870 364211 822062115 83 Linux /etc/fstab proc /proc proc defaults 0 0 none /dev/pts devpts gid=5,mode=620 0 0 /dev/sda1 none swap sw 0 0 /dev/sda2 /boot ext3 defaults 0 0 /dev/sda3 / ext3 defaults 0 0 /dev/sda4 /home ext3 defaults 0 0 and grub config file: title OpenVZ (2.6.18-274.18.1.el5.028stab098.1) root (hd0,1) kernel /vmlinuz-2.6.18-274.18.1.el5.028stab098.1 ro root=/dev/sda3 vga=0x317 selinux=0 initrd /initrd-2.6.18-274.18.1.el5.028stab098.1.img title OpenVZ (2.6.18-274.7.1.el5.028stab095.1) root (hd0,1) kernel /vmlinuz-2.6.18-274.7.1.el5.028stab095.1 ro root=/dev/sda3 vga=0x317 selinux=0 initrd /initrd-2.6.18-274.7.1.el5.028stab095.1.img title OpenVZ (2.6.18-194.8.1.el5.028stab070.4) root (hd0,1) kernel /vmlinuz-2.6.18-194.8.1.el5.028stab070.4 ro root=/dev/sda3 vga=0x317 initrd /initrd-2.6.18-194.8.1.el5.028stab070.4.img Any help is greatly appreciated Thanks.

    Read the article

  • Why do I get a DegradedArray event with mdadm

    - by azera
    Hello Just so we're clear on what's happening: I bought 4 new sata 2 drives, with the intent of using them in a raid5 all drive are fully recognised by both my bios and my linux box (gentoo) I created a raid5 array, fiddled a bit with it to understand how it works, how to monitor ect At some point, this triggered a degradedarray event, even though the array is brand new. I tried to stopping the array and recreating a new array with the same drive but the new array starts degraded too. here is what I used to create it mdadm --create -l5 -n4 /dev/md/md0-r5 /dev/sdb /dev/sdd /dev/sde /dev/sdf here are the output from my /proc/mdstat and mdadm --detail --scan **mdstat** Personalities : [raid0] [raid1] [raid6] [raid5] [raid4] [raid10] md127 : active raid5 sdf[4] sde[2] sdd[1] sdb[0] 4395415488 blocks level 5, 64k chunk, algorithm 2 [4/3] [UUU_] [>....................] recovery = 2.8% (41689732/1465138496) finish=890.3min speed=26645K/sec unused devices: <none> **detail** ARRAY /dev/md/md0-r5 metadata=0.90 spares=1 UUID=453e2833:81f22a74:64188b84:66721085 As such I have a couple questions: does a raid5 array always start in degraded mode at first ? why does sdf have the number 4 between bracket instead of 3, why does it see a spare disk and why is the 4th drive marked with _ instead of U ? (bad configuration ?) How can I recreate the array from scratch, do i have to format each drive on its own before recreating it ? Thanks for any help, I'm not sure about what I should do at the moment

    Read the article

< Previous Page | 205 206 207 208 209 210 211 212 213 214 215 216  | Next Page >