Search Results

Search found 13262 results on 531 pages for 'complete validation'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 230/531 | < Previous Page | 226 227 228 229 230 231 232 233 234 235 236 237  | Next Page >

  • Installing a new SQL Server instance fails

    - by Rubio
    I've previously in my setup installed SQL Server Express 2005. Now I've switched to SQL Server Express 2008. I updated the command line parameters to those documented for the latter. If the comp already has SQL Server Express 2008 installed, my installer should create a new instance. The command line parameters are as follows: /ACTION=Install /FEATURES=SQLEngine /QS /INSTANCENAME=ABCD /SECURITYMODE=SQL /SAPWD=CunningPassword The requested instance name does not exist on the target machine. This will end in an error -2068643838. The logs show the following error: "No features were installed during the setup execution. The requested features may already be installed." If I remove the /QS parameter and try to install interactively, I'll get as far as the Feature Selection page. The UI shows three options, Instance Features, Shared Features and Redistributable Features. Whatever I select, clicking Next results in the same error (There are validation errors on this page). Any ideas anyone?

    Read the article

  • JQUERY animate Delay?

    - by AnApprentice
    I'm using JQUERY animate to show a banner at the top of the page, which is a DIV that is set to top -60 to hide it. I'm using the following JS call to show the div: // Animation $('#message-dock').animate({ top: 0 }, 500, function() { // Animation complete. }); What I can't figure out is for some reason there is an unwanted delay before I start seeing the div and I can't figure out why? Any Ideas?

    Read the article

  • Auto-Completion in Unix VI editor

    - by IllustratedInsomnia
    Hey guys, after using graphical IDE's like Visual Studio, I'm used to pressing CTRL+Space to auto-complete a variable or function name. Now, I know such a thing isn't completely possible in VI, but I heard there was a list of commands that could be mapped that allowed automatic completion of variables and functions in the current file opened. Does anyone know what this sequence is? Thanks in advance.

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • How can I create an editable combo box in HTML/Javascript?

    - by Christian Davén
    I need to let users select an item from a dropdown list, but also allow them to instead enter any text, even if it doesn't match an item in the list. How can I achieve this on a web page with HTML and Javascript? The select field doesn't let users enter text, and the input text field doesn't show the preferred alternatives. All items must show if the user opens the dropdown, so it can't be a simple auto-complete that only shows matching items.

    Read the article

  • Restoring older firmware through XCode?

    - by Moshe
    I'm trying to restore iPhone OS 3.1.3 to a 3GS that has been upgraded to iOS 4. iTunes refuses to complete the install. What needs to be done? I am currently using the GM XCode. Should I be using the latest public stable version instead? Update: XCode reports that "The baseband cannot be rolled back".

    Read the article

  • Javascript expando objects

    - by xyz
    What are expando objects in javascripts? For what purpose we need this ? Any complete example will be appreciated I found 1 article here Javascript: The red-headed stepchild of web development Thanks

    Read the article

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

  • Python urllib.urlopen() call doesn't work with a URL that a browser accepts

    - by Charles Anderson
    If I point Firefox at http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes, I get a page of HTML. But if I try this in Python: import urllib site = 'http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes' req = urllib.urlopen(site) text = req.read() I get the following: 500 Internal Server Error The server encountered an internal error or misconfiguration and was unable to complete your request. What am I doing wrong?

    Read the article

  • Same keyword for two purposes in java? [closed]

    - by gurukulki
    Possible Duplicates: Same keyword for two purposes in java? Same keyword for two purposes in java? As we use "default" keyword as a access specifier, and it can be used in switch statements as well with complete different purpose, So i was curious that is there any other keywords in java which can be used in more then one purposes

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • XP Mode under Win 7 Professional: Windows Activation Update failure despite activated Windows

    - by Cristina
    I am trying to install Windows XP Mode from here: http://www.microsoft.com/windows/virtual-pc/download.aspx (the Hardware-Assisted Virtualization Detection Tool has given me the green for proceeding) Even though my Windows has been activated a year or so ago, the download button leads me to a splash screen saying "Windows validation required". I am next forced to download a WindowsActivationUpdate.exe which, after downloading some mysterious "update", fails with the error message "Update installation failed, error information 0x80070002" (rough translation from German). I've tried running it both normally and as Administrator. What could be the problem?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What kind of SSL Cert do I need and where do I get it?

    - by chacham15
    I want to have subdomains with SSL within my domain. The main difference is that each subdomain is hosted by a different person with a different public key/private key pair. Let me illustrate with an example: User send his public key and requests subdomain from foo.com User is added and assigned subdomain bar (bar.foo.com). Users public key is stored for future validation against bar.foo.com User goes to bar.foo.com and see's a validated SSL connection. From what I gather, this means that I need to create a CA, which is fine. The problem is that from what I recall, a CA needs a special sort of SSL Cert. How do I go about getting this?

    Read the article

  • Is it possible to download a .zip file into iPhone when user clicks a link inside UIWebView?

    - by Horace Ho
    In a new app, I plan to let users download their own files and stored them inside iPhone. The process is typically: iPhone present a web page by UIWebView, in which there are several links to .zip files the user browser the page and click on one of the .zip file link iPhone downloads the file into the iPhone document folder, closes WebView, acknowledges the user when download is complete How can that be done? Thanks

    Read the article

  • Detecting I/O errors in a NON BLOCKING SOCKET

    - by ripunjay-tripathi-gmail-com
    I am writing a client - server system in which I used NON-BLOCKING sockets. My problem is to detect error { while performing send() or write() } that may occur while data transfer. Example lets say, while the data is being transferred the peer crashes. Another case there is some network problem, something like wire unplugged etc. As of now, I am using a high level ACK, that peer sends after receiving the complete data. Ripunjay Tripathi

    Read the article

  • Is there a guide to debugging Java processes in Eclipse across OSs?

    - by Jekke
    I have an application written in Java to run on Linux. I'm developing in Eclipse under windows. I would like to run the code on the Linux box and debug it on the Windows one remotely. I've found some information about how to do so, but it's pretty sparse. Does anyone have (or can point to) a complete explanation of the process? Any help would be appreciated.

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • Compare structures of two databases?

    - by streetparade
    Hello, I wanted to ask whether it is possible to compare the complete database structure of two huge databases. We have two databases, the one is a development database, the other a production database. I've sometimes forgotten to make changes in to the production database, before we released some parts of our code, which results that the production database doesn't have the same structure, so if we release something we got some errors. Is there a way to compare the two, or synchronize?

    Read the article

  • Consuming and Provide webservice to client

    - by Jason
    Hi, I got a requirement to implement a website in java which will utilize another web service. Here is the scenario I am providing the product compare results to client and assume i am using amazon and other web services. Initially client invoke our web service and then we fetch results from merchants. I don't want complete solution just look for consuming and create web service in java example. I searched on google but couldn't found relevant example. I prefer if example is using eclipse :) Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 226 227 228 229 230 231 232 233 234 235 236 237  | Next Page >