Search Results

Search found 13262 results on 531 pages for 'complete validation'.

Page 233/531 | < Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to remove control chars from UTF8 string

    - by Mimefilt
    Hi there, i have a VB.NET program that handles the content of documents. The programm handles high volumes of documents as "batch"(2Million documents;total 1TB volume) Some of this documents may contain control chars or chars like f0e8(http://www.fileformat.info/info/unicode/char/f0e8/browsertest.htm). Is there a easy and especially fast way to remove that chars?(except space,newline,tab,...) If the answer is regex: Has anyone a complete regex for me? Thanks!

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • uiimage oncomplete iphone

    - by dubbeat
    Is there such a thing as an "on load complete" for images in iphone? I want to be able to destroy a UIActivity indicator once and image is loaded. What the general best practice for doing this?

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Read / write program in java using JChooser

    - by Casper Marcussen
    Hello everyone Didn't want to bother people in here, but since i am under a time pressure, i am desperate to get help. My questions is how to link the file choosen from a JChooser to a file, and how to converte it to stringm being able to display and edit it in a TextArea. i hav ethe GUI set up using swing, but the link between actionListener and the Jchooser is not complete Any help would be much appreciated code: http://pastebin.com/p3fb17Wi

    Read the article

  • Client server architecture question

    - by Shane Fulmer
    I am working on a client server system, and am running into issues where multiple clients are executing an action at the same time. We are able to solve this by locking on the critical section of code, which ensures that the first client will complete the action before the second client enters the code block. My question is this: our server is also clustered, so multiple instances of the server itself can exist, which recreates the same problem as before. How could we solve this problem? Thanks!

    Read the article

  • sending data packet just before closing socket

    - by xopht
    Before disconnect the client, the server wants to send some info to the client - why do I(server) disconnect you(client). If I send packet to the info and close the client socket immediately, closesocket() returns -1 and if I use linger option to work closesocket() successfully, the info cannot be sent completely. How can I complete this and is it possible to know socket buffer is empty(means my packet sent all)? thx.

    Read the article

  • Cucumber : Size of features

    - by David Lyod
    Im new to testing with cucumber and have a question regarding the size of a 'Feature'. Assume you can add a collection of items to a list and do the usual CRUD , is it preferred to create one feature for this complete set of CRUD actions or a feature for each? What is the preferred/accepted method ? At what point does an action become a feature itself ?

    Read the article

  • Where is shared_ptr?

    - by Jake
    I am so frustrated right now after several hours trying to find where shared_ptr is located. None of the examples I see show complete code to include the headers for shared_ptr (and working). Simply stating "std" "tr1" and "" is not helping at all! I have downloaded boosts and all but still it doesn't show up! Can someone help me by telling exactly where to find it? Thanks for letting me vent my frustrations!

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

  • Outlook 2007 Autodiscover Out Of Office Assistant

    - by Adam
    Hi We are having an issue trying to set the Out Of Office Assistant through Outlook 2007. It works fine through OWA but all of the users cannot set it through Outlook. They get: your out of office settings cannot be displayed because the server is unavailable We have run through: https://www.testexchangeconnectivity.com/ and we get this error: Certificate name validation error More info: Host name xxxxxxxxxxxx.com does not match any name found on the server certificate CN=*.securedwebspace.com, OU=Domain Control Validated - RapidSSL(R), OU=See www.rapidssl.com/resources/cps (c)09, OU=GT93715821, O=*.securedwebspace.com, C=GB Any ideas on how we can fix this? (Everything else seems to work fine - Its just the Out of Office through Outlook) Server is SBS 2008 with Exchange 2007 installed. Thanks

    Read the article

  • Convert Dashes to CamelCase in PHP

    - by Kirk
    Can someone help me complete this PHP function? I want to take a string like this: 'this-is-a-string' and convert it to this: 'thisIsAString': function dashesToCamelCase($string, $capitalizeFirstCharacter = false) { // Do stuff return $string; }

    Read the article

  • iis 7.0 Internal 500 Error

    - by bill
    Hi All, i am tearing my hair out. I have read every post on the internet and cannot for the life of me figure out HOW to force IIS 7.0 on 2008 to display detailed errors. I have published a .net 4.0 app. i am at a complete loss. thanks!

    Read the article

  • cvWarpPerspective, having transformation matrix, how to extract the quad points?

    - by Stevecao
    I have the 3x3 transformation matrix that goes through the cvWarpPerspective, I would like to extract the four corner coordinates value. CvMat* M; M = xxxxxxxxxxx ;// Matrix was generated by a certain process cvWarpPerspective( img, transformed, M, CV_INTER_LINEAR + CV_WARP_FILL_OUTLIERS, cvScalarAll( 0 ) ); // this creates a complete black new image transformed, from this image i would like to know the 4 corner coordinates

    Read the article

  • Calendar event correct PHP script

    - by Marin
    Hello everybody! I need somebody(If you have time:) ) to help me find a good Calendar event script that functions:)Please help me.Thank you in advance:) Ps:I am looking for a complete web application which will run on a WAMP environment and has a GUI based installer or minimal command line installation requirements

    Read the article

< Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >