Search Results

Search found 13262 results on 531 pages for 'complete validation'.

Page 231/531 | < Previous Page | 227 228 229 230 231 232 233 234 235 236 237 238  | Next Page >

  • Is there a guide to debugging Java processes in Eclipse across OSs?

    - by Jekke
    I have an application written in Java to run on Linux. I'm developing in Eclipse under windows. I would like to run the code on the Linux box and debug it on the Windows one remotely. I've found some information about how to do so, but it's pretty sparse. Does anyone have (or can point to) a complete explanation of the process? Any help would be appreciated.

    Read the article

  • Best editor for CodeIgniter?

    - by Rismo
    I'm learning CodeIgniter and I come from Microsoft Visual Studio so I'm used to the auto complete feature. I've been using notepad++ so far but I wonder if anyone knows an editor that works better with CodeIgniter. I would love to see features like: Right-click - Add new model Right-click - Add new view Autocomplete with CodeIgniter helpers and libraries

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • Calling pthread_cond_signal without locking mutex

    - by Maysam
    Hi, I read somewhere that we should lock the mutex before calling pthread_cond_signal and unlock the mutext after calling it: The pthread_cond_signal() routine is used to signal (or wake up) another thread which is waiting on the condition variable. It should be called after mutex is locked, and must unlock mutex in order for pthread_cond_wait() routine to complete. My question is: isn't it OK to call pthread_cond_signal or pthread_cond_broadcast methods without locking the mutex?

    Read the article

  • Forms Authentication across Sub-Domains on local IIS

    - by Parminder
    I asked this question at SO http://stackoverflow.com/questions/8278015/forms-nauthentication-across-sub-domains-on-local-iis Now asking it here. I know a cookie can be shared across multiple subdomains using the setting <forms name=".ASPXAUTH" loginUrl="Login/" protection="Validation" timeout="120" path="/" domain=".mydomain.com"/> in Web.config. But how to replicate same thing on local machine. I am using windows 7 and IIS 7 on my laptop. So I have sites localhost.users/ for my actual site users.mysite.com localhost.host/ for host.mysite.com and similar.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

  • WPF windows locked when calling webservice. Even when run asynchronously

    - by SumGuy
    Hi there. I'm having a big problem when calling a web service from my WPF application. The application/window locks until the process has completed. I've attempted to run this asynchronously but the problem still persists. Currently, the web service call I'm making can last 45-60 seconds. It runs a process on the server to fetch a big chunk of data. As it take a little while I wanted to have a progress bar moving indeterminately for the user to see that the application hasn't stalled or anything (you know how impatatient they get). So: private void btnSelect_Click(object sender, RoutedEventArgs e) { wDrawingList = new WindowDrawingList(systemManager); AsyncMethodHandler caller = default(AsyncMethodHandler); caller = new AsyncMethodHandler(setupDrawingList); // open new thread with callback method caller.BeginInvoke((Guid)((Button)sender).Tag, MyAsyncCallback, null); } Click a button and the app will create the form that the async stuff will be posted to and set up the async stuff calling the async method. public bool setupDrawingList(Guid ID) { if (systemManager.set(ID)) { wDrawingList.Dispatcher.Invoke(DispatcherPriority.Background, new Action(() => { wDrawingList.ShowForm(); Hide(); })); return true; } return false; } This is the async method. The showForm method contains the calls to setup the new form including the monster web service call public void MyAsyncCallback(IAsyncResult ar) { // Because you passed your original delegate in the asyncState parameter of the Begin call, you can get it back here to complete the call. MethodDelegate dlgt = (MethodDelegate)ar.AsyncState; // Complete the call. bool output = dlgt.EndInvoke(ar); try { // Retrieve the delegate. AsyncResult result = (AsyncResult)ar; AsyncMethodHandler caller = (AsyncMethodHandler)result.AsyncDelegate; // Because this method is running from secondary thread it can never access ui objects because they are created // on the primary thread. // Call EndInvoke to retrieve the results. bool returnValue = caller.EndInvoke(ar); // Still on secondary thread, must update ui on primary thread UpdateUI(returnValue == true ? "Success" : "Failed"); } catch (Exception ex) { string exMessage = null; exMessage = "Error: " + ex.Message; UpdateUI(exMessage); } } public void UpdateUI(string outputValue) { // Get back to primary thread to update ui UpdateUIHandler uiHandler = new UpdateUIHandler(UpdateUIIndicators); string results = outputValue; // Run new thread off Dispatched (primary thread) this.Dispatcher.Invoke(System.Windows.Threading.DispatcherPriority.Normal, uiHandler, results); } public void UpdateUIIndicators(string outputValue) { // update user interface controls from primary UI thread sbi3.Content = "Processing Completed."; } Any help or theories are appreciated. I'm at a loss. Thanks in advance

    Read the article

  • rails, activerecord callbacks not saving

    - by Joseph Silvashy
    I have a model with a callback that runs after_update: after_update :set_state protected def set_state if self.valid? self.state = 'complete' else self.state = 'in_progress' end end But it doesn't actually save those values, why not? Regardless of if the model is valid or not it won't even write anything, even if i remove the if self.valid? condition, I can't seem to save the state. Um, this might sound dumb, do I need to run save on it?

    Read the article

  • gae error : Error: Server Error, how to debug it .

    - by zjm1126
    when i upload my project to google-app-engine , it show this : Error: Server Error The server encountered an error and could not complete your request. If the problem persists, please report your problem and mention this error message and the query that caused it. why ? how can i debug this error ? thanks

    Read the article

  • Consuming and Provide webservice to client

    - by Jason
    Hi, I got a requirement to implement a website in java which will utilize another web service. Here is the scenario I am providing the product compare results to client and assume i am using amazon and other web services. Initially client invoke our web service and then we fetch results from merchants. I don't want complete solution just look for consuming and create web service in java example. I searched on google but couldn't found relevant example. I prefer if example is using eclipse :) Thanks

    Read the article

  • Nested Transaction issues within custom Windows Service

    - by pdwetz
    I have a custom Windows Service I recently upgraded to use TransactionScope for nested transactions. It worked fine locally on my old dev machine (XP sp3) and on a test server (Server 2003). However, it fails on my new Windows 7 machine as well as on 2008 Server. It was targeting 2.0 framework; I tried targeting 3.5 instead, but it still fails. The strange part is really in how it fails; no exception is thrown. The service itself merely times out. I added tracing code, and it fails when opening the connection for Database lookup #2 below. I also enabled tracing for System.Transactions; it literally cuts out partway while writing the block for the failed connection. We ran a SQL trace, but only the first lookup shows up. I put in code traces, and it gets to the trace the line before the second lookup, but nothing after. I've had the same experience hitting two different SQL servers (both are SQL 2005 running on Server 2003). The connection string is utilizing a SQL account (not Windows integration). All connections are against the same database in this case, but given the nature of the code it is being escalated to MSDTC. Here's the basic code structure: TransactionOptions options = new TransactionOptions(); options.IsolationLevel = System.Transactions.IsolationLevel.ReadCommitted; using (TransactionScope scope = new TransactionScope(TransactionScopeOption.RequiresNew, options)) { // Database lookup #1 TransactionOptions options = new TransactionOptions(); options.IsolationLevel = Transaction.Current != null ? Transaction.Current.IsolationLevel : System.Transactions.IsolationLevel.ReadCommitted; using (TransactionScope scope = new TransactionScope(TransactionScopeOption.Required, options)) { // Database lookup #2; fails on connection.Open() // Database save (never reached) scope.Complete();<br/> } scope.Complete();<br/> } My local firewall is disabled. The service normally runs using Network Service, but I also tried my user account (same results). The short of it is that I use the same general technique widely in my web applications and haven't had any issues. I pulled out the code and ran it fine within a local Windows Form application. If anyone has any additional debugging ideas (or, even better, solutions) I'd love to hear them.

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Rails wiki highlight/strikethrough version differences between article versions

    - by mark
    Hi I'm wondering how to implement highlighting of changes to user edited articles on a wiki style rails project. Since articles may be fairly lengthy I'd ideally like strikethrough and highlighting, similar to github and wikipedia for example. Despite searching around the net I've not really come up with much, apart from instiki which is a complete wiki application. Thanks in advance for any advice.

    Read the article

  • gmail drawing send

    - by siran
    is there some online web app which would let me make a vector drawing, and give me the choice to write some text and send it through gmail ? for the magic to be complete, the web app would save my drawing as png (or whatever) and attach it to the sent email... i guess i would have to give the webapp my gmail account info so it can send it from my account...

    Read the article

  • How do I set up a one way trust when some DCs are firewalled off from each other?

    - by makerofthings7
    I have two Windows 2008 forests in Win2003 mode and I need to set up a one way trust between them. The validation button in Domains And Trusts works in one forest but not in the other. I think this is because not all DCs can see all the other DCs. I'm not sure if I need to set up the hosts file, so I did so with company.com in the respective domain along with the relevant DC. (do I need _msdcs _tcp zones etc) How do I set up a one way trust when some DCs are firewalled off from each other?

    Read the article

  • protect_from_forgery & Unobtrusive Javascript

    - by Matt Grande
    Hi all, I have some javascript making an ajax call in my Rails site: $.ajax({type: "PUT", url: url, data: { dummy: data }, complete: function(data) {}}); When Rails gets it, it throws back an ActionController::InvalidAuthenticityToken Error. I'd like to keep the protect_from_forgery stuff in there, if possible... But I'm at a loss for how can I pass the auth token from a javascript file? Can anyone help me out?

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • How to add django modules to pydiction dictionary?

    - by speck
    I'm trying to use pydiction to autocomplete Python/Django statements in VIM Editor. When I try to add django modules to complete-dic using this: python pydiction.py /usr/lib/pymodules/python2.6/django or: python pydiction.py /usr/lib/pymodules/python2.6/django/__init__.py I receive this error: Couldn't import: (...). Import by filename is not supported. Thanks! Pydiction: http://www.vim.org/scripts/script.php?script_id=850

    Read the article

  • Difference between Python urllib.urlretrieve() and wget

    - by jrdioko
    I am trying to retrieve a 500mb file using Python, and I have a script which uses urllib.urlretrieve(). There seems to some network problem between me and the download site, as this call consistently hangs and fails to complete. However, using wget to retrieve the file tends to work without problems. What is the difference between urlretrieve() and wget that could cause this difference?

    Read the article

< Previous Page | 227 228 229 230 231 232 233 234 235 236 237 238  | Next Page >