Search Results

Search found 8286 results on 332 pages for 'defined'.

Page 235/332 | < Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >

  • PHP - Find parent key of array

    - by Jordan Rynard
    I'm trying to find a way to return the value of an array's parent key. For example, from the array below I'd like to find out the parent's key where $array['id'] == "0002". The parent key is obvious because it's defined here (it would be 'products'), but normally it'd be dynamic, hence the problem. The 'id' and value of 'id' is known though. [0] => Array ( [data] => [id] => 0000 [name] => Swirl [categories] => Array ( [0] => Array ( [id] => 0001 [name] => Whirl [products] => Array ( [0] => Array ( [id] => 0002 [filename] => 1.jpg ) [1] => Array ( [id] => 0003 [filename] => 2.jpg ) ) ) ) )

    Read the article

  • Templates vs. coded HTML

    - by Alan Harris-Reid
    I have a web-app consisting of some html forms for maintaining some tables (SQlite, with CherryPy for web-server stuff). First I did it entirely 'the Python way', and generated html strings via. code, with common headers, footers, etc. defined as functions in a separate module. I also like the idea of templates, so I tried Jinja2, which I find quite developer-friendly. In the beginning I thought templates were the way to go, but that was when pages were simple. Once .css and .js files were introduced (not necessarily in the same folder as the .html files), and an ever-increasing number of {{...}} variables and {%...%} commands were introduced, things started getting messy at design-time, even though they looked great at run-time. Things got even more difficult when I needed additional javascript in the or sections. As far as I can see, the main advantages of using templates are: Non-dynamic elements of page can easily be viewed in browser during design. Except for {} placeholders, html is kept separate from python code. If your company has a web-page designer, they can still design without knowing Python. while some disadvantages are: {{}} delimiters visible when viewed at design-time in browser Associated .css and .js files have to be in same folder to see effects in browser at design-time. Data, variables, lists, etc., must be prepared in advanced and either declared globally or passed as parameters to render() function. So - when to use 'hard-coded' HTML, and when to use templates? I am not sure of the best way to go, so I would be interested to hear other developers' views. TIA, Alan

    Read the article

  • Encryption in Java & Flex

    - by Jef
    I want tp encrypt and decrypt string, with defined salt. But the result must be same if the code run in java and adobe flex. The main goal is: the app in adobe flex will be generate a string that can be decrypt in server using java. I use this flex library http://crypto.hurlant.com/demo/ Try to 'Secret Key' Tab. I want to use AES Encryption, 'CBC' or 'PKCS5'. var k:String = "1234567890123456"; var kdata:ByteArray = Hex.toArray(k); var txt:String = "hello"; var data:ByteArray = Hex.toArray(Hex.fromString(txt));; var name:String = "simple-aes-cbc"; var pad:IPad =new PKCS5(); var mode:ICipher = Crypto.getCipher(name, kdata, pad); pad.setBlockSize(mode.getBlockSize()); mode.encrypt(data); encrypted.text=Hex.fromArray(data); trace(Hex.fromArray(data)); And here is the code in java String plaintext = "hello"; String key = "1234567890123456"; SecretKey keyspec = new SecretKeySpec(key.getBytes(), "AES"); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.ENCRYPT_MODE,keyspec); byte[] encrypted = cipher.doFinal(plaintext.getBytes()); BASE64Encoder base64 = new BASE64Encoder(); String encodedString = base64.encode(encrypted); System.out.println(encodedString); Why the result is not same? Can you guys provide the sample with the same result both of java and flex (encrypt and decrypt)? And if I want to change the paramater, for example, from cbc to ebc, which line that need to be changed? Thanks!

    Read the article

  • How to set a define inside other define

    - by João Madureira Pires
    Hi all! I'm developing a web application in jboss, seam, richfaces. I'm using a template(xhtml) as master page of all others and there i set two insert tags. <ui:insert name="head"/> <ui:insert name="body"/> The problem is that in pages that use this master page as template, the <ui:define name="head">...</ui:define> must be defined inside the <ui:define name="body">...</ui:define>. How can i do this? Basically, what i want is to do the following: <ui:define name="body">... <ui:define name="head"> <meta name="title" content="#{something.title}" /> </ui:define> ...</ui:define> the master page must return : <meta name="title" content="#{something.title}" /> on the <ui:insert name="head"/> Thanks in advance

    Read the article

  • Pass a hidden jqGrid value when editing on ASP.Net MVC

    - by taylonr
    I have a jqGrid in an ASP.Net MVC. The grid is defined as: $("#list").jqGrid({ url: '<%= Url.Action("History", "Farrier", new { id = ViewData["horseId"]}) %>', editurl: '/Farrier/Add', datatype: 'json', mtype: 'GET', colNames: ['horseId', 'date', 'notes'], colModel: [ { name: 'horseId', index: 'horseId', width: 250, align: 'left', editable:false, editrules: {edithidden: true}, hidden: true }, { name: 'date', index: 'farrierDate', width: 250, align: 'left', editable:true }, { name: 'notes', index: 'farrierNotes', width: 100, align: 'left', editable: true } ], pager: jQuery('#pager'), rowNum: 5, rowList: [5, 10, 20, 50], sortname: 'farrierDate', sortorder: "DESC", viewrecords: true }); What I want to be able to do, add a row to the grid, where the horseId is either a) not displayed or b) greyed out. But is passed to the controller when saving. The way it's set up is this grid will only have 1 horse id at a time (it will exist on a horse's property page.) The only time I've gotten anything to work is when I made it editable, but then that opens it up for the user to modify the id, which isn't a good idea. So is there some way I can set this value before submitting the data? it does exist as a variable on this page, if that helps any (and I've checked that it isn't null). Thanks

    Read the article

  • Javascript: Collision detection

    - by jack moore
    Hello, could someone please help me to understand how collision detection works in JS? I can't use jQuery or gameQuery - already using prototype - so, I'm looking for something very simple. Not asking for complete solution, just point me to the right direction. Let's say there's: <div id="ball"></div> and <div id="someobject0"></div> Now the ball is moving (any direction). "Someobject"(0-X) is already pre-defined and there's 20-60 of them randomly positioned like this: #someobject {position: absolute; top: RNDpx; left: RNDpx;} I can create an array with "someobject(X)" positions and test collision while the "ball" is moving... Something like: for(var c=0; c<objposArray.length; c++){ ........ and code to check ball's current position vs all objects one by one.... } But I guess this would be a "noob" solution and it looks pretty slow. Is there anything better?

    Read the article

  • Execute Ant task with Maven

    - by Gonzalo
    Hi, I'm trying to execute with Maven some test written using Ant tasks. I generated the files required to import the task into Maven, but I can't execute them. My POM is defined this way: <build> <plugins> <plugin> <artifactId>maven-ant-plugin</artifactId> <version>2.1</version> <executions> <execution> <phase>generate-sources</phase> <configuration> <tasks> <echo message="Hello, maven"/> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> </executions> </plugin> </plugins> </build> I try to execute that message, but I get an error with run: [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] 'run' was specified in an execution, but not found in the plugin But, if I run: "mvn antrun:run", I know that this can not run the task. An if I've different targets, how do I call them from Maven? I've the pom.xml, and build.xml with the ant tasks. Thanks. Gonzalo

    Read the article

  • Bison input analyzer - basic question on optional grammer and input interpretation

    - by kumar_m_kiran
    Hi All, I am very new to Flex/Bison, So it is very navie question. Pardon me if so. May look like homework question - but I need to implement project based on below concept. My question is related to two parts, Question 1 In Bison parser, How do I provide rules for optional input. Like, I need to parse the statment Example : -country='USA' -state='INDIANA' -population='100' -ratio='0.5' -comment='Census study for Indiana' Here the ratio token can be optional. Similarly, If I have many tokens optional, then How do I provide the grammer in the parser for the same? My code looks like, %start program program : TK_COUNTRY TK_IDENTIFIER TK_STATE TK_IDENTIFIER TK_POPULATION TK_IDENTIFIER ... where all the tokens are defined in the lexer. Since there are many tokens which are optional, If I use "|" then there will be many different ways of input combination possible. Question 2 There are good chance that the comment might have quotes as part of the input, so I have added a token -tag which user can provide to interpret the same, Example : -country='USA' -state='INDIANA' -population='100' -ratio='0.5' -comment='Census study for Indiana$'s population' -tag=$ Now, I need to reinterpret Indiana$'s as Indiana's since -tag=$. Please provide any input or related material for to understand these topic. Thanks for your input in advance.

    Read the article

  • Multi-level inheritance with Implements on properties in VB.NET vs C#

    - by Ben McCormack
    Let's say I have 2 interfaces defined like so: public interface ISkuItem { public string SKU { get; set; } } public interface ICartItem : ISkuItem { public int Quantity { get; set; } public bool IsDiscountable { get; set; } } When I go to implement the interface in C#, VS produces the following templated code: public class CartItem : ICartItem { #region ICartItem Members public int Quantity { get {...} set {...} } public bool IsDiscountable { get {...} set {...} } #endregion #region ISkuItem Members public string SKU { get {...} set {...} } #endregion } In VB.NET, the same class is built out like so: Public Class CartItem Implements ICartItem Public Property IsDiscountable As Boolean Implements ICartItem.IsDiscountable 'GET SET' End Property Public Property Quantity As Integer Implements ICartItem.Quantity 'GET SET' End Property Public Property SKU As String Implements ISkuItem.SKU 'GET SET' End Property End Class VB.NET explicitly requires you to add Implements IInterfaceName.PropertyName after each property that gets implemented whereas C# simply uses regions to indicate which properties and methods belong to the interface. Interestingly in VB.NET, on the SKU property, I can specify either Implements ISkuItem.SKU or Implements ICartItem.SKU. Although the template built by VS defaults to ISkuItem, I can also specify ICartItem if I want. Oddly, because C# only uses regions to block out inherited properties, it seems that I can't explicitly specify the implementing interface of SKU in C# like I can in VB.NET. My question is: Is there any importance behind being able to specify one interface or another to implement properites in VB.NET, and if so, is there a way to mimic this functionality in C#?

    Read the article

  • Proper way to set PYTHONPATH (including precedence)

    - by Wells
    In .bashrc I have: export PYTHONPATH=/home/wells/py-mlb I've verified this is actually being set. so, in this directory is another directory called 'py_mlb'- the actual module. So I go python -v and then import py_mlb but it does: >>> import py_mlb import py_mlb # directory /usr/local/lib/python2.6/dist-packages/py_mlb Then I do import sys and print sys.path and I see: >>> print sys.path ['', '/usr/local/lib/python2.6/dist-packages/python_memcached-1.44-py2.6.egg', '/usr/local/lib/python2.6/dist-packages/pymc-2.1alpha-py2.6-linux-i686.egg', '/usr/local/lib/python2.6/dist-packages/nose-0.11.1-py2.6.egg', '/home/wells/py-mlb', '/usr/lib/python2.6', '/usr/lib/python2.6/plat-linux2', '/usr/lib/python2.6/lib-tk', '/usr/lib/python2.6/lib-old', '/usr/lib/python2.6/lib-dynload', '/usr/lib/python2.6/dist-packages', '/usr/local/lib/python2.6/dev-packages', '/usr/lib/pymodules/python2.6', '/usr/lib/pymodules/python2.6/gtk-2.0', '/usr/local/lib/python2.6/dist-packages'] So my path from .bashrc IS in there, and from the look of it it's even before dist-packages but it's importing the module from dist-packages. How can I finagle this so the PYTHONPATH as defined by .bashrc takes precedence? Thanks!

    Read the article

  • struts2: Redirect from global interceptor

    - by Dewfy
    In struts2 I have very simple task, after user is logged-in I'm checking if they profile is complete. If not user should be blocked from any other action and redirected to edit page. So I have created my default package: <package name="main" extends="tiles-default" > <interceptors> <interceptor name="checkProfile" class="my.CheckProfileInterceptor" /> <interceptor-stack name="secure"> <interceptor-ref name="defaultStack"/> <interceptor-ref name="checkProfile"/> </interceptor-stack> </interceptors> <default-interceptor-ref name="secure"/> </package> After it all my packages would include this template as a base: <package namespace="/packageA" name="packageA" extends="main"> ... <package namespace="/packageB" name="packageB" extends="main"> ... Saying editing page is /packageA/editProfile, my interceptor does following: public String intercept(ActionInvocation actionInvocation) throws Exception { if( currentUser.isOk() ) return "editProfile"; ... BUT! interceptor is global, so it raises struts2 error: No result defined for action (name of editProfile action class) When interceptor is placed inside some package - then everything ok. What should i do to declare global action?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • JavaScript and JQuery - Encoding HTML

    - by user70192
    Hello, I have a web page that has a textarea defined on it like so: <textarea id="myTextArea" rows="6" cols="75"></textarea> There is a chance that a user may enter single and double quotes in this field. For instance, I have been testing with the following string: Just testin' using single and double "quotes". I'm hoping the end of this task is comin'. Additionally, the user may enter HTML code, which I would prefer to prevent. Regardless, I am passing the contents of this textarea onto web service. I must encode the contents of the textarea in JavaScript before I can send it on. Currently, I'm trying the following: var contents $('<div/>').text($("#myTextArea).val()).html(); alert(contents); I was expecting contents to display Just testin&#39; using single and double &#34;quotes&#34;. I&#39;m hoping the end of this task is comin&#39;. Instead, the original string is printed out. Beyond just double-and-single quotes, there are a variety of entities to consider. Because of this, I was assuming there would be a way to encode HTML before passing it on. Can someone please tell me how to do this? Thank you,

    Read the article

  • what is the exact way to use Endorsed directory in jdk1.6

    - by raticulin
    I want to upgrade my jaxws to 2.2 (jdk1.6 comes bundled with jaxws 2.1). My jdk is (I did not install public jre): java version "1.6.0_20" Java(TM) SE Runtime Environment (build 1.6.0_20-b02) Java HotSpot(TM) Client VM (build 16.3-b01, mixed mode) In jaxws' own doc they explain how to do it: One way to fix this is to copy jaxws-api.jar and jaxb-api.jar into JRE endorsed directory, which is $JAVA_HOME/lib/endorsed (or $JDK_HOME/jre/lib/endorsed) But I am not sure this is having any effect in my installation. For starters I have only defined %JAVA_HOME%. And folder $JAVA_HOME/lib/endorsed is inexistant, so I created and copied the two jars. But if I do (wsgen is a tool from jaxws) wsgen -version I still get: JAX-WS RI 2.1.6 in JDK 6 I also tried creating folder JAVA_HOME\jre\lib\endorsed (notice that in the doc they say JDK_HOME, but as I only have JAVA_HOME I used this path). Still same wsgen output. My questions are: What is the difference between JAVA_HOME and JDK_HOME in the doc page? anything significant or just two ways to refer to JAVA_HOME ? Is 'wsgen -version' a valid way to check jaxws version that is used or this always calls the exe in the original jdk, but it does not mean endorsed jars will be used? Anyone knows very detailed steps to install jaxws2.2 in a jdk.16?

    Read the article

  • Configure WebLogic MDB to listen to Foreing AMQ Server

    - by eliel.lobo
    I'm trying to create an MDB(EJB 3.0) on WebLogic 10.3.5. to listen to a Queue in an external AMQ server. but after much work and combination of tutorials i get the followin error when deployin on WwebLogic. [EJB:015027]The Message-Driven EJB is transactional but JMS connection factory referenced by the JNDI name: ActiveMQXAConnectionFactory is not a JMS XA connection factory. Here is a brief of the work i have done: I have added the corresponding libraries to my WLS classpath (following thos tuturial http://amadei.com.br/blog/index.php/connecting-weblogic-and-activemq) and I have created the corresponding JMS Modules as indicated in the tutorial. As connection factory I have used ActiveMQConnectionFactory initially and ActiveMQXAConnectionFactory later, I also ignome the jms. notation an just put plain names as testQueue. Then create a simple MDB whit the following structure. I explicitly defined "connectionFactoryJndiName" property because otherwise it assumes a WebLogic connection factory which is not found an then raises an error. @MessageDriven( activationConfig = { @ActivationConfigProperty(propertyName = "destinationType", propertyValue = "javax.jms.Queue"), @ActivationConfigProperty(propertyName = "destination", propertyValue = "testQueue"), @ActivationConfigProperty(propertyName = "connectionFactoryJndiName", propertyValue = "ActiveMQXAConnectionFactory") }, mappedName = "testQueue") public class ROMELReceiver implements MessageListener { /** * Default constructor. */ public ROMELReceiver() { // TODO Auto-generated constructor stub } /** * @see MessageListener#onMessage(Message) */ public void onMessage(Message message) { System.out.println("Message received"); } } At this point I'm stuck with the error mentioned above. Even though I use ActiveMQXAConnectionFactory instead of simply ActiveMQConnectionFactory, JNDI resources tree in web logic server shows org.apache.activemq.ActiveMQConnectionFactory as class for my configured connection factory. am i missing something? or is this just a completely wrong way to connect WebLogic whith AMQ? Thanks in advance.

    Read the article

  • Why can I run JUnit tests for my Spring project, but not a main method?

    - by FarmBoy
    I am using JDBC to connect to MySQL for a small application. In order to test without altering the real database, I'm using HSQL in memory for JUnit tests. I'm using Spring for DI and DAOs. Here is how I'm configuring my HSQL DataSource <bean id="mockDataSource" class="org.springframework.jdbc.datasource.SingleConnectionDataSource"> <property name="driverClassName" value="org.hsqldb.jdbcDriver"/> <property name="url" value="jdbc:hsqldb:mem:mockSeo"/> <property name="username" value="sa"/> </bean> This works fine for my JUnit tests which use the mock DB. But when I try to run a main method, I find the following error: Error creating bean with name 'mockDataSource' defined in class path resource [beans.xml]: Error setting property values; nested exception is org.springframework.beans.PropertyBatchUpdateException; nested PropertyAccessExceptions (1) are: PropertyAccessException 1: org.springframework.beans.MethodInvocationException: Property 'driverClassName' threw exception; nested exception is java.lang.IllegalStateException: Could not load JDBC driver class [org.hsqldb.jdbcDriver] I'm running from Eclipse, and I'm using the Maven plugin. Is there a reason why this would work as a Test, but not as a main()? I know that the main method itself is not the problem, because it works if I remove all references to the HSQL DataSource from my Spring Configuration file.

    Read the article

  • F# Active Pattern List.filter or equivalent

    - by akaphenom
    I have a records of types type tradeLeg = { id : int ; tradeId : int ; legActivity : LegActivityType ; actedOn : DateTime ; estimates : legComponents ; entryType : ShareOrDollarBased ; confirmedPrice: DollarsPerShare option; actuals : legComponents option ; type trade = { id : int ; securityId : int ; ricCode : string ; tradeActivity : TradeType ; enteredOn : DateTime ; closedOn : DateTime ; tradeLegs : tradeLeg list ; } Obviously the tradeLegs are a type off of a trade. A leg may be settled or unsettled (or unsettled but price confirmed) - thus I have defined the active pattern: let (|LegIsSettled|LegIsConfirmed|LegIsUnsettled|) (l: tradeLeg) = if Helper.exists l.actuals then LegIsSettled elif Helper.exists l.confirmedPrice then LegIsConfirmed else LegIsUnsettled and then to determine if a trade is settled (based on all legs matching LegIsSettled pattern: let (|TradeIsSettled|TradeIsUnsettled|) (t: trade) = if List.exists ( fun l -> match l with | LegIsSettled -> false | _ -> true) t.tradeLegs then TradeIsSettled else TradeIsUnsettled I can see some advantages of this use of active patterns, however i would think there is a more efficient way to see if any item of a list either matches (or doesn't) an actie pattern without having to write a lambda expression specifically for it, and using List.exist. Question is two fold: is there a more concise way to express this? is there a way to abstract the functionality / expression (fun l - match l with | LegIsSettled - false | _ - true) Such that let itemMatchesPattern pattern item = match item with | pattern -> true | _ -> false such I could write (as I am reusing this design-pattern): let curriedItemMatchesPattern = itemMatchesPattern LegIsSettled if List.exists curriedItemMatchesPattern t.tradeLegs then TradeIsSettled else TradeIsUnsettled Thoughts?

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • how to fix: ctags null expansion of name pattern "\1"

    - by bua
    Hi, As the title points I have problem with ctags when trying to parse user-defined language. Basically I've followed those instructions. The quickest and easiest way to do this is by defining a new language using the program options. In order to have Swine support available every time I start ctags, I will place the following lines into the file $HOME/.ctags, which is read in every time ctags starts: --langdef=swine --langmap=swine:.swn --regex-swine=/^def[ \t]*([a-zA-Z0-9_]+)/\1/d,definition/ The first line defines the new language, the second maps a file extension to it, and the third defines a regular expression to identify a language definition and generate a tag file entry for it. I've tried different flags: b,e for regex. My definition of tag is: --regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/\l/f,function/b When I replace \1 with anything else (ascii caracter set ), It works. the output is: (--regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/my function name/f,function/b) !_TAG_FILE_FORMAT 2 /extended format; --format=1 will not append ;" to lines/ !_TAG_FILE_SORTED 1 /0=unsorted, 1=sorted, 2=foldcase/ !_TAG_PROGRAM_AUTHOR Darren Hiebert /[email protected]/ !_TAG_PROGRAM_NAME Exuberant Ctags // !_TAG_PROGRAM_URL http://ctags.sourceforge.net /official site/ !_TAG_PROGRAM_VERSION 5.8 // my function name file.q /^.ras.getLocation:{[u]$/;" f my function name file.q /^.a.getResource:{[u; pass]$/;" f my function name file.q /^.a.init:{$/;" f my function name file.q /^.a.kill:{[u; force]$/;" f my function name file.q /^.asdf.status:{[what; u]$/;" f my function name file.q /^.pc:{$/;" f Why \1 doesn't work? (I've tried all 1-9)

    Read the article

  • PHP XML Strategy: Parsing DOM to fill "Bean"

    - by Mike
    I have a question concerning a good strategy on how to fill a data "bean" with data inside an xml file. The bean might look like this: class Person { var $id; var $forename = ""; var $surname = ""; var $bio = new Biography(); } class Biography { var $url = ""; var $id; } the xml subtree containing the info might look like this: <root> <!-- some more parent elements before node(s) of interest --> <person> <name pre="forename"> Foo </name> <name pre="surname"> Bar </name> <id> 1254 </id> <biography> <url> http://www.someurl.com </url> <id> 5488 </id> </biography> </person> </root> At the moment, I have one approach using DOMDocument. A method iterates over the entries and fills the bean by "remembering" the last node. I think thats not a good approach. What I have in mind is something like preconstructing some xpath expression(s) and then iterate over the subtrees/nodeLists. Return an array containing the beans as defined above eventually. However, it seems not to be possible reusing a subtree /DOMNode as DOMXPath constructor parameter. Has anyone of you encountered such a problem?

    Read the article

  • WPF TextBlock Binding to DependencyProperty

    - by Bill Campbell
    Hi, I have what I believe to be about one of the most simple cases of attempting to bind a view to a dependencyproperty in the view model. It seems that the initial changes are reflected in the view but other changes to the DP do not update the view's TextBlock. I'm probably just missing something simple but I just can't see what it is. Please take a look... My XAML has a status bar on the bottom of the window. I want to bind to the DP "VRAStatus". <StatusBar x:Name="sbar" Grid.Column="0" Grid.Row="2" Grid.ColumnSpan="2" VerticalAlignment="Bottom" Background="LightBlue" Opacity="0.4" DockPanel.Dock="Bottom" > <StatusBarItem> <TextBlock x:Name="statusBar" Text="{Binding VRAStatus}" /> </StatusBarItem> <StatusBarItem> <Separator Style="{StaticResource StatusBarSeparatorStyle}"/> </StatusBarItem> </StatusBar> My viewmodel has the DP defined: public string VRAStatus { get { return (string)GetValue(VRAStatusProperty); } set { SetValue(VRAStatusProperty, value); } } // Using a DependencyProperty as the backing store for VRAStatus. public static readonly DependencyProperty VRAStatusProperty = DependencyProperty.Register("VRAStatus", typeof(string), typeof(PenskeRouteAssistViewModel),new PropertyMetadata(string.Empty)); Then, in my code I set the DP: VRAStatus = "Test Message..."; Is there something obvious here that I am missing? In my constructor for the viewmodel I set the DP like this: VRAStatus = "Ready"; I never get the Test Message to display. Please Help. thanks in advance! Bill

    Read the article

  • Strange ng-model behavior inside ng-repeat

    - by Mike Fisher
    I'm trying to build up a complex post request to run a report in my Angular app. I have a list of inputs all dynamically generated via an ng-repeat a simple version of my html looks like this. <div ng-repeat="filter in lists.filters"> <input type="checkbox" ng-model="report.options.filters[filter.value]['type']/> <input type="text" ng-model="report.options.filters[filter.value]['values']/> </div> ng-repeat is looping over this array [ {name: 'Advertisers', value: 'advertisers'}, {name: 'Sizes', value: 'sizes'}, {name: 'Campaign IDs', value: 'campaigns'}, {name: 'Creative IDs', value: 'creatives'}, {name: 'Publishers', value: 'publishers'}, {name: 'Placement IDs', value: 'placements'}, {name: 'Seller Types', value: 'seller_types'}, {name: 'Impression Types', value: 'impression_types'}, {name: 'Bid Types', value: 'bid_types'}, {name: 'Seller Members', value: 'seller_members'}, {name: 'Buyer Members', value: 'buyer_members'}, {name: 'Insertion Order Ids', value: 'insertion_orders'}, {name: 'Countries', value: 'countries'}, {name: 'Site Ids', value: 'sites'}, {name: 'Sources', value: 'sources'} ]; The JSON I'm sending back needs to be structured like this: "filters": { "state": "all", "campaigns": {type:"include", values":[1,2]}, "creatives": {type:"exclude","values":[1,2]}, "publishers": {"values":[1,2]}, "placements": {type:"exclude",values":[1,2]}, "advertisers": {"values":[1,2]}, "sizes": {"values":[1,2]}, "countries": {"values":[1,2]}, "insertion_orders": {"values":[1,2]}, "sites": {"values":[1,2]}, "bid_types": {"values":[1,2]}, "seller_types": {"values":[1,2]}, "impression_types": {"values":[1,2]}, "seller_members": {"values":[1,2]}, "buyer_members": {"values":[1,2]}, "sources": {"values":[1,2]} } When I do this Angular throws an error: 'Cannot set property 'values' of undefined' and 'Cannot set property 'type' of undefined' Yet if I do this (inside ng-repeat) <input type="text" ng-model="report.options.filters[filter.value]/> Or this outside of ng-repeat <input type="text" ng-model="report.options.filters[filter.value]['values']/> No errors are thrown and everything works fine. I'm positive that filter.value is defined and available on the scope even though Angular thinks it's not for some reason. I'm not quite sure what I'm doing wrong. Any help is much appreciated.

    Read the article

  • Creating cookieless application on development machine with asp.net

    - by zaladane
    I tried posting this on ServerFault with no luck so i am trying here. I am thinking about setting up a new domain to host static content on my website and have it cookieless just like Stackoverflow with their static domain. So before going ahead and buying the domain and setting it up I wanted to test it on my developement machine first under localhost (I have to mention that i am planning on having IIS running on my new domain for the static files). I therefore created a new application under IIS and disabled session state and forms authentication. When my main application needs resources like css, images and js , I use the path to the "static" application where they are hosted. The problem is that when I look at the request and the response for the requested files, they still have the session_id cookie defined as well as the asp.net authentication cookie. Is it at all possible to accomplish what i am trying to do on a development machine or do i have to just go ahead and purchase the new domain which hopefully with make things right? I tried to read about cookieless domain but can't figure out what i might be missing.

    Read the article

  • richfaces progressBar polling

    - by John
    Hi, I've got a progressBar component defined as the following on my webpage: <rich:modalPanel id="pb1Panel"> <rich:progressBar id="pb1" oncomplete="javascript:#{myBean.handleProgressEvent()} closeProgressModalPanel()" value="#{pb1Listener.percentageComplete}" label="#{pb1Listener.percentageComplete} %" minValue="1" maxValue="100" limitToList="true" timeout="3200" interval="1400" enabled="false"/> </rich:modalPanel> and a button: <a4j:commandButton id="actButton" value="action" action="#{myBean.performAction}" immediate="true" ajaxSingle="true" onclick="javascript:Richfaces.showModalPanel('pb1Panel');" reRender="pb1Panel"> <a4j:support event="onClick" value="#{rich:component('pb1')}.enable()" reRender="pb1" /> </a4j:commandButton> which doesn't work. However if I take out the .... enabled="false"/> .... from the progress bar, and the element from the button, everything seems to work just fine. Any suggestion why it's not working? I'm setting enabled="false" initially because I do not want the polling to start unless the button was clicked (to reduce unnecessary polling). The system is building on richfaces/seam. Thanks!

    Read the article

  • XML parsing design using xmlpp and C++

    - by shagv
    I would like to use an xml format similar to the following: <CONFIG> <PROFILE NAME="foobar"> <PARAM ID="0" NAME="Foo" CLASS="BaseParam"/> <PARAM ID="2" NAME="Bar" CLASS="StrIntParam"> <VALUE TYPE="STRING">some String</VALUE> <VALUE TYPE="INT">1234</VALUE> </PARAM> </PROFILE> </CONFIG> CONFIG contains a list of PROFILEs which contain a list of PARAMs which themselves can be any structure (to be defined in the future). The idea was to define classes that parsed each PARAM type and to keep track of which class to use in the PARAM's CLASS attribute. In code I have a config class that manages the list of profiles and a profile class that manages the list of params. I would like the profile class to handle additional param types (that inherit BaseParam) without modification to the profile class (or at the very least with minimal modification). First of all, is this design viable? If so, what are some ways I could use different param classes and have their creation at run-time be automatic (the profile class sees the CLASS attribute and knows which type to create)?

    Read the article

< Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >