Search Results

Search found 8286 results on 332 pages for 'defined'.

Page 235/332 | < Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >

  • Dojo DnD: how to access newly copied node on onDndDrop event?

    - by toshinao
    Hi. I am working on code like the following. 01: var c1 = new dojo.dnd.Source('container1', {copyOnly:true}); // container1 is a div 02: var c2 = new dojo.dnd.Source('container2'); // container2 is a div 03: var list = []; 04: for (var i = 0; i < 3; i++) { list.push( dojo.create('div') ); } 05: c1.insertNodes(false, list); 06: 07: function checkDndCopy(nodes, target){ 08: dojo.forEach(nodes, function(node){ alert(node.id); } ); 09: } 10: dojo.subscribe("/dnd/drop", function(){ 11: var mgr = dojo.dnd.manager(); 12: checkDndCopy(mgr.nodes, mgr.target); 13: }); The nodes inserted to the c1 at line 05 have id of "dojoUnique1, donoUnique2, dojoUnique3". On a event of drag and drop a node from c1 to c2, a onDndDrop event is fired and the subscribe method defined in line10-13 is invoked. I expected that newly copied node appears in the nodes (for example) at line 08. But this is not true. When dojoUnique1 is target of drag and drop, nodes at line 08 contains only dojoUnique1. I want to modify some attributes of newly copied nodes on the event of onDndDrop. Please let me know how such a thing is realized.

    Read the article

  • Execute Ant task with Maven

    - by Gonzalo
    Hi, I'm trying to execute with Maven some test written using Ant tasks. I generated the files required to import the task into Maven, but I can't execute them. My POM is defined this way: <build> <plugins> <plugin> <artifactId>maven-ant-plugin</artifactId> <version>2.1</version> <executions> <execution> <phase>generate-sources</phase> <configuration> <tasks> <echo message="Hello, maven"/> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> </executions> </plugin> </plugins> </build> I try to execute that message, but I get an error with run: [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] 'run' was specified in an execution, but not found in the plugin But, if I run: "mvn antrun:run", I know that this can not run the task. An if I've different targets, how do I call them from Maven? I've the pom.xml, and build.xml with the ant tasks. Thanks. Gonzalo

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Developmnet process for an embedded project with significant Hardware change

    - by pierr
    Hi, I have a good idea about Agile development process but it seems it does not fit well with a embedded project with significant hardware change. I will describe below what we are currently doing (Ad-hoc way , no defined process yet). The change are divided to three categories and different process are used for them : complete hardware change example : use a different video codec IP a) Study the new IP b) RTL/FPGA simulation c) Implement the leagcy interface - go to b) d) Wait until hardware (tape out) is ready f) Test on the real Hardware hardware improvement example : enhance the image display quaulity by improving the underlie algorithm a)RTL/FPGA simulation b)Wait until hardware and test on the hardware Mino change exmaple : only change hardware register mapping a)Wait until hardware and test on the hardware The worry is it seems we don't have too much control and confidence about software maturity for the hardware change as the bring up schedule is always very tight and the customer desired a seemless change when updating to a new version hardware. How did you manage this kind of hardware hardware change? Did you solve that by a Hardware Abstraction Layer (HAL)? Did you have a automatical test for the HAL layer? How did you test when the hardware platform is not even ready? Do you have well documented process for this kind of change? Thanks for your insight.

    Read the article

  • How can I get the Hibernate Configuration object from Spring?

    - by Wayne Russell
    Hi, I am trying to obtain Spring-defined Hibernate Configuration and SessionFactory objects in my non-Spring code. The following is the definition in my applicationContext.xml file: Code: <bean id="sessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="hibernateProperties"> <props> <prop key="hibernate.dialect">org.hibernate.dialect.MySQLDialect</prop> <prop key="hibernate.show_sql">true</prop> <prop key="hibernate.hbm2ddl.auto">update</prop> <prop key="hibernate.cglib.use_reflection_optimizer">true</prop> <prop key="hibernate.cache.provider_class">org.hibernate.cache.HashtableCacheProvider</prop> </props> </property> <property name="dataSource"> <ref bean="dataSource"/> </property> </bean> If I now call getBean("sessionFactory"), I am returned a $Proxy0 object which appears to be a proxy for the Hibernate SessionFactory object. But that isn't what I want - I need the LocalSessionFactoryBean itself because I need access to the Configuration as well as the SessionFactory. The reason I need the Configuration object is that our framework is able to use Hibernate's dynamic model to automatically insert mappings at runtime; this requires that we change the Configuration and rebuild the SessionFactory. Really, all we're trying to do is obtain the Hibernate config that already exists in Spring so that those of our customers that already have that information in Spring don't need to duplicate it into a hibernate.cfg.xml file in order to use our Hibernate features.

    Read the article

  • how to get cartesian products between database and local sequences in linq?

    - by JD
    I saw this similar question here but can't figure out how to use Contains in Cartesian product desired result situation: http://stackoverflow.com/questions/1712105/linq-to-sql-exception-local-sequence-cannot-be-used-in-linq-to-sql-implementatio Let's say I have following: var a = new [] { 1, 4, 7 }; var b = new [] { 2, 5, 8 }; var test = from i in a from j in b select new { A = i, B = j, AB = string.Format("{0:00}a{1:00}b", i, j), }; foreach (var t in test) Console.Write("{0}, ", t.AB); This works great and I get a dump like so (note, I want the cartesian product): 01a02b, 01a05b, 01a08b, 04a02b, 04a05b, 04a08b, 07a02b, 07a05b, 07a08b, Now what I really want is to take this and cartesian product it again against an ID from a database table I have. But, as soon as I add in one more from clause that instead of referencing objects, references SQL table, I get an error. So, altering above to something like so where db is defined as a new DataContext (i.e., class deriving from System.Data.Linq.DataContext): var a = new [] { 1, 4, 7 }; var b = new [] { 2, 5, 8 }; var test = from symbol in db.Symbols from i in a from j in b select new { A = i, B = j, AB = string.Format("{0}{1:00}a{2:00}b", symbol.ID, i, j), }; foreach (var t in test) Console.Write("{0}, ", t.AB); The error I get is following: Local sequence cannot be used in LINQ to SQL implementations of query operators except the Contains operator Its related to not using Contains apparently but I'm unsure how Contains would be used when I don't really want to constrict the results - I want the Cartesian product for my situation. Any ideas of how to use Contains above and still yield the Cartesian product when joining database and local sequences?

    Read the article

  • What could I add to this code to allow the cell height to dynamically change as I edit the JTextArea

    - by Dr. Plaguey
    The derived classes I am using public class TextAreaRenderer extends JTextArea implements TableCellRenderer { public TextAreaRenderer() { setLineWrap(true); setWrapStyleWord(true); } public Component getTableCellRendererComponent(JTable jTable, Object obj, boolean isSelected, boolean hasFocus, int row, int column) { setText((String)obj); int height_wanted = (int)getPreferredSize().getHeight() + 10; if (height_wanted != rootJTable.getRowHeight(row)) rootJTable.setRowHeight(row, height_wanted); return this; } } class TextEditor extends AbstractCellEditor implements TableCellEditor { protected JTextArea ta; String txt; public TextEditor() { ta = new JTextArea(); } //Implement the one CellEditor method that AbstractCellEditor doesn't. public Object getCellEditorValue() { return ta.getText(); } // Implement the one method defined by TableCellEditor. public Component getTableCellEditorComponent(javax.swing.JTable table, Object value,boolean isSelected, int row, int column) { txt = value.toString(); ta.setText(txt); ta.setLineWrap(true); return new JScrollPane(ta); } public boolean isCellEditable(EventObject anEvent) { return true; } } Set column renderer and editor rootJTable.getColumnModel().getColumn(1).setCellRenderer(new TextAreaRenderer()); rootJTable.getColumnModel().getColumn(1).setCellEditor(new TextEditor());

    Read the article

  • Formatting the parent and child nodes of a Treeview that is populated by a XML file

    - by Marina
    Hello Everyone, I'm very new to xml so I hope I'm not asking any silly question here. I'm currently working on populating a treeview from an XML file that is not hierarchically structured. In the xml file that I was given the child and parent nodes are defined within the attributes of the item element. How would I be able to utilize the attributes in order for the treeview to populate in the right hierarchical order. (Example Mary Jane should be a child node of Peter Smith). At present all names are under one another. root <item parent_id="0" id="1"><content><name>Peter Smith</name></content></item> <item parent_id="1" id="2"><content><name>Mary Jane</name></content></item> <item parent_id="1" id="7"><content><name>Lucy Lu</name></content></item> <item parent_id="2" id="3"><content><name>Informatics Team</name></content></item> <item parent_id="3" id="4"><content><name>Sandy Chu</name></content></item> <item parent_id="4" id="5"><content><name>John Smith</name></content></item> <item parent_id="5" id="6"><content><name>Jane Smith</name></content></item> /root Thank you for all of your help, Marina

    Read the article

  • Why can I run JUnit tests for my Spring project, but not a main method?

    - by FarmBoy
    I am using JDBC to connect to MySQL for a small application. In order to test without altering the real database, I'm using HSQL in memory for JUnit tests. I'm using Spring for DI and DAOs. Here is how I'm configuring my HSQL DataSource <bean id="mockDataSource" class="org.springframework.jdbc.datasource.SingleConnectionDataSource"> <property name="driverClassName" value="org.hsqldb.jdbcDriver"/> <property name="url" value="jdbc:hsqldb:mem:mockSeo"/> <property name="username" value="sa"/> </bean> This works fine for my JUnit tests which use the mock DB. But when I try to run a main method, I find the following error: Error creating bean with name 'mockDataSource' defined in class path resource [beans.xml]: Error setting property values; nested exception is org.springframework.beans.PropertyBatchUpdateException; nested PropertyAccessExceptions (1) are: PropertyAccessException 1: org.springframework.beans.MethodInvocationException: Property 'driverClassName' threw exception; nested exception is java.lang.IllegalStateException: Could not load JDBC driver class [org.hsqldb.jdbcDriver] I'm running from Eclipse, and I'm using the Maven plugin. Is there a reason why this would work as a Test, but not as a main()? I know that the main method itself is not the problem, because it works if I remove all references to the HSQL DataSource from my Spring Configuration file.

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • F# Active Pattern List.filter or equivalent

    - by akaphenom
    I have a records of types type tradeLeg = { id : int ; tradeId : int ; legActivity : LegActivityType ; actedOn : DateTime ; estimates : legComponents ; entryType : ShareOrDollarBased ; confirmedPrice: DollarsPerShare option; actuals : legComponents option ; type trade = { id : int ; securityId : int ; ricCode : string ; tradeActivity : TradeType ; enteredOn : DateTime ; closedOn : DateTime ; tradeLegs : tradeLeg list ; } Obviously the tradeLegs are a type off of a trade. A leg may be settled or unsettled (or unsettled but price confirmed) - thus I have defined the active pattern: let (|LegIsSettled|LegIsConfirmed|LegIsUnsettled|) (l: tradeLeg) = if Helper.exists l.actuals then LegIsSettled elif Helper.exists l.confirmedPrice then LegIsConfirmed else LegIsUnsettled and then to determine if a trade is settled (based on all legs matching LegIsSettled pattern: let (|TradeIsSettled|TradeIsUnsettled|) (t: trade) = if List.exists ( fun l -> match l with | LegIsSettled -> false | _ -> true) t.tradeLegs then TradeIsSettled else TradeIsUnsettled I can see some advantages of this use of active patterns, however i would think there is a more efficient way to see if any item of a list either matches (or doesn't) an actie pattern without having to write a lambda expression specifically for it, and using List.exist. Question is two fold: is there a more concise way to express this? is there a way to abstract the functionality / expression (fun l - match l with | LegIsSettled - false | _ - true) Such that let itemMatchesPattern pattern item = match item with | pattern -> true | _ -> false such I could write (as I am reusing this design-pattern): let curriedItemMatchesPattern = itemMatchesPattern LegIsSettled if List.exists curriedItemMatchesPattern t.tradeLegs then TradeIsSettled else TradeIsUnsettled Thoughts?

    Read the article

  • JavaScript and JQuery - Encoding HTML

    - by user70192
    Hello, I have a web page that has a textarea defined on it like so: <textarea id="myTextArea" rows="6" cols="75"></textarea> There is a chance that a user may enter single and double quotes in this field. For instance, I have been testing with the following string: Just testin' using single and double "quotes". I'm hoping the end of this task is comin'. Additionally, the user may enter HTML code, which I would prefer to prevent. Regardless, I am passing the contents of this textarea onto web service. I must encode the contents of the textarea in JavaScript before I can send it on. Currently, I'm trying the following: var contents $('<div/>').text($("#myTextArea).val()).html(); alert(contents); I was expecting contents to display Just testin&#39; using single and double &#34;quotes&#34;. I&#39;m hoping the end of this task is comin&#39;. Instead, the original string is printed out. Beyond just double-and-single quotes, there are a variety of entities to consider. Because of this, I was assuming there would be a way to encode HTML before passing it on. Can someone please tell me how to do this? Thank you,

    Read the article

  • PHP XML Strategy: Parsing DOM to fill "Bean"

    - by Mike
    I have a question concerning a good strategy on how to fill a data "bean" with data inside an xml file. The bean might look like this: class Person { var $id; var $forename = ""; var $surname = ""; var $bio = new Biography(); } class Biography { var $url = ""; var $id; } the xml subtree containing the info might look like this: <root> <!-- some more parent elements before node(s) of interest --> <person> <name pre="forename"> Foo </name> <name pre="surname"> Bar </name> <id> 1254 </id> <biography> <url> http://www.someurl.com </url> <id> 5488 </id> </biography> </person> </root> At the moment, I have one approach using DOMDocument. A method iterates over the entries and fills the bean by "remembering" the last node. I think thats not a good approach. What I have in mind is something like preconstructing some xpath expression(s) and then iterate over the subtrees/nodeLists. Return an array containing the beans as defined above eventually. However, it seems not to be possible reusing a subtree /DOMNode as DOMXPath constructor parameter. Has anyone of you encountered such a problem?

    Read the article

  • XML parsing design using xmlpp and C++

    - by shagv
    I would like to use an xml format similar to the following: <CONFIG> <PROFILE NAME="foobar"> <PARAM ID="0" NAME="Foo" CLASS="BaseParam"/> <PARAM ID="2" NAME="Bar" CLASS="StrIntParam"> <VALUE TYPE="STRING">some String</VALUE> <VALUE TYPE="INT">1234</VALUE> </PARAM> </PROFILE> </CONFIG> CONFIG contains a list of PROFILEs which contain a list of PARAMs which themselves can be any structure (to be defined in the future). The idea was to define classes that parsed each PARAM type and to keep track of which class to use in the PARAM's CLASS attribute. In code I have a config class that manages the list of profiles and a profile class that manages the list of params. I would like the profile class to handle additional param types (that inherit BaseParam) without modification to the profile class (or at the very least with minimal modification). First of all, is this design viable? If so, what are some ways I could use different param classes and have their creation at run-time be automatic (the profile class sees the CLASS attribute and knows which type to create)?

    Read the article

  • Bison input analyzer - basic question on optional grammer and input interpretation

    - by kumar_m_kiran
    Hi All, I am very new to Flex/Bison, So it is very navie question. Pardon me if so. May look like homework question - but I need to implement project based on below concept. My question is related to two parts, Question 1 In Bison parser, How do I provide rules for optional input. Like, I need to parse the statment Example : -country='USA' -state='INDIANA' -population='100' -ratio='0.5' -comment='Census study for Indiana' Here the ratio token can be optional. Similarly, If I have many tokens optional, then How do I provide the grammer in the parser for the same? My code looks like, %start program program : TK_COUNTRY TK_IDENTIFIER TK_STATE TK_IDENTIFIER TK_POPULATION TK_IDENTIFIER ... where all the tokens are defined in the lexer. Since there are many tokens which are optional, If I use "|" then there will be many different ways of input combination possible. Question 2 There are good chance that the comment might have quotes as part of the input, so I have added a token -tag which user can provide to interpret the same, Example : -country='USA' -state='INDIANA' -population='100' -ratio='0.5' -comment='Census study for Indiana$'s population' -tag=$ Now, I need to reinterpret Indiana$'s as Indiana's since -tag=$. Please provide any input or related material for to understand these topic. Thanks for your input in advance.

    Read the article

  • richfaces progressBar polling

    - by John
    Hi, I've got a progressBar component defined as the following on my webpage: <rich:modalPanel id="pb1Panel"> <rich:progressBar id="pb1" oncomplete="javascript:#{myBean.handleProgressEvent()} closeProgressModalPanel()" value="#{pb1Listener.percentageComplete}" label="#{pb1Listener.percentageComplete} %" minValue="1" maxValue="100" limitToList="true" timeout="3200" interval="1400" enabled="false"/> </rich:modalPanel> and a button: <a4j:commandButton id="actButton" value="action" action="#{myBean.performAction}" immediate="true" ajaxSingle="true" onclick="javascript:Richfaces.showModalPanel('pb1Panel');" reRender="pb1Panel"> <a4j:support event="onClick" value="#{rich:component('pb1')}.enable()" reRender="pb1" /> </a4j:commandButton> which doesn't work. However if I take out the .... enabled="false"/> .... from the progress bar, and the element from the button, everything seems to work just fine. Any suggestion why it's not working? I'm setting enabled="false" initially because I do not want the polling to start unless the button was clicked (to reduce unnecessary polling). The system is building on richfaces/seam. Thanks!

    Read the article

  • NSBorderlessWindow not responding to CMD-W/CMD-M

    - by Sean
    I have an NSBorderlessWindow subclass of NSWindow with a transparent and non-opaque background (so it's non-rectangular in appearance). I've added my own buttons to function as the close and minimize buttons when I click them, but for some reason the window will not respond to CMD-W or CMD-M like a normal one does. I have my NSWindow subclass set to return YES to canBecomeKeyWindow and canBecomeMainWindow. My NIB still has all the standard menu items in it that are there when you create a new project - including the "Minimize" item in the Window menu with the default shortcut CMD-M defined. It's hooked up to send performMiniaturize: to the first responder. However it is not enabled when the app is run, so it seems like it must be asking the window if it can minimize and the window says no or something. (I'm still very new to OSX/Cocoa.) What am I missing? Also, and maybe this is related, my borderless window has a shadow enabled - but unlike a normal titled window, when I make my window the active/front window by clicking on it, the shadow doesn't change. Normally an OSX focused window has a slightly larger/darker shadow to make it stand out more but mine never changes the shadow. It's like I'm missing something to make the OS treat this window as a real/normal/main window or something and as a result I lose the shadow change and functioning CMD-W/CMD-M.

    Read the article

  • How to set a define inside other define

    - by João Madureira Pires
    Hi all! I'm developing a web application in jboss, seam, richfaces. I'm using a template(xhtml) as master page of all others and there i set two insert tags. <ui:insert name="head"/> <ui:insert name="body"/> The problem is that in pages that use this master page as template, the <ui:define name="head">...</ui:define> must be defined inside the <ui:define name="body">...</ui:define>. How can i do this? Basically, what i want is to do the following: <ui:define name="body">... <ui:define name="head"> <meta name="title" content="#{something.title}" /> </ui:define> ...</ui:define> the master page must return : <meta name="title" content="#{something.title}" /> on the <ui:insert name="head"/> Thanks in advance

    Read the article

  • Pass a hidden jqGrid value when editing on ASP.Net MVC

    - by taylonr
    I have a jqGrid in an ASP.Net MVC. The grid is defined as: $("#list").jqGrid({ url: '<%= Url.Action("History", "Farrier", new { id = ViewData["horseId"]}) %>', editurl: '/Farrier/Add', datatype: 'json', mtype: 'GET', colNames: ['horseId', 'date', 'notes'], colModel: [ { name: 'horseId', index: 'horseId', width: 250, align: 'left', editable:false, editrules: {edithidden: true}, hidden: true }, { name: 'date', index: 'farrierDate', width: 250, align: 'left', editable:true }, { name: 'notes', index: 'farrierNotes', width: 100, align: 'left', editable: true } ], pager: jQuery('#pager'), rowNum: 5, rowList: [5, 10, 20, 50], sortname: 'farrierDate', sortorder: "DESC", viewrecords: true }); What I want to be able to do, add a row to the grid, where the horseId is either a) not displayed or b) greyed out. But is passed to the controller when saving. The way it's set up is this grid will only have 1 horse id at a time (it will exist on a horse's property page.) The only time I've gotten anything to work is when I made it editable, but then that opens it up for the user to modify the id, which isn't a good idea. So is there some way I can set this value before submitting the data? it does exist as a variable on this page, if that helps any (and I've checked that it isn't null). Thanks

    Read the article

  • Creating cookieless application on development machine with asp.net

    - by zaladane
    I tried posting this on ServerFault with no luck so i am trying here. I am thinking about setting up a new domain to host static content on my website and have it cookieless just like Stackoverflow with their static domain. So before going ahead and buying the domain and setting it up I wanted to test it on my developement machine first under localhost (I have to mention that i am planning on having IIS running on my new domain for the static files). I therefore created a new application under IIS and disabled session state and forms authentication. When my main application needs resources like css, images and js , I use the path to the "static" application where they are hosted. The problem is that when I look at the request and the response for the requested files, they still have the session_id cookie defined as well as the asp.net authentication cookie. Is it at all possible to accomplish what i am trying to do on a development machine or do i have to just go ahead and purchase the new domain which hopefully with make things right? I tried to read about cookieless domain but can't figure out what i might be missing.

    Read the article

  • Strange ng-model behavior inside ng-repeat

    - by Mike Fisher
    I'm trying to build up a complex post request to run a report in my Angular app. I have a list of inputs all dynamically generated via an ng-repeat a simple version of my html looks like this. <div ng-repeat="filter in lists.filters"> <input type="checkbox" ng-model="report.options.filters[filter.value]['type']/> <input type="text" ng-model="report.options.filters[filter.value]['values']/> </div> ng-repeat is looping over this array [ {name: 'Advertisers', value: 'advertisers'}, {name: 'Sizes', value: 'sizes'}, {name: 'Campaign IDs', value: 'campaigns'}, {name: 'Creative IDs', value: 'creatives'}, {name: 'Publishers', value: 'publishers'}, {name: 'Placement IDs', value: 'placements'}, {name: 'Seller Types', value: 'seller_types'}, {name: 'Impression Types', value: 'impression_types'}, {name: 'Bid Types', value: 'bid_types'}, {name: 'Seller Members', value: 'seller_members'}, {name: 'Buyer Members', value: 'buyer_members'}, {name: 'Insertion Order Ids', value: 'insertion_orders'}, {name: 'Countries', value: 'countries'}, {name: 'Site Ids', value: 'sites'}, {name: 'Sources', value: 'sources'} ]; The JSON I'm sending back needs to be structured like this: "filters": { "state": "all", "campaigns": {type:"include", values":[1,2]}, "creatives": {type:"exclude","values":[1,2]}, "publishers": {"values":[1,2]}, "placements": {type:"exclude",values":[1,2]}, "advertisers": {"values":[1,2]}, "sizes": {"values":[1,2]}, "countries": {"values":[1,2]}, "insertion_orders": {"values":[1,2]}, "sites": {"values":[1,2]}, "bid_types": {"values":[1,2]}, "seller_types": {"values":[1,2]}, "impression_types": {"values":[1,2]}, "seller_members": {"values":[1,2]}, "buyer_members": {"values":[1,2]}, "sources": {"values":[1,2]} } When I do this Angular throws an error: 'Cannot set property 'values' of undefined' and 'Cannot set property 'type' of undefined' Yet if I do this (inside ng-repeat) <input type="text" ng-model="report.options.filters[filter.value]/> Or this outside of ng-repeat <input type="text" ng-model="report.options.filters[filter.value]['values']/> No errors are thrown and everything works fine. I'm positive that filter.value is defined and available on the scope even though Angular thinks it's not for some reason. I'm not quite sure what I'm doing wrong. Any help is much appreciated.

    Read the article

  • WPF TextBlock Binding to DependencyProperty

    - by Bill Campbell
    Hi, I have what I believe to be about one of the most simple cases of attempting to bind a view to a dependencyproperty in the view model. It seems that the initial changes are reflected in the view but other changes to the DP do not update the view's TextBlock. I'm probably just missing something simple but I just can't see what it is. Please take a look... My XAML has a status bar on the bottom of the window. I want to bind to the DP "VRAStatus". <StatusBar x:Name="sbar" Grid.Column="0" Grid.Row="2" Grid.ColumnSpan="2" VerticalAlignment="Bottom" Background="LightBlue" Opacity="0.4" DockPanel.Dock="Bottom" > <StatusBarItem> <TextBlock x:Name="statusBar" Text="{Binding VRAStatus}" /> </StatusBarItem> <StatusBarItem> <Separator Style="{StaticResource StatusBarSeparatorStyle}"/> </StatusBarItem> </StatusBar> My viewmodel has the DP defined: public string VRAStatus { get { return (string)GetValue(VRAStatusProperty); } set { SetValue(VRAStatusProperty, value); } } // Using a DependencyProperty as the backing store for VRAStatus. public static readonly DependencyProperty VRAStatusProperty = DependencyProperty.Register("VRAStatus", typeof(string), typeof(PenskeRouteAssistViewModel),new PropertyMetadata(string.Empty)); Then, in my code I set the DP: VRAStatus = "Test Message..."; Is there something obvious here that I am missing? In my constructor for the viewmodel I set the DP like this: VRAStatus = "Ready"; I never get the Test Message to display. Please Help. thanks in advance! Bill

    Read the article

  • Multi-level inheritance with Implements on properties in VB.NET vs C#

    - by Ben McCormack
    Let's say I have 2 interfaces defined like so: public interface ISkuItem { public string SKU { get; set; } } public interface ICartItem : ISkuItem { public int Quantity { get; set; } public bool IsDiscountable { get; set; } } When I go to implement the interface in C#, VS produces the following templated code: public class CartItem : ICartItem { #region ICartItem Members public int Quantity { get {...} set {...} } public bool IsDiscountable { get {...} set {...} } #endregion #region ISkuItem Members public string SKU { get {...} set {...} } #endregion } In VB.NET, the same class is built out like so: Public Class CartItem Implements ICartItem Public Property IsDiscountable As Boolean Implements ICartItem.IsDiscountable 'GET SET' End Property Public Property Quantity As Integer Implements ICartItem.Quantity 'GET SET' End Property Public Property SKU As String Implements ISkuItem.SKU 'GET SET' End Property End Class VB.NET explicitly requires you to add Implements IInterfaceName.PropertyName after each property that gets implemented whereas C# simply uses regions to indicate which properties and methods belong to the interface. Interestingly in VB.NET, on the SKU property, I can specify either Implements ISkuItem.SKU or Implements ICartItem.SKU. Although the template built by VS defaults to ISkuItem, I can also specify ICartItem if I want. Oddly, because C# only uses regions to block out inherited properties, it seems that I can't explicitly specify the implementing interface of SKU in C# like I can in VB.NET. My question is: Is there any importance behind being able to specify one interface or another to implement properites in VB.NET, and if so, is there a way to mimic this functionality in C#?

    Read the article

  • Question about functional OOP style in JavaScript

    - by valums
    I prefer to use functional OOP style for my code (similar to the module pattern) because it helps me to avoid the "new" keyword and all problems with the scope of "this" keyword in callbacks. But I've run into a few minor issues with it. I would like to use the following code to create a class. namespace.myClass = function(){ var self = {}, somePrivateVar1; // initialization code that would call // private or public methods privateMethod(); self.publicMethod(); // sorry, error here function privateMethod(){} self.publicMethod = function(){}; return self; } The problem is that I can't call public methods from my initialization code, as these functions are not defined yet. The obvious solution would be to create an init method, and call it before "return self" line. But maybe you know a more elegant solution? Also, how do you usually handle inheritance with this pattern? I use the following code, butI would like to hear your ideas and suggestions. namespace.myClass2 = function(){ var self = namespace.parentClass(), somePrivateVar1; var superMethod = self.someMethod; self.someMethod = function(){ // example shows how to overwrite parent methods superMethod(); }; return self; } Edit. For those who asked what are the reasons for choosing this style of OOP, you can look into following questions: http://stackoverflow.com/questions/1557386/prototypal-vs-functional-oop-in-javascript http://stackoverflow.com/questions/383402/is-javascript-s-new-keyword-considered-harmful

    Read the article

  • Problem with MessageContract, Generic return types and clientside naming

    - by Soeteman
    I'm building a web service which uses MessageContracts, because I want to add custom fields to my SOAP header. In a previous topic, I learned that a composite response has to be wrapped. For this purpose, I devised a generic ResponseWrapper class. [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName="WrapperOf{0}")] public class ResponseWrapper<T> { [MessageBodyMember(Namespace = "http://mynamespace.com")] public T Response { get; set; } } I made a ServiceResult base class, defined as follows: [MessageContract(WrapperNamespace = "http://mynamespace.com")] public class ServiceResult { [MessageBodyMember] public bool Status { get; set; } [MessageBodyMember] public string Message { get; set; } [MessageBodyMember] public string Description { get; set; } } To be able to include the request context in the response, I use a derived class of ServiceResult, which uses generics: [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName = "ServiceResultOf{0}")] public class ServiceResult<TRequest> : ServiceResult { [MessageBodyMember] public TRequest Request { get; set; } } This is used in the following way [OperationContract()] ResponseWrapper<ServiceResult<HCCertificateRequest>> OrderHealthCertificate(RequestContext<HCCertificateRequest> context); I expected my client code to be generated as ServiceResultOfHCCertificateRequest OrderHealthCertificate(RequestContextOfHCCertificateRequest context); Instead, I get the following: ServiceResultOfHCCertificateRequestzSOTD_SSj OrderHealthCertificate(CompType1 c1, CompType2 c2, HCCertificateRequest context); CompType1 and CompType2 are properties of the RequestContext class. The problem is that a hash is added to the end of ServiceResultOfHCCertificateRequestzSOTD_SSj. How do I need define my generic return types in order for the client type to be generated as expected (without the hash)?

    Read the article

< Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >