Search Results

Search found 8286 results on 332 pages for 'defined'.

Page 234/332 | < Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >

  • F# Class with Generics : 'constructor deprecated' error

    - by akaphenom
    I am trying to create a a class that will store a time series of data - organized by groups, but I had some compile errors so I stripped down to the basics (just a simple instantiation) and still can't overcome the compile error. I was hoping some one may have seen this issue before. Clas is defined as: type TimeSeriesQueue<'V, 'K when 'K: comparison> = class val private m_daysInCache: int val private m_cache: Map<'K, 'V list ref > ref; val private m_getKey: ('V -> 'K) ; private new(getKey) = { m_cache = ref Map.empty m_daysInCache = 7 ; m_getKey = getKey ; } end So that looks OK to me (it may not be, but doesnt have any errors or warnings) - the instantiation gets the error: type tempRec = { someKey: string ; someVal1: int ; someVal2: int ; } let keyFunc r:tempRec = r.someKey // error occurs on the following line let q = new TimeSeriesQueue<tempRec, string> keyFunc This construct is deprecated: The use of the type syntax 'int C' and 'C ' is not permitted here. Consider adjusting this type to be written in the form 'C' NOTE This may be simple stupidity - I am just getting back from holiday and my brain is still on time zone lag...

    Read the article

  • What is the correct way to configure a spring TextEncryptor for use on Heroku

    - by Ollie Edwards
    I have a spring TextEncryptor defined like this <bean id="textEncryptor" class="org.springframework.security.crypto.encrypt.Encryptors" factory-method="text"> <constructor-arg value="${security.encryptPassword}" /> <constructor-arg value="${security.encryptSalt}" /> </bean> Which is fed these properties security.encryptPassword=47582920264f212c566d5e5a6d security.encryptSalt=39783e315e6a207e733d6f4141 Which works fine on my local environment. When I deploy to Heroku I get java.lang.IllegalArgumentException: Unable to initialize due to invalid secret key at org.springframework.security.crypto.encrypt.CipherUtils.initCipher(CipherUtils.java:110) at org.springframework.security.crypto.encrypt.AesBytesEncryptor.encrypt(AesBytesEncryptor.java:65) at org.springframework.security.crypto.encrypt.HexEncodingTextEncryptor.encrypt(HexEncodingTextEncryptor.java:36) ... Caused by: java.security.InvalidKeyException: Illegal key size at javax.crypto.Cipher.checkCryptoPerm(Cipher.java:972) at javax.crypto.Cipher.implInit(Cipher.java:738) at javax.crypto.Cipher.chooseProvider(Cipher.java:797) at javax.crypto.Cipher.init(Cipher.java:1276) at javax.crypto.Cipher.init(Cipher.java:1215) at org.springframework.security.crypto.encrypt.CipherUtils.initCipher(CipherUtils.java:105) ... 53 more So I tried some smaller keys but I always get the same problem. What is the correct key size to use on Heroku?

    Read the article

  • Formula parsing / evaluation routine or library with generic DLookup functionality

    - by tbone
    I am writing a .Net application where I must support user-defined formulas that can perform basic mathematics, as well as accessing data from any arbitrary table in the database. I have the math part working, using JScript Eval(). What I haven't decided on is what a nice way is to do the generic table lookups. For example, I may have a formula something like: Column: BonusAmount Formula: {CurrentSalary} * 1.5 * {[SystemSettings][Value][SettingName=CorpBonus AND Year={Year}]} So, in this example I would replace {xxx} and {Year} with the value of Column xxx from the current table, and I would replace the second part with the value of (select Value from SystemSettings WHERE SettingName='CorpBonus' AND Year=2008) So, basically, I am looking for something very much like the MS Access DLookup function: DLookup ( expression, domain, [criteria] ) DLookup("[UnitPrice]", "Order Details", "OrderID = 10248") But, I also need to overall parsing routine that can tell whether to just look up in the current row, or to look into another table. Would also be nice to support aggregate functions (ie: DAvg, DMax, etc), as well as all the weird edge cases handled. So I wonder if anyone knows of any sort of an existing library, or has a nice routine that can handle this formula parsing and database lookup / aggregate function resolution requirements.

    Read the article

  • Matplotlib canvas drawing

    - by Morgoth
    Let's say I define a few functions to do certain matplotlib actions, such as def dostuff(ax): ax.scatter([0.],[0.]) Now if I launch ipython, I can load these functions and start a new figure: In [1]: import matplotlib.pyplot as mpl In [2]: fig = mpl.figure() In [3]: ax = fig.add_subplot(1,1,1) In [4]: run functions # run the file with the above defined function If I now call dostuff, then the figure does not refresh: In [6]: dostuff(ax) I have to then explicitly run: In [7]: fig.canvas.draw() To get the canvas to draw. Now I can modify dostuff to be def dostuff(ax): ax.scatter([0.],[0.]) ax.get_figure().canvas.draw() This re-draws the canvas automatically. But now, say that I have the following code: def dostuff1(ax): ax.scatter([0.],[0.]) ax.get_figure().canvas.draw() def dostuff2(ax): ax.scatter([1.],[1.]) ax.get_figure().canvas.draw() def doboth(ax): dostuff1(ax) dostuff2(ax) ax.get_figure().canvas.draw() I can call each of these functions, and the canvas will be redrawn, but in the case of doboth(), it will get redrawn multiple times. My question is: how could I code this, such that the canvas.draw() only gets called once? In the above example it won't change much, but in more complex cases with tens of functions that can be called individually or grouped, the repeated drawing is much more obvious, and it would be nice to be able to avoid it. I thought of using decorators, but it doesn't look as though it would be simple. Any ideas?

    Read the article

  • struts2: Redirect from global interceptor

    - by Dewfy
    In struts2 I have very simple task, after user is logged-in I'm checking if they profile is complete. If not user should be blocked from any other action and redirected to edit page. So I have created my default package: <package name="main" extends="tiles-default" > <interceptors> <interceptor name="checkProfile" class="my.CheckProfileInterceptor" /> <interceptor-stack name="secure"> <interceptor-ref name="defaultStack"/> <interceptor-ref name="checkProfile"/> </interceptor-stack> </interceptors> <default-interceptor-ref name="secure"/> </package> After it all my packages would include this template as a base: <package namespace="/packageA" name="packageA" extends="main"> ... <package namespace="/packageB" name="packageB" extends="main"> ... Saying editing page is /packageA/editProfile, my interceptor does following: public String intercept(ActionInvocation actionInvocation) throws Exception { if( currentUser.isOk() ) return "editProfile"; ... BUT! interceptor is global, so it raises struts2 error: No result defined for action (name of editProfile action class) When interceptor is placed inside some package - then everything ok. What should i do to declare global action?

    Read the article

  • Passing viewmodel to actionresult creates new viewmodel

    - by Jonas Bohez
    I am using a viewmodel, which i then when to send to an actionresult to use (the modified viewmodel) But in the controller, i lose the list and objects in my viewmodel. This is my view: @using PigeonFancier.Models @model PigeonFancier.Models.InschrijvingModel @using (Html.BeginForm("UpdateInschrijvingen","Melker",Model)) { <div> <fieldset> <table> @foreach (var item in Model.inschrijvingLijst) { <tr> <td>@Html.DisplayFor(model => item.Duif.Naam)</td> <td> @Html.CheckBoxFor(model => item.isGeselecteerd)</td> </tr> } </table> <input type="submit" value="Wijzigen"/> </fieldset> </div> } This is my controller, which does nothing at the moment until i can get the full viewmodel back from the view. public ActionResult UpdateInschrijvingen(InschrijvingModel inschrijvingsModel) { // inschrijvingsModel is not null, but it creates a new model before it comes here with //Use the model for some updates return RedirectToAction("Inschrijven", new { vluchtId = inschrijvingsModel.vlucht.VluchtId }); } This is the model with the List and some other objects who become null because it creates a new model when it comes back from the view to the actionresult public class InschrijvingModel { public Vlucht vlucht; public Duivenmelker duivenmelker; public List<CheckBoxModel> inschrijvingLijst { get; set; } public InschrijvingModel() { // Without this i get, No parameterless constructor defined exception. // So it uses this when it comes back from the view to make a new model } public InschrijvingModel(Duivenmelker m, Vlucht vl) { inschrijvingLijst = new List<CheckBoxModel>(); vlucht = vl; duivenmelker = m; foreach (var i in m.Duiven) { inschrijvingLijst.Add(new CheckBoxModel(){Duif = i, isGeselecteerd = i.IsIngeschrevenOpVlucht(vl)}); } } What is going wrong and how should i fix this problem please? Thanks

    Read the article

  • Templates vs. coded HTML

    - by Alan Harris-Reid
    I have a web-app consisting of some html forms for maintaining some tables (SQlite, with CherryPy for web-server stuff). First I did it entirely 'the Python way', and generated html strings via. code, with common headers, footers, etc. defined as functions in a separate module. I also like the idea of templates, so I tried Jinja2, which I find quite developer-friendly. In the beginning I thought templates were the way to go, but that was when pages were simple. Once .css and .js files were introduced (not necessarily in the same folder as the .html files), and an ever-increasing number of {{...}} variables and {%...%} commands were introduced, things started getting messy at design-time, even though they looked great at run-time. Things got even more difficult when I needed additional javascript in the or sections. As far as I can see, the main advantages of using templates are: Non-dynamic elements of page can easily be viewed in browser during design. Except for {} placeholders, html is kept separate from python code. If your company has a web-page designer, they can still design without knowing Python. while some disadvantages are: {{}} delimiters visible when viewed at design-time in browser Associated .css and .js files have to be in same folder to see effects in browser at design-time. Data, variables, lists, etc., must be prepared in advanced and either declared globally or passed as parameters to render() function. So - when to use 'hard-coded' HTML, and when to use templates? I am not sure of the best way to go, so I would be interested to hear other developers' views. TIA, Alan

    Read the article

  • PHP - Find parent key of array

    - by Jordan Rynard
    I'm trying to find a way to return the value of an array's parent key. For example, from the array below I'd like to find out the parent's key where $array['id'] == "0002". The parent key is obvious because it's defined here (it would be 'products'), but normally it'd be dynamic, hence the problem. The 'id' and value of 'id' is known though. [0] => Array ( [data] => [id] => 0000 [name] => Swirl [categories] => Array ( [0] => Array ( [id] => 0001 [name] => Whirl [products] => Array ( [0] => Array ( [id] => 0002 [filename] => 1.jpg ) [1] => Array ( [id] => 0003 [filename] => 2.jpg ) ) ) ) )

    Read the article

  • Android : Customizing tabs on state : How do I make a selector a drawable

    - by Chrispix
    I know how to put the icon on each tab, that is no problem. I also ran across this : Stack Overflow thread on pretty much same thing I followed one of the links from that question, and found this Pretty much, it said use a selector defined in the xml, sure, did that. But there is no id associated w/ it so I am not sure how to get the selector function as a drawable so I can use it as the icon for the tabs. Maybe I am going about this the wrong way.. But this is what I have, and obviously missing something. <selector android:id="@+id/myselector" xmlns:android="http://schemas.android.com/apk/res/android"> <!-- Non focused states --> <item android:state_focused="false" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/darklogo" /> <item android:state_focused="false" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Focused states --> <item android:state_focused="true" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <item android:state_focused="true" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Pressed --> <item android:state_pressed="true" android:drawable="@drawable/lightlogo" /> </selector> In my code, an example tab is generated using : host.addTab(host.newTabSpec("three") .setIndicator("map",drawables) .setContent(new Intent(this, Map.class))); Right now drawables is just a reference to an drawable image resource. How do I make the selector a drawable? * This is my question *

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Multiplication algorithm for abritrary precision (bignum) integers.

    - by nn
    Hi, I'm writing a small bignum library for a homework project. I am to implement Karatsuba multiplication, but before that I would like to write a naive multiplication routine. I'm following a guide written by Paul Zimmerman titled "Modern Computer Arithmetic" which is freely available online. On page 4, there is a description of an algorithm titled BasecaseMultiply which performs gradeschool multiplication. I understand step 2, 3, where B^j is a digit shift of 1, j times. But I don't understand step 1 and 3, where we have A*b_j. How is this multiplication meant to be carried out if the bignum multiplication hasn't been defined yet? Would the operation "*" in this algorithm just be the repeated addition method? Here is the parts I have written thus far. I have unit tested them so they appear to be correct for the most part: The structure I use for my bignum is as follows: #define BIGNUM_DIGITS 2048 typedef uint32_t u_hw; // halfword typedef uint64_t u_w; // word typedef struct { unsigned int sign; // 0 or 1 unsigned int n_digits; u_hw digits[BIGNUM_DIGITS]; } bn; Currently available routines: bn *bn_add(bn *a, bn *b); // returns a+b as a newly allocated bn void bn_lshift(bn *b, int d); // shifts d digits to the left, retains sign int bn_cmp(bn *a, bn *b); // returns 1 if a>b, 0 if a=b, -1 if a<b

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • Proper way to set PYTHONPATH (including precedence)

    - by Wells
    In .bashrc I have: export PYTHONPATH=/home/wells/py-mlb I've verified this is actually being set. so, in this directory is another directory called 'py_mlb'- the actual module. So I go python -v and then import py_mlb but it does: >>> import py_mlb import py_mlb # directory /usr/local/lib/python2.6/dist-packages/py_mlb Then I do import sys and print sys.path and I see: >>> print sys.path ['', '/usr/local/lib/python2.6/dist-packages/python_memcached-1.44-py2.6.egg', '/usr/local/lib/python2.6/dist-packages/pymc-2.1alpha-py2.6-linux-i686.egg', '/usr/local/lib/python2.6/dist-packages/nose-0.11.1-py2.6.egg', '/home/wells/py-mlb', '/usr/lib/python2.6', '/usr/lib/python2.6/plat-linux2', '/usr/lib/python2.6/lib-tk', '/usr/lib/python2.6/lib-old', '/usr/lib/python2.6/lib-dynload', '/usr/lib/python2.6/dist-packages', '/usr/local/lib/python2.6/dev-packages', '/usr/lib/pymodules/python2.6', '/usr/lib/pymodules/python2.6/gtk-2.0', '/usr/local/lib/python2.6/dist-packages'] So my path from .bashrc IS in there, and from the look of it it's even before dist-packages but it's importing the module from dist-packages. How can I finagle this so the PYTHONPATH as defined by .bashrc takes precedence? Thanks!

    Read the article

  • Workflow engine BPMN, Drools, etc or ESB?

    - by Tom
    We currently have an application that is based on an in-house developed workflow engine with YAML based DSL. We are looking to move parts of it to Java. I have discovered a number of java solutions like Intalio, JBPM, Drools Expert, Drools Flow etc. They appear to be aimed at businesses where the business analyst creates the workflows using a graphical editor and submits them to the workflow engine. They seem geared towards ease of use for non-technical people rather than for developers with a focus on human interaction. The workflows tend to look like. Discover-a-file -\ -> join -> process-file -> move-file -> register-file Discover-some-metadata -/ If any step fails we need to retry it X times. We also need to be able to stop the system and be able to restart it and have it continue from where it was (durable). Some of our workflows can be defined by a set of goals we need to achieve so Jess's backwards rule chaining sounds interesting but it is not open source. It might be that what we are after is a Finite State Machine engine or just an Enterprise Service Bus and do everything as JMS queues. Is there a good open source workflow engine that is both standards-based but also geared towards developers. We don't particular want to use a graphical workflow designer or write reams of XML and it should ideally be in Java or language agnostic (makes REST/Soap calls to external services). Thanks, Tom

    Read the article

  • Zend Framework: Zend_translate and routing related issue

    - by Dan
    I have implemented Zend_Navigation, Zend_Translate in my application. The routing is setup in Bootstrap.php like below. $fc = Zend_Controller_Front::getInstance(); $zl=new Zend_Locale(); Zend_Registry::set('Zend_Locale',$zl); $lang=$zl->getLanguage().'_'.$zl->getRegion(); $router = $fc->getRouter(); $route = new Zend_Controller_Router_Route(':lang/:module/:controller/:action/*', array( 'lang'=>$lang, 'module'=>'default', 'controller'=>'index', 'action'=>'index' )); $router->addRoute('default', $route); $fc->setRouter($router); $fc->registerPlugin( new Plugin_LanguageSetup()); in LaunguageSetup Plugin i have defined the dispatchLoopStartup method to do the checking of the language param public function dispatchLoopStartup(Zend_Controller_Request_Abstract $request) { $this->createLangUrl($request); $this->_language = $request->getParam('lang'); if ((!isset($this->_language)) || !in_array($this->_language, $this->_languagesArray)) { $this->_language = 'en_US'; $request->setParam('lang', 'en_US'); } $file = APPLICATION_PATH.$this->_directory.$this->_language.'.csv'; $translate = new Zend_Translate('csv', $file, $this->_language); Zend_Registry::set('Zend_Translate', $translate); $zl = Zend_Registry::get('Zend_Locale'); $zl->setLocale($this->_language); Zend_Registry::set('Zend_Locale', $zl); // $fc = Zend_Controller_Front::getInstance(); // $router = $fc->getRouter(); // $route = new Zend_Controller_Router_Route(':lang/:module/:controller/:action/*', array( // 'lang'=>$this->_language, 'module'=>'default', 'controller'=>'index', 'action'=>'index' // )); // $router->addRoute('default', $route); // $fc->setRouter($router); } What happen is the language always have the default value, the 'lang' param never default lang value in route, even if i type it in the address bar manually i.e /en_US/module/controller/action/ It always get revert back to the default Zend_locale(); Only way i can fix it is to setup the route again in the plugin and inject a correct language value as default. Any Idea why?

    Read the article

  • Execute Ant task with Maven

    - by Gonzalo
    Hi, I'm trying to execute with Maven some test written using Ant tasks. I generated the files required to import the task into Maven, but I can't execute them. My POM is defined this way: <build> <plugins> <plugin> <artifactId>maven-ant-plugin</artifactId> <version>2.1</version> <executions> <execution> <phase>generate-sources</phase> <configuration> <tasks> <echo message="Hello, maven"/> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> </executions> </plugin> </plugins> </build> I try to execute that message, but I get an error with run: [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] 'run' was specified in an execution, but not found in the plugin But, if I run: "mvn antrun:run", I know that this can not run the task. An if I've different targets, how do I call them from Maven? I've the pom.xml, and build.xml with the ant tasks. Thanks. Gonzalo

    Read the article

  • refactor LINQ TO SQL custom properties that instantiate datacontext

    - by Thiago Silva
    I am working on an existing ASP.NET MVC app that started small and has grown with time to require a good re-architecture and refactoring. One thing that I am struggling with is that we've got partial classes of the L2S entities so we could add some extra properties, but these props create a new data context and query the DB for a subset of data. This would be the equivalent to doing the following in SQL, which is not a very good way to write this query as oppsed to joins: SELECT tbl1.stuff, (SELECT nestedValue FROM tbl2 WHERE tbl2.Foo = tbl1.Bar), tbl1.moreStuff FROM tbl1 so in short here's what we've got in some of our partial entity classes: public partial class Ticket { public StatusUpdate LastStatusUpdate { get { //this static method call returns a new DataContext but needs to be refactored var ctx = OurDataContext.GetContext(); var su = Compiled_Query_GetLastUpdate(ctx, this.TicketId); return su; } } } We've got some functions that create a compiled query, but the issue is that we also have some DataLoadOptions defined in the DataContext, and because we instantiate a new datacontext for getting these nested property, we get an exception "Compiled Queries across DataContexts with different LoadOptions not supported" . The first DataContext is coming from a DataContextFactory that we implemented with the refactorings, but this second one is just hanging off the entity property getter. We're implementing the Repository pattern in the refactoring process, so we must stop doing stuff like the above. Does anyone know of a good way to address this issue?

    Read the article

  • Getting Started with AJAX ToolKit Controls

    - by Aviran
    I am trying to make my first AJAX Control and I get error. I probbly missed some steps but I cann't find them eventhough I read many tutorials, probbly since I am new in AJAX, so I need to be guided step-by-step. These are the steps I've already done: Downloading AJAX ToolKit. Adding These Controls to the ToolBox. creating new ASP.NET Website (I heard about AJAX-Enabled Option, but I dont have this option) Adding a AJAX Tool. And thats it. I read that I need to register add AjaxControlToolkit.dll in application bin folder, but I dont know how to do that and I dont have Bin Folder in my website, only App_Data Folder. than I need to add this to the web config: <add tagPrefix="ajaxToolkit" namespace="AjaxControlToolkit" assembly="AjaxControlToolkit"/> than I need to add this to my website: <asp:ScriptManager ID="scriptmanager1" EnablePartialRendering="true" runat="Server" /> This is the error I receive: "Compilation Error Description: An error occurred during the compilation of a resource required to service this request. Please review the following specific error details and modify your source code appropriately. Compiler Error Message: CS0012: The type 'System.Web.UI.ExtenderControl' is defined in an assembly that is not referenced. You must add a reference to assembly 'System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35'." Source Error: Line 16: <br /> Line 17: <asp:Label ID="Label1" runat="server" Text="Label" Width="229px"></asp:Label><br /> Line 18: <asp:ConfirmButtonExtender ID="ConfirmButtonExtender1" runat="server" ConfirmText="are you sure" Line 19: TargetControlID="Button1"> Line 20: </asp:ConfirmButtonExtender> Does anyone know how can I solve this error?

    Read the article

  • Why does Java's invokevirtual need to resolve the called method's compile-time class?

    - by Chris
    Consider this simple Java class: class MyClass { public void bar(MyClass c) { c.foo(); } } I want to discuss what happens on the line c.foo(). At the bytecode level, the meat of c.foo() will be the invokevirtual opcode, and, according to the documentation for invokevirtual, more or less the following will happen: Look up the foo method defined in compile-time class MyClass. (This involves first resolving MyClass.) Do some checks, including: Verify that c is not an initialization method, and verify that calling MyClass.foo wouldn't violate any protected modifiers. Figure out which method to actually call. In particular, look up c's runtime type. If that type has foo(), call that method and return. If not, look up c's runtime type's superclass; if that type has foo, call that method and return. If not, look up c's runtime type's superclass's superclass; if that type has foo, call that method and return. Etc.. If no suitable method can be found, then error. Step #3 alone seems adequate for figuring out which method to call and verifying that said method has the correct argument/return types. So my question is why step #1 gets performed in the first place. Possible answers seem to be: You don't have enough information to perform step #3 until step #1 is complete. (This seems implausible at first glance, so please explain.) The linking or access modifier checks done in #1 and #2 are essential to prevent certain bad things from happening, and those checks must be performed based on the compile-time type, rather than the run-time type hierarchy. (Please explain.)

    Read the article

  • Graph limitations - Should I use Decorator?

    - by Nick Wiggill
    I have a functional AdjacencyListGraph class that adheres to a defined interface GraphStructure. In order to layer limitations on this (eg. acyclic, non-null, unique vertex data etc.), I can see two possible routes, each making use of the GraphStructure interface: Create a single class ("ControlledGraph") that has a set of bitflags specifying various possible limitations. Handle all limitations in this class. Update the class if new limitation requirements become apparent. Use the decorator pattern (DI, essentially) to create a separate class implementation for each individual limitation that a client class may wish to use. The benefit here is that we are adhering to the Single Responsibility Principle. I would lean toward the latter, but by Jove!, I hate the decorator Pattern. It is the epitome of clutter, IMO. Truthfully it all depends on how many decorators might be applied in the worst case -- in mine so far, the count is seven (the number of discrete limitations I've recognised at this stage). The other problem with decorator is that I'm going to have to do interface method wrapping in every... single... decorator class. Bah. Which would you go for, if either? Or, if you can suggest some more elegant solution, that would be welcome. EDIT: It occurs to me that using the proposed ControlledGraph class with the strategy pattern may help here... some sort of template method / functors setup, with individual bits applying separate controls in the various graph-canonical interface methods. Or am I losing the plot?

    Read the article

  • How do I make Views fill the full width of their parent in my Android app?

    - by Omega
    I have the following layout defined for one of my Activities: <?xml version="1.0" encoding="utf-8"?> <TableLayout android:id="@+id/TableLayout01" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android"> <TableRow android:id="@+id/TableRow01" android:layout_height="wrap_content" android:layout_width="fill_parent"> <EditText android:text="Resource Name" android:id="@+id/ResourceName" android:lines="1" android:isScrollContainer="false"></EditText> </TableRow> <TableRow android:id="@+id/TableRow02" android:layout_height="wrap_content" android:layout_width="fill_parent"> <Button android:id="@+id/Tile" android:text="Tile"></Button> </TableRow> </TableLayout> The layout renders almost correctly, the only problem is that my text box and my button aren't occupying the full width of their respective rows. I've tried specifying fill_parent for the layout width properties, but to no avail, they still only occupy roughly half of the screen. Documentation overall for Android so far has been great, but there are a few scenarios like this one where I hit an invisible wall! Thanks for all the help!

    Read the article

  • Encryption in Java & Flex

    - by Jef
    I want tp encrypt and decrypt string, with defined salt. But the result must be same if the code run in java and adobe flex. The main goal is: the app in adobe flex will be generate a string that can be decrypt in server using java. I use this flex library http://crypto.hurlant.com/demo/ Try to 'Secret Key' Tab. I want to use AES Encryption, 'CBC' or 'PKCS5'. var k:String = "1234567890123456"; var kdata:ByteArray = Hex.toArray(k); var txt:String = "hello"; var data:ByteArray = Hex.toArray(Hex.fromString(txt));; var name:String = "simple-aes-cbc"; var pad:IPad =new PKCS5(); var mode:ICipher = Crypto.getCipher(name, kdata, pad); pad.setBlockSize(mode.getBlockSize()); mode.encrypt(data); encrypted.text=Hex.fromArray(data); trace(Hex.fromArray(data)); And here is the code in java String plaintext = "hello"; String key = "1234567890123456"; SecretKey keyspec = new SecretKeySpec(key.getBytes(), "AES"); Cipher cipher = Cipher.getInstance("AES/CBC/PKCS5Padding"); cipher.init(Cipher.ENCRYPT_MODE,keyspec); byte[] encrypted = cipher.doFinal(plaintext.getBytes()); BASE64Encoder base64 = new BASE64Encoder(); String encodedString = base64.encode(encrypted); System.out.println(encodedString); Why the result is not same? Can you guys provide the sample with the same result both of java and flex (encrypt and decrypt)? And if I want to change the paramater, for example, from cbc to ebc, which line that need to be changed? Thanks!

    Read the article

  • Alternatives to storing Moose object using Apache::Session with CODE references

    - by Hartmut Behrens
    I have a Moose class that i would like to store using Apache::Session::File. However, Apache::Session::File by default will not store it and instead i get the error message: (in cleanup) Can't store CODE items at blib\lib\Storable.pm (autosplit into blib\lib\auto\Storable\_freeze.al)... This problem can be circumvented by setting $Storable::Deparse = 1; $Storable::Eval = 1; in order to allow CODE references to be serialized. The offending method in the Moose class is listed below, which retrieves a column from a mysql database: sub _build_cell_generic { my ($self,$col) = @_; my $sth = $self->call_dbh('prepare','select '.$col.' from '.$self->TABLE.' where CI = ? and LAC = ? and IMPORTDATE = ?'); $sth->execute($self->CI,$self->LAC,$self->IMPORTDATE); my $val = $sth->fetchrow_array; $sth->finish; return defined $val ? $val : undef; } So presumably the dbh object (isa DBIx::Connector) contains CODE references. Is there a better alternative in order to allow serialization of this Moose class than setting $Storable::Deparse and $Storable::Eval ?

    Read the article

  • XML parsing design using xmlpp and C++

    - by shagv
    I would like to use an xml format similar to the following: <CONFIG> <PROFILE NAME="foobar"> <PARAM ID="0" NAME="Foo" CLASS="BaseParam"/> <PARAM ID="2" NAME="Bar" CLASS="StrIntParam"> <VALUE TYPE="STRING">some String</VALUE> <VALUE TYPE="INT">1234</VALUE> </PARAM> </PROFILE> </CONFIG> CONFIG contains a list of PROFILEs which contain a list of PARAMs which themselves can be any structure (to be defined in the future). The idea was to define classes that parsed each PARAM type and to keep track of which class to use in the PARAM's CLASS attribute. In code I have a config class that manages the list of profiles and a profile class that manages the list of params. I would like the profile class to handle additional param types (that inherit BaseParam) without modification to the profile class (or at the very least with minimal modification). First of all, is this design viable? If so, what are some ways I could use different param classes and have their creation at run-time be automatic (the profile class sees the CLASS attribute and knows which type to create)?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >