Search Results

Search found 8286 results on 332 pages for 'defined'.

Page 234/332 | < Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >

  • Probably an easy one - PHP/CodeIgniter 'Undefined Variable'

    - by Jack W-H
    Morning y'all This is probably an easy one but I barely got any sleep last night and am struggling to comprehend anything. I've got a CodeIgniter library I've made called Points.php. Here's the contents of Points: <?php if (!defined('BASEPATH')) exit('No direct script access allowed'); class Points { function __construct() { $this->ci =& get_instance(); $this->ci->load->database(); } function getpoints($params) { echo $userid; } } /* End of file Points.php */ /* Location: ./application/libraries/Points.php */ ?> As you can see, I'm building it up slowly and it's being kept simple. In one of my views, I want it to display the number of 'points' (which for the time being is simply the third segment of the URI). I call it like this: <p>Points: <?php $params['user_id']=$this->uri->segment(3,1); echo $this->points->getpoints($params); ?></p> The warning I get back in the view is this: A PHP Error was encountered Severity: Notice Message: Undefined variable: userid Filename: libraries/Points.php Yes I know it's such a simple problem but I've tried lots of things. Some variations include echoing in Points.php $params['userid']; etc. But I don't see what I'm doing wrong? This is my first CodeIgniter class and I've fallen at the first step, haha...

    Read the article

  • Multiplication algorithm for abritrary precision (bignum) integers.

    - by nn
    Hi, I'm writing a small bignum library for a homework project. I am to implement Karatsuba multiplication, but before that I would like to write a naive multiplication routine. I'm following a guide written by Paul Zimmerman titled "Modern Computer Arithmetic" which is freely available online. On page 4, there is a description of an algorithm titled BasecaseMultiply which performs gradeschool multiplication. I understand step 2, 3, where B^j is a digit shift of 1, j times. But I don't understand step 1 and 3, where we have A*b_j. How is this multiplication meant to be carried out if the bignum multiplication hasn't been defined yet? Would the operation "*" in this algorithm just be the repeated addition method? Here is the parts I have written thus far. I have unit tested them so they appear to be correct for the most part: The structure I use for my bignum is as follows: #define BIGNUM_DIGITS 2048 typedef uint32_t u_hw; // halfword typedef uint64_t u_w; // word typedef struct { unsigned int sign; // 0 or 1 unsigned int n_digits; u_hw digits[BIGNUM_DIGITS]; } bn; Currently available routines: bn *bn_add(bn *a, bn *b); // returns a+b as a newly allocated bn void bn_lshift(bn *b, int d); // shifts d digits to the left, retains sign int bn_cmp(bn *a, bn *b); // returns 1 if a>b, 0 if a=b, -1 if a<b

    Read the article

  • F# Class with Generics : 'constructor deprecated' error

    - by akaphenom
    I am trying to create a a class that will store a time series of data - organized by groups, but I had some compile errors so I stripped down to the basics (just a simple instantiation) and still can't overcome the compile error. I was hoping some one may have seen this issue before. Clas is defined as: type TimeSeriesQueue<'V, 'K when 'K: comparison> = class val private m_daysInCache: int val private m_cache: Map<'K, 'V list ref > ref; val private m_getKey: ('V -> 'K) ; private new(getKey) = { m_cache = ref Map.empty m_daysInCache = 7 ; m_getKey = getKey ; } end So that looks OK to me (it may not be, but doesnt have any errors or warnings) - the instantiation gets the error: type tempRec = { someKey: string ; someVal1: int ; someVal2: int ; } let keyFunc r:tempRec = r.someKey // error occurs on the following line let q = new TimeSeriesQueue<tempRec, string> keyFunc This construct is deprecated: The use of the type syntax 'int C' and 'C ' is not permitted here. Consider adjusting this type to be written in the form 'C' NOTE This may be simple stupidity - I am just getting back from holiday and my brain is still on time zone lag...

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • PHP - Find parent key of array

    - by Jordan Rynard
    I'm trying to find a way to return the value of an array's parent key. For example, from the array below I'd like to find out the parent's key where $array['id'] == "0002". The parent key is obvious because it's defined here (it would be 'products'), but normally it'd be dynamic, hence the problem. The 'id' and value of 'id' is known though. [0] => Array ( [data] => [id] => 0000 [name] => Swirl [categories] => Array ( [0] => Array ( [id] => 0001 [name] => Whirl [products] => Array ( [0] => Array ( [id] => 0002 [filename] => 1.jpg ) [1] => Array ( [id] => 0003 [filename] => 2.jpg ) ) ) ) )

    Read the article

  • How do I make Views fill the full width of their parent in my Android app?

    - by Omega
    I have the following layout defined for one of my Activities: <?xml version="1.0" encoding="utf-8"?> <TableLayout android:id="@+id/TableLayout01" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android"> <TableRow android:id="@+id/TableRow01" android:layout_height="wrap_content" android:layout_width="fill_parent"> <EditText android:text="Resource Name" android:id="@+id/ResourceName" android:lines="1" android:isScrollContainer="false"></EditText> </TableRow> <TableRow android:id="@+id/TableRow02" android:layout_height="wrap_content" android:layout_width="fill_parent"> <Button android:id="@+id/Tile" android:text="Tile"></Button> </TableRow> </TableLayout> The layout renders almost correctly, the only problem is that my text box and my button aren't occupying the full width of their respective rows. I've tried specifying fill_parent for the layout width properties, but to no avail, they still only occupy roughly half of the screen. Documentation overall for Android so far has been great, but there are a few scenarios like this one where I hit an invisible wall! Thanks for all the help!

    Read the article

  • Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

    - by Thomas Schreiner
    Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

    Read the article

  • Zend Framework: Zend_translate and routing related issue

    - by Dan
    I have implemented Zend_Navigation, Zend_Translate in my application. The routing is setup in Bootstrap.php like below. $fc = Zend_Controller_Front::getInstance(); $zl=new Zend_Locale(); Zend_Registry::set('Zend_Locale',$zl); $lang=$zl->getLanguage().'_'.$zl->getRegion(); $router = $fc->getRouter(); $route = new Zend_Controller_Router_Route(':lang/:module/:controller/:action/*', array( 'lang'=>$lang, 'module'=>'default', 'controller'=>'index', 'action'=>'index' )); $router->addRoute('default', $route); $fc->setRouter($router); $fc->registerPlugin( new Plugin_LanguageSetup()); in LaunguageSetup Plugin i have defined the dispatchLoopStartup method to do the checking of the language param public function dispatchLoopStartup(Zend_Controller_Request_Abstract $request) { $this->createLangUrl($request); $this->_language = $request->getParam('lang'); if ((!isset($this->_language)) || !in_array($this->_language, $this->_languagesArray)) { $this->_language = 'en_US'; $request->setParam('lang', 'en_US'); } $file = APPLICATION_PATH.$this->_directory.$this->_language.'.csv'; $translate = new Zend_Translate('csv', $file, $this->_language); Zend_Registry::set('Zend_Translate', $translate); $zl = Zend_Registry::get('Zend_Locale'); $zl->setLocale($this->_language); Zend_Registry::set('Zend_Locale', $zl); // $fc = Zend_Controller_Front::getInstance(); // $router = $fc->getRouter(); // $route = new Zend_Controller_Router_Route(':lang/:module/:controller/:action/*', array( // 'lang'=>$this->_language, 'module'=>'default', 'controller'=>'index', 'action'=>'index' // )); // $router->addRoute('default', $route); // $fc->setRouter($router); } What happen is the language always have the default value, the 'lang' param never default lang value in route, even if i type it in the address bar manually i.e /en_US/module/controller/action/ It always get revert back to the default Zend_locale(); Only way i can fix it is to setup the route again in the plugin and inject a correct language value as default. Any Idea why?

    Read the article

  • Problem with MessageContract, Generic return types and clientside naming

    - by Soeteman
    I'm building a web service which uses MessageContracts, because I want to add custom fields to my SOAP header. In a previous topic, I learned that a composite response has to be wrapped. For this purpose, I devised a generic ResponseWrapper class. [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName="WrapperOf{0}")] public class ResponseWrapper<T> { [MessageBodyMember(Namespace = "http://mynamespace.com")] public T Response { get; set; } } I made a ServiceResult base class, defined as follows: [MessageContract(WrapperNamespace = "http://mynamespace.com")] public class ServiceResult { [MessageBodyMember] public bool Status { get; set; } [MessageBodyMember] public string Message { get; set; } [MessageBodyMember] public string Description { get; set; } } To be able to include the request context in the response, I use a derived class of ServiceResult, which uses generics: [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName = "ServiceResultOf{0}")] public class ServiceResult<TRequest> : ServiceResult { [MessageBodyMember] public TRequest Request { get; set; } } This is used in the following way [OperationContract()] ResponseWrapper<ServiceResult<HCCertificateRequest>> OrderHealthCertificate(RequestContext<HCCertificateRequest> context); I expected my client code to be generated as ServiceResultOfHCCertificateRequest OrderHealthCertificate(RequestContextOfHCCertificateRequest context); Instead, I get the following: ServiceResultOfHCCertificateRequestzSOTD_SSj OrderHealthCertificate(CompType1 c1, CompType2 c2, HCCertificateRequest context); CompType1 and CompType2 are properties of the RequestContext class. The problem is that a hash is added to the end of ServiceResultOfHCCertificateRequestzSOTD_SSj. How do I need define my generic return types in order for the client type to be generated as expected (without the hash)?

    Read the article

  • Formula parsing / evaluation routine or library with generic DLookup functionality

    - by tbone
    I am writing a .Net application where I must support user-defined formulas that can perform basic mathematics, as well as accessing data from any arbitrary table in the database. I have the math part working, using JScript Eval(). What I haven't decided on is what a nice way is to do the generic table lookups. For example, I may have a formula something like: Column: BonusAmount Formula: {CurrentSalary} * 1.5 * {[SystemSettings][Value][SettingName=CorpBonus AND Year={Year}]} So, in this example I would replace {xxx} and {Year} with the value of Column xxx from the current table, and I would replace the second part with the value of (select Value from SystemSettings WHERE SettingName='CorpBonus' AND Year=2008) So, basically, I am looking for something very much like the MS Access DLookup function: DLookup ( expression, domain, [criteria] ) DLookup("[UnitPrice]", "Order Details", "OrderID = 10248") But, I also need to overall parsing routine that can tell whether to just look up in the current row, or to look into another table. Would also be nice to support aggregate functions (ie: DAvg, DMax, etc), as well as all the weird edge cases handled. So I wonder if anyone knows of any sort of an existing library, or has a nice routine that can handle this formula parsing and database lookup / aggregate function resolution requirements.

    Read the article

  • Android : Customizing tabs on state : How do I make a selector a drawable

    - by Chrispix
    I know how to put the icon on each tab, that is no problem. I also ran across this : Stack Overflow thread on pretty much same thing I followed one of the links from that question, and found this Pretty much, it said use a selector defined in the xml, sure, did that. But there is no id associated w/ it so I am not sure how to get the selector function as a drawable so I can use it as the icon for the tabs. Maybe I am going about this the wrong way.. But this is what I have, and obviously missing something. <selector android:id="@+id/myselector" xmlns:android="http://schemas.android.com/apk/res/android"> <!-- Non focused states --> <item android:state_focused="false" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/darklogo" /> <item android:state_focused="false" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Focused states --> <item android:state_focused="true" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <item android:state_focused="true" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Pressed --> <item android:state_pressed="true" android:drawable="@drawable/lightlogo" /> </selector> In my code, an example tab is generated using : host.addTab(host.newTabSpec("three") .setIndicator("map",drawables) .setContent(new Intent(this, Map.class))); Right now drawables is just a reference to an drawable image resource. How do I make the selector a drawable? * This is my question *

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • Dojo DnD: how to access newly copied node on onDndDrop event?

    - by toshinao
    Hi. I am working on code like the following. 01: var c1 = new dojo.dnd.Source('container1', {copyOnly:true}); // container1 is a div 02: var c2 = new dojo.dnd.Source('container2'); // container2 is a div 03: var list = []; 04: for (var i = 0; i < 3; i++) { list.push( dojo.create('div') ); } 05: c1.insertNodes(false, list); 06: 07: function checkDndCopy(nodes, target){ 08: dojo.forEach(nodes, function(node){ alert(node.id); } ); 09: } 10: dojo.subscribe("/dnd/drop", function(){ 11: var mgr = dojo.dnd.manager(); 12: checkDndCopy(mgr.nodes, mgr.target); 13: }); The nodes inserted to the c1 at line 05 have id of "dojoUnique1, donoUnique2, dojoUnique3". On a event of drag and drop a node from c1 to c2, a onDndDrop event is fired and the subscribe method defined in line10-13 is invoked. I expected that newly copied node appears in the nodes (for example) at line 08. But this is not true. When dojoUnique1 is target of drag and drop, nodes at line 08 contains only dojoUnique1. I want to modify some attributes of newly copied nodes on the event of onDndDrop. Please let me know how such a thing is realized.

    Read the article

  • How can I get the Hibernate Configuration object from Spring?

    - by Wayne Russell
    Hi, I am trying to obtain Spring-defined Hibernate Configuration and SessionFactory objects in my non-Spring code. The following is the definition in my applicationContext.xml file: Code: <bean id="sessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="hibernateProperties"> <props> <prop key="hibernate.dialect">org.hibernate.dialect.MySQLDialect</prop> <prop key="hibernate.show_sql">true</prop> <prop key="hibernate.hbm2ddl.auto">update</prop> <prop key="hibernate.cglib.use_reflection_optimizer">true</prop> <prop key="hibernate.cache.provider_class">org.hibernate.cache.HashtableCacheProvider</prop> </props> </property> <property name="dataSource"> <ref bean="dataSource"/> </property> </bean> If I now call getBean("sessionFactory"), I am returned a $Proxy0 object which appears to be a proxy for the Hibernate SessionFactory object. But that isn't what I want - I need the LocalSessionFactoryBean itself because I need access to the Configuration as well as the SessionFactory. The reason I need the Configuration object is that our framework is able to use Hibernate's dynamic model to automatically insert mappings at runtime; this requires that we change the Configuration and rebuild the SessionFactory. Really, all we're trying to do is obtain the Hibernate config that already exists in Spring so that those of our customers that already have that information in Spring don't need to duplicate it into a hibernate.cfg.xml file in order to use our Hibernate features.

    Read the article

  • refactor LINQ TO SQL custom properties that instantiate datacontext

    - by Thiago Silva
    I am working on an existing ASP.NET MVC app that started small and has grown with time to require a good re-architecture and refactoring. One thing that I am struggling with is that we've got partial classes of the L2S entities so we could add some extra properties, but these props create a new data context and query the DB for a subset of data. This would be the equivalent to doing the following in SQL, which is not a very good way to write this query as oppsed to joins: SELECT tbl1.stuff, (SELECT nestedValue FROM tbl2 WHERE tbl2.Foo = tbl1.Bar), tbl1.moreStuff FROM tbl1 so in short here's what we've got in some of our partial entity classes: public partial class Ticket { public StatusUpdate LastStatusUpdate { get { //this static method call returns a new DataContext but needs to be refactored var ctx = OurDataContext.GetContext(); var su = Compiled_Query_GetLastUpdate(ctx, this.TicketId); return su; } } } We've got some functions that create a compiled query, but the issue is that we also have some DataLoadOptions defined in the DataContext, and because we instantiate a new datacontext for getting these nested property, we get an exception "Compiled Queries across DataContexts with different LoadOptions not supported" . The first DataContext is coming from a DataContextFactory that we implemented with the refactorings, but this second one is just hanging off the entity property getter. We're implementing the Repository pattern in the refactoring process, so we must stop doing stuff like the above. Does anyone know of a good way to address this issue?

    Read the article

  • MooTools/JavaScript variable scope

    - by 827
    I am trying to make each number displayed clickable. "1" should alert() 80, "2" should produce 60, etc. However, when the alert(adjust) is called, it only shows 0, not the correct numbers. However, if the commented out alert(adjust) is uncommented, it produces the correct number on page load, but not on clicking. I was wondering why the code inside addEvents cannot access the previously defined variable adjust. <html> <head> <script type="text/javascript" charset="utf-8" src="mootools.js"></script> <script type="text/javascript" charset="utf-8"> window.addEvent('domready', function() { var id_numbers = [1,2,3,4,5]; for(var i = 0; i<id_numbers.length; i++) { var adjust = (20 * (5 - id_numbers[i])); // alert(adjust); $('i_' + id_numbers[i]).addEvents({ 'click': function() { alert(adjust); } }); } }); </script> </head> <body> <div id="i_1">1</div> <div id="i_2">2</div> <div id="i_3">3</div> <div id="i_4">4</div> <div id="i_5">5</div> </body> </html> Thanks.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Why can I run JUnit tests for my Spring project, but not a main method?

    - by FarmBoy
    I am using JDBC to connect to MySQL for a small application. In order to test without altering the real database, I'm using HSQL in memory for JUnit tests. I'm using Spring for DI and DAOs. Here is how I'm configuring my HSQL DataSource <bean id="mockDataSource" class="org.springframework.jdbc.datasource.SingleConnectionDataSource"> <property name="driverClassName" value="org.hsqldb.jdbcDriver"/> <property name="url" value="jdbc:hsqldb:mem:mockSeo"/> <property name="username" value="sa"/> </bean> This works fine for my JUnit tests which use the mock DB. But when I try to run a main method, I find the following error: Error creating bean with name 'mockDataSource' defined in class path resource [beans.xml]: Error setting property values; nested exception is org.springframework.beans.PropertyBatchUpdateException; nested PropertyAccessExceptions (1) are: PropertyAccessException 1: org.springframework.beans.MethodInvocationException: Property 'driverClassName' threw exception; nested exception is java.lang.IllegalStateException: Could not load JDBC driver class [org.hsqldb.jdbcDriver] I'm running from Eclipse, and I'm using the Maven plugin. Is there a reason why this would work as a Test, but not as a main()? I know that the main method itself is not the problem, because it works if I remove all references to the HSQL DataSource from my Spring Configuration file.

    Read the article

  • Alternatives to storing Moose object using Apache::Session with CODE references

    - by Hartmut Behrens
    I have a Moose class that i would like to store using Apache::Session::File. However, Apache::Session::File by default will not store it and instead i get the error message: (in cleanup) Can't store CODE items at blib\lib\Storable.pm (autosplit into blib\lib\auto\Storable\_freeze.al)... This problem can be circumvented by setting $Storable::Deparse = 1; $Storable::Eval = 1; in order to allow CODE references to be serialized. The offending method in the Moose class is listed below, which retrieves a column from a mysql database: sub _build_cell_generic { my ($self,$col) = @_; my $sth = $self->call_dbh('prepare','select '.$col.' from '.$self->TABLE.' where CI = ? and LAC = ? and IMPORTDATE = ?'); $sth->execute($self->CI,$self->LAC,$self->IMPORTDATE); my $val = $sth->fetchrow_array; $sth->finish; return defined $val ? $val : undef; } So presumably the dbh object (isa DBIx::Connector) contains CODE references. Is there a better alternative in order to allow serialization of this Moose class than setting $Storable::Deparse and $Storable::Eval ?

    Read the article

  • JavaScript and JQuery - Encoding HTML

    - by user70192
    Hello, I have a web page that has a textarea defined on it like so: <textarea id="myTextArea" rows="6" cols="75"></textarea> There is a chance that a user may enter single and double quotes in this field. For instance, I have been testing with the following string: Just testin' using single and double "quotes". I'm hoping the end of this task is comin'. Additionally, the user may enter HTML code, which I would prefer to prevent. Regardless, I am passing the contents of this textarea onto web service. I must encode the contents of the textarea in JavaScript before I can send it on. Currently, I'm trying the following: var contents $('<div/>').text($("#myTextArea).val()).html(); alert(contents); I was expecting contents to display Just testin&#39; using single and double &#34;quotes&#34;. I&#39;m hoping the end of this task is comin&#39;. Instead, the original string is printed out. Beyond just double-and-single quotes, there are a variety of entities to consider. Because of this, I was assuming there would be a way to encode HTML before passing it on. Can someone please tell me how to do this? Thank you,

    Read the article

  • Why does Java's invokevirtual need to resolve the called method's compile-time class?

    - by Chris
    Consider this simple Java class: class MyClass { public void bar(MyClass c) { c.foo(); } } I want to discuss what happens on the line c.foo(). At the bytecode level, the meat of c.foo() will be the invokevirtual opcode, and, according to the documentation for invokevirtual, more or less the following will happen: Look up the foo method defined in compile-time class MyClass. (This involves first resolving MyClass.) Do some checks, including: Verify that c is not an initialization method, and verify that calling MyClass.foo wouldn't violate any protected modifiers. Figure out which method to actually call. In particular, look up c's runtime type. If that type has foo(), call that method and return. If not, look up c's runtime type's superclass; if that type has foo, call that method and return. If not, look up c's runtime type's superclass's superclass; if that type has foo, call that method and return. Etc.. If no suitable method can be found, then error. Step #3 alone seems adequate for figuring out which method to call and verifying that said method has the correct argument/return types. So my question is why step #1 gets performed in the first place. Possible answers seem to be: You don't have enough information to perform step #3 until step #1 is complete. (This seems implausible at first glance, so please explain.) The linking or access modifier checks done in #1 and #2 are essential to prevent certain bad things from happening, and those checks must be performed based on the compile-time type, rather than the run-time type hierarchy. (Please explain.)

    Read the article

  • how to fix: ctags null expansion of name pattern "\1"

    - by bua
    Hi, As the title points I have problem with ctags when trying to parse user-defined language. Basically I've followed those instructions. The quickest and easiest way to do this is by defining a new language using the program options. In order to have Swine support available every time I start ctags, I will place the following lines into the file $HOME/.ctags, which is read in every time ctags starts: --langdef=swine --langmap=swine:.swn --regex-swine=/^def[ \t]*([a-zA-Z0-9_]+)/\1/d,definition/ The first line defines the new language, the second maps a file extension to it, and the third defines a regular expression to identify a language definition and generate a tag file entry for it. I've tried different flags: b,e for regex. My definition of tag is: --regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/\l/f,function/b When I replace \1 with anything else (ascii caracter set ), It works. the output is: (--regex-q=/^[ \t]*[^[:space:]]*[:space:]*:[:space:]*{/my function name/f,function/b) !_TAG_FILE_FORMAT 2 /extended format; --format=1 will not append ;" to lines/ !_TAG_FILE_SORTED 1 /0=unsorted, 1=sorted, 2=foldcase/ !_TAG_PROGRAM_AUTHOR Darren Hiebert /[email protected]/ !_TAG_PROGRAM_NAME Exuberant Ctags // !_TAG_PROGRAM_URL http://ctags.sourceforge.net /official site/ !_TAG_PROGRAM_VERSION 5.8 // my function name file.q /^.ras.getLocation:{[u]$/;" f my function name file.q /^.a.getResource:{[u; pass]$/;" f my function name file.q /^.a.init:{$/;" f my function name file.q /^.a.kill:{[u; force]$/;" f my function name file.q /^.asdf.status:{[what; u]$/;" f my function name file.q /^.pc:{$/;" f Why \1 doesn't work? (I've tried all 1-9)

    Read the article

  • Graph limitations - Should I use Decorator?

    - by Nick Wiggill
    I have a functional AdjacencyListGraph class that adheres to a defined interface GraphStructure. In order to layer limitations on this (eg. acyclic, non-null, unique vertex data etc.), I can see two possible routes, each making use of the GraphStructure interface: Create a single class ("ControlledGraph") that has a set of bitflags specifying various possible limitations. Handle all limitations in this class. Update the class if new limitation requirements become apparent. Use the decorator pattern (DI, essentially) to create a separate class implementation for each individual limitation that a client class may wish to use. The benefit here is that we are adhering to the Single Responsibility Principle. I would lean toward the latter, but by Jove!, I hate the decorator Pattern. It is the epitome of clutter, IMO. Truthfully it all depends on how many decorators might be applied in the worst case -- in mine so far, the count is seven (the number of discrete limitations I've recognised at this stage). The other problem with decorator is that I'm going to have to do interface method wrapping in every... single... decorator class. Bah. Which would you go for, if either? Or, if you can suggest some more elegant solution, that would be welcome. EDIT: It occurs to me that using the proposed ControlledGraph class with the strategy pattern may help here... some sort of template method / functors setup, with individual bits applying separate controls in the various graph-canonical interface methods. Or am I losing the plot?

    Read the article

  • richfaces progressBar polling

    - by John
    Hi, I've got a progressBar component defined as the following on my webpage: <rich:modalPanel id="pb1Panel"> <rich:progressBar id="pb1" oncomplete="javascript:#{myBean.handleProgressEvent()} closeProgressModalPanel()" value="#{pb1Listener.percentageComplete}" label="#{pb1Listener.percentageComplete} %" minValue="1" maxValue="100" limitToList="true" timeout="3200" interval="1400" enabled="false"/> </rich:modalPanel> and a button: <a4j:commandButton id="actButton" value="action" action="#{myBean.performAction}" immediate="true" ajaxSingle="true" onclick="javascript:Richfaces.showModalPanel('pb1Panel');" reRender="pb1Panel"> <a4j:support event="onClick" value="#{rich:component('pb1')}.enable()" reRender="pb1" /> </a4j:commandButton> which doesn't work. However if I take out the .... enabled="false"/> .... from the progress bar, and the element from the button, everything seems to work just fine. Any suggestion why it's not working? I'm setting enabled="false" initially because I do not want the polling to start unless the button was clicked (to reduce unnecessary polling). The system is building on richfaces/seam. Thanks!

    Read the article

  • Developmnet process for an embedded project with significant Hardware change

    - by pierr
    Hi, I have a good idea about Agile development process but it seems it does not fit well with a embedded project with significant hardware change. I will describe below what we are currently doing (Ad-hoc way , no defined process yet). The change are divided to three categories and different process are used for them : complete hardware change example : use a different video codec IP a) Study the new IP b) RTL/FPGA simulation c) Implement the leagcy interface - go to b) d) Wait until hardware (tape out) is ready f) Test on the real Hardware hardware improvement example : enhance the image display quaulity by improving the underlie algorithm a)RTL/FPGA simulation b)Wait until hardware and test on the hardware Mino change exmaple : only change hardware register mapping a)Wait until hardware and test on the hardware The worry is it seems we don't have too much control and confidence about software maturity for the hardware change as the bring up schedule is always very tight and the customer desired a seemless change when updating to a new version hardware. How did you manage this kind of hardware hardware change? Did you solve that by a Hardware Abstraction Layer (HAL)? Did you have a automatical test for the HAL layer? How did you test when the hardware platform is not even ready? Do you have well documented process for this kind of change? Thanks for your insight.

    Read the article

< Previous Page | 230 231 232 233 234 235 236 237 238 239 240 241  | Next Page >