Search Results

Search found 23573 results on 943 pages for 'program flow'.

Page 266/943 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

  • SQL Server: Database stuck in "Restoring" state

    - by Ian Boyd
    i backed up a data: BACKUP DATABASE MyDatabase TO DISK = 'MyDatabase.bak' WITH INIT --overwrite existing And then tried to restore it: RESTORE DATABASE MyDatabase FROM DISK = 'MyDatabase.bak' WITH REPLACE --force restore over specified database And now the database is stuck in the restoring state. Some people have theorized that it's because there was no log file in the backup, and it needed to be rolled forward using: RESTORE DATABASE MyDatabase WITH RECOVERY Except that, of course, fails: Msg 4333, Level 16, State 1, Line 1 The database cannot be recovered because the log was not restored. Msg 3013, Level 16, State 1, Line 1 RESTORE DATABASE is terminating abnormally. And exactly what you want in a catastrophic situation is a restore that won't work. The backup contains both a data and log file: RESTORE FILELISTONLY FROM DISK = 'MyDatabase.bak' Logical Name PhysicalName ============= =============== MyDatabase C:\Program Files\Microsoft SQL Server\MSSQL.1\MSSQL\DATA\MyDatabase.mdf MyDatabase_log C:\Program Files\Microsoft SQL Server\MSSQL.1\MSSQL\DATA\MyDatabase_log.LDF

    Read the article

  • Save gcc compile status to a text file for Java

    - by JohnBore
    I'm making a C Assessment Program through Java, which has a bunch of programming questions for C, and it lets the user input an answer in the form of C code, and then press a "Compile" button, which is linked to a bat file that runs the user input code through gcc. I've got the input and compiling working, but I need to get the output from the compiler and get that to print textarea within the program. I can get a simple "Hello, world" compiling, but I'm having trouble getting programs that require a user input with scanf, for example, to be printed. else if(e.getSource().equals(compile)){ if(questionNumber<1){ JOptionPane.showMessageDialog(programFrame, "Please start the assessment", "Compile Error", JOptionPane.ERROR_MESSAGE); } else{ FileOutputStream fileWrite; try { fileWrite = new FileOutputStream("demo/demo.c"); new PrintStream(fileWrite).println(input.getText());//saves what the user has entered in to a C source file fileWrite.close(); @SuppressWarnings("unused") Process process = Runtime.getRuntime().exec("cmd /c compile.bat");//runs the batch file to compile the source file compileCode(); try{ fileStream = new FileInputStream("demo/output.txt"); inputStream = new DataInputStream(fileStream); bufferRead = new BufferedReader(new InputStreamReader(inputStream)); while((stringLine = bufferRead.readLine())!=null){ compiled.append(stringLine); compiled.append("\n"); } inputStream.close(); } catch(IOException exc){ System.err.println("Unable to read file"); System.exit(-1); } } catch (IOException exc) { JOptionPane.showMessageDialog(programFrame, "Demo file not found", "File Error", JOptionPane.ERROR_MESSAGE); } } This is the actionPerformed method for the "Compile" button, the compileCode() is the JFrame that displays the output and "compiled" is the textArea for the output. My batch file is: C: cd dev-cpp\bin gcc.exe H:\workspace\QuestionProgram\demo\demo.c -o demo > H:\workspace\QuestionProgram\demo\compilestatus.txt demo > H:\workspace\QuestionProgram\demo\output.txt I'm not sure how I can do it, so the frame is created for the output of the code if the code requires a user input as the command prompt doesn't open without adding "START" to .exec(), but then the frame appears before the program has finished running. Also, how would I get the output of the compiler if the compile fails because of an error? The way I've got it in my batch file at the moment doesn't put anything in a text file if it fails.

    Read the article

  • Matlab Error: Too many output arguments

    - by lebland_Matlab
    I use the following function in a Matlab program: ... ... ... [A, B, C, D, E] = function (F, G, H, I, J, K, L, M, N, O, P) ... ... ... and I get the following error message: ??? Error using == function Too many output arguments. A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P are the vectors of inputs and outputs of the function. but the same program works very well when I replaced the line of the function by its full script! Can you tell me where I should look to find the error..

    Read the article

  • How do I convert decimal numbers to binary in Perl?

    - by David
    I am trying to make a program that converts decimal numbers or text into binary numbers in perl. The program asks for user input of a character or string , and then prints out the result to the console. How do I do this? My code I have been working on is below, but i cannot seem to fix it. print "Enter a number to convert: "; chomp($decimal = <STDIN>); print "\nConverting $number to binary...\n"; $remainder = $decimal%2; while($decimal > 0) { $decimal/2; print $remainder; }

    Read the article

  • Where is PostSharp.Public 1.5 DLL ?

    - by jfneis
    Fellows, I'm going crazy with looks like a really stupid problem. I'm trying to build a simple example using PostSharp as a log AOP utility. I've not installed PostSharp, and I don't want to, I want to reference the necessaries DLLs, change my .csproj and see everything working. Change the project and add references was kind of easy, byt just after adding the LogAttribute to a method I got two errors: Error 1 'Log4PostSharp.LogAttribute' is not an attribute class C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 17 10 LogWithPostsharpCmd Error 2 The type 'PostSharp.Extensibility.MulticastAttribute' is defined in an assembly that is not referenced. You must add a reference to assembly 'PostSharp.Public, Version=1.5.0.0, Culture=neutral, PublicKeyToken=b13fd38b8f9c99d7'. C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 18 22 LogWithPostsharpCmd The first error really looks like consequence of the second, but here is the deal: the PostSharp.Public.* simply doesn't exist in the downloaded .zip. Is there something that I'm not getting? Thank you in advance. Filipe

    Read the article

  • Port scientific software to GPU and publish it

    - by Werner
    Hi, let's say that I am a physicist and that I am the master of the universe when it comes to port salready existing oftware to GPU's with 100x or more speedups. Let's say that I find that some other scientist, which does not know how to program GPU, publishes the Open Source code in his/her website of a physical simulation program, in the field I am expert on. Let's say that I realize "I can port that code to GPU", and I suggest him, but he shows no interest. My interest here is, 1) to port it to GPU, 2) to publish this result in a scientific journal related with physics and/or computer science My question for you is 1- would you proceed here to port the code to GPU (or other new arch) and publish it? 2- how would you do it and which journal do you suggest? Thanks

    Read the article

  • Couchdb conflict resolution

    - by Sundar
    How does CouchDB handles conflicts while doing bi-directional replication? For example: Lets say there are two address book databases (in server A and B). There is a document for Jack which contains contact details of Jack. Server A and B are replicated and both have the same version of Jack document. In server A, Jack's mobile no is updated. In server B, Jack's address is updated. Now when we do bi-directional replication there is a conflict. How does couchDB handles it? If we initiate replication in a Java program, is there a way to know whether there were any conflicts from the java program?

    Read the article

  • Linking with Boost error

    - by drhorrible
    I just downloaded and ran the boost installer for version 1.42 (from boostpro.com), and set up my project according to the getting started guide. However, when I build the program, I get this linker error: LINK : fatal error LNK1104: cannot open file 'libboost_program_options-vc90-mt-gd-1_42.lib' The build log adds this (I've replaced project-specific paths with *'s): Creating temporary file "******\Debug\RSP00001252363252.rsp" with contents [ /OUT:"*********.exe" /INCREMENTAL /LIBPATH:"C:\Program Files\boost\boost_1_42_0\lib" /MANIFEST /MANIFESTFILE:"Debug\hw6.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"********\Debug\***.pdb" /SUBSYSTEM:CONSOLE /DYNAMICBASE /NXCOMPAT /MACHINE:X86 kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib uuid.lib odbc32.lib odbccp32.lib ".\Debug\****.obj" ".\Debug\****.exe.embed.manifest.res" ] Creating command line "link.exe @********\Debug\RSP00001252363252.rsp /NOLOGO /ERRORREPORT:PROMPT" I've also emailed [email protected] (with a message very similar to this), but I thought maybe so would be faster.

    Read the article

  • OnExit is not entering via PostSharp in asp.net project.

    - by mark smith
    Hi there, I have setup PostSharp and it appears to be working but i don't get it entering OnExit (i have logged setup to ensure it is working) ... Its a bit tricky to configure with asp.net - or is it just me ... I am using the 1.5 new version I basically have the following in my web.config and i had to add the SearchPath otherwise it can't find my assemblies <postsharp directory="C:\Program Files\PostSharp 1.5" trace="true"> <parameters> <!--<add name="parameter-name" value="parameter-value"/>--> </parameters> <searchPath> <!-- Always add the binary folder to the search path. --> <add name="bin" value="~\bin"/> </searchPath> </postsharp> I have set tracing on but what is strange to me is that it appears to build to the temp directory, maybe this is my issue, i am unsure .. hence i do F5 ... Is it possible to name the Output directory and output file?? As you can see it is editing a DLL in the temp dir so IIS is no longer in control so it doesn't execute it ??? Confused! :-) C:\Program Files\PostSharp 1.5\postsharp.exe "/P:Output=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" "/P:IntermediateDirectory=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp " /P:CleanIntermediate=False /P:ReferenceDirectory=. /P:SignAssembly=False /P:PrivateKeyLocation= /P:ResolvedReferences= "/P:SearchPath=C:\Source Code\Visual Studio 2008\Projects\mysitemvc\mysitemvc\bin," /V /SkipAutoUpdate "C:\Program Files\PostSharp 1.5\Default.psproj" "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\before-postsharp\App_Web_04ae3ewy.dll" PostSharp 1.5 [1.5.6.627] - Copyright (c) Gael Fraiteur, 2005-2009. info PS0035: C:\Windows\Microsoft.NET\Framework\v2.0.50727\ilasm.exe "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.il" /QUIET /DLL /PDB "/RESOURCE=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.res" "/OUTPUT=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" /SUBSYSTEM=3 /FLAGS=1 /BASE=18481152 /STACK=1048576 /ALIGNMENT=512 /MDV=v2.0.50727

    Read the article

  • How can I flush the output of disp in Octave?

    - by Nathan Fellman
    I have a program in Octave that has a loop - running a function with various parameters, not something that I can turn into matrices. At the beginning of each iteration I print the current parameters using disp. The first times I ran it I had a brazillion warnings, and then I also got these prints. Now that I cleaned them up, I no longer see them. My guess is that they're stuck in a buffer, and I'll see them when the program ends or the buffer fills. Is there any way to force a flush of the print buffer so that I can see my prints?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Build an Organization Chart In Visio 2010

    - by Mysticgeek
    With trying to manage a business these days, it’s very important to have an Organization Chart to keep everything manageable. Here we’ll show you how to build one in Visio 2010. This Guest Article was written by our friends over at Office 2010 Club. Need for Organization Charts The need of creating Organization Charts are becoming indispensable these days, as companies start focusing on extensive hiring for far reach availability, increase in productivity and targeting diverse markets. Considering this rigorous change, creating an organization chart can help stakeholders in comprehending the ever growing organization structure & hierarchy with an ease. It shows the basic structure of organization along with defining the relationships between employees working in different departments. Opportunely, Microsoft Visio 2010 offers an easy way to create Organization chart. As before now, orthodox ways of listing organization hierarchy have been used for defining the structure of departments along with communication possible including; horizontal and vertical communications. To transform these lists which defines organizational structure, into a detailed chart, Visio 2010 includes an add-in for importing Excel spreadsheet, which comes in handy for pulling out data from spreadsheet to create an organization chart. Importantly, you don’t need to indulge yourself in maze of defining organizational hierarchies and chalking-out structure, as you just need to specify the column & row headers, along with data you need to import and it will automatically create out chart defining; organizational hierarchies with specified credentials of each employee, categorized in their corresponding departments. Creating Organization Charts in Visio 2010 To start off with, we have created an Excel spreadsheet having fields, Name, Supervisor, Designation, Department and Phone. The Name field contains name of all the employees working in different departments, whereas Supervisor field contains name of supervisors or team leads. This field is vital for creating Organization Chart, as it defines the basic structure & hierarchy in chart. Now launch Visio 2010, head over to View tab, under Add-Ons menu, from Business options, click Organization Chart Wizard. This will start Organization Chart Wizard, in the first step, enable Information that’s already stored in a file or database option, and click Next. As we are importing Excel sheet, select the second option for importing Excel spreadsheet. Specify the Excel file path and click Next to continue. In this step, you need to specify the fields which actually defines the structure of an organization. In our case, these are Name & Supervisor fields. After specifying fields, click Next to Proceed further. As organization chart is primarily for showing the hierarchy of departments/employees working in organization along with how they are linked together, and who supervises whom. Considering this, in this step we will leave out Supervisor field, because it’s inclusion wouldn’t be necessary as Visio automatically chalks-out the basic structure defined in Excel sheet. Add the rest of the fields under Displayed fields category, and click Next. Now choose the fields which you want to include in Organization Chart’s shapes and click Next. This step is about breaking the chart into multiple pages, if you are dealing with 100+ employees, you may want to specify numbers of pages on which Organization Chart will be displayed. But in our case, we are dealing with much less amount of data, so we will enable I want the wizard to automatically break my organization chart across pages option. Specify the name you need to show on the top of the page. If you are having less than 20 hierarchies, enter the name of the highest ranked employee in organization and click Finish to end the wizard. It will instantly create an Organization chart out of specified Excel spreadsheet. Highest ranked employee will be shown on top of the organization chart, supervising various employees from different departments. As shown below, his immediate subordinates further manages other employees and so on. For advance customizations, head over to Org Chart tab, here you will find different groups for setting up the Org Chart’s hierarchy and manage other employees’ positions. Under Arrange group, shapes’ arrangements can be changed and it provides easy navigation through the chart. You can also change the type of the position and hide subordinates of selected employee. From Picture group, you can insert a picture of the employees, departments, etc. From synchronization group, you have the option of creating a synced copy and expanding subordinates of selected employee. Under Organization Data group, you can change whole layout of Organization chart from Display Options including; shape display, show divider, enable/disable imported fields, change block position, and fill colors, etc. If at any point of time, you need to insert new position or announce vacancy, Organization Chart stencil is always available on the left sidebar. Drag the desired Organization Chart shape into main diagram page, to maintain the structure integrity, i.e, for inserting subordinates for a specific employee, drag the position shape over the existing employee shape box. For instance, We have added a consultant in organization, who is directly under CEO, for maintaining this, we have dragged the Consultant box and just dropped it over the CEO box to make the immediate subordinate position. Adding details to new position is a cinch, just right-click new position box and click Properties. This will open up Shape Data dialog, start filling in all the relevant information and click OK. Here you can see the newly created position is easily populated with all the specified information. Now expanding an Organization Chart doesn’t require maintenance of long lists any more. Under Design tab, you can also try out different designs & layouts over organization chart to make it look more flamboyant and professional.  Conclusion An Organization Chart is a great way of showing detailed organizational hierarchies; with defined credentials of employees, departments structure, new vacancies, newly hired employees, recently added departments, and importantly shows most convenient way of interaction between different departments & employees, etc. Similar Articles Productive Geek Tips Geek Reviews: Using Dia as a Free Replacement for Microsoft VisioMysticgeek Blog: Create Appealing Charts In Excel 2007Create Charts in Excel 2007 the Easy Way with Chart AdvisorCreate a Hyperlink in a Word 2007 Flow Chart and Hide Annoying ScreenTipsCreate A Flow Chart In Word 2007 TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips HippoRemote Pro 2.2 Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Know if Someone Accessed Your Facebook Account Shop for Music with Windows Media Player 12 Access Free Documentaries at BBC Documentaries Rent Cameras In Bulk At CameraRenter Download Songs From MySpace Steve Jobs’ iPhone 4 Keynote Video

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >