Search Results

Search found 14486 results on 580 pages for 'python idle'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 371/580 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • Twisted - how to create multi protocol process and send the data between the protocols

    - by SpankMe
    Hey, Im trying to write a program that would be listening for data (simple text messages) on some port (say tcp 6666) and then pass them to one or more different protocols - irc, xmpp and so on. I've tried many approaches and digged the Internet, but I cant find easy and working solution for such task. The code I am currently fighting with is here: http://pastebin.com/ri7caXih I would like to know how to from object like: ircf = ircFactory('asdfasdf', '#asdf666') get access to self protocol methods, because this: self.protocol.dupa1(msg) returns error about self not being passed to active protocol object. Or maybe there is other, better, easier and more kosher way to create single reactor with multiple protocols and have actions triggeres when a message arrives on any of them, and then pass that message to other protocols for handling/processing/sending? Any help will be highly appreciated!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Is using os.path.abspath to validate an untrusted filename's location secure?

    - by mcmt
    I don't think I'm missing anything. Then again I'm kind of a newbie. def GET(self, filename): name = urllib.unquote(filename) full = path.abspath(path.join(STATIC_PATH, filename)) #Make sure request is not tricksy and tries to get out of #the directory, e.g. filename = "../.ssh/id_rsa". GET OUTTA HERE assert full[:len(STATIC_PATH)] == STATIC_PATH, "bad path" return open(full).read() Edit: I realize this will return the wrong HTTP error code if the file doesn't exist (at least under web.py). I will fix this.

    Read the article

  • How do I use Django to insert a Geometry Field into the database?

    - by alex
    class LocationLog(models.Model): user = models.ForeignKey(User) utm = models.GeometryField(spatial_index=True) This is my database model. I would like to insert a row. I want to insert a circle at point -55, 333. With a radius of 10. How can I put this circle into the geometry field? Of course, then I would want to check which circles overlap a given circle. (my select statement)

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • How to replace a Widget with another using Qt ?

    - by Natim
    Hi, I have an QHBoxLayout with a QTreeWidget on the left, a separator on the middle and a widget on the right. When I click on the QTreeWidget, I want to change the widget on the right to modify the QTreeWidgetItem I tried to do this with this code : def new_rendez_vous(self): self.ui.horizontalLayout_4.removeWidget(self.ui.editionFormWidget) del self.ui.editionFormWidget self.ui.editionFormWidget = RendezVousManagerDialog(self.parent) self.ui.editionFormWidget.show() self.ui.horizontalLayout_4.addWidget(self.ui.editionFormWidget) self.connect(self.ui.editionFormWidget, QtCore.SIGNAL('saved'), self.scheduleTreeWidget.updateData) def edit(self, category, rendez_vous): self.ui.horizontalLayout_4.removeWidget(self.ui.editionFormWidget) del self.ui.editionFormWidget self.ui.editionFormWidget = RendezVousManagerDialog(self.parent, category, rendez_vous) self.ui.editionFormWidget.show() self.ui.horizontalLayout_4.addWidget(self.ui.editionFormWidget) self.connect(self.ui.editionFormWidget, QtCore.SIGNAL('saved'), self.scheduleTreeWidget.updateData) def edit_category(self, category): self.ui.horizontalLayout_4.removeWidget(self.ui.editionFormWidget) del self.ui.editionFormWidget self.ui.editionFormWidget = CategoryManagerDialog(self.parent, category) self.ui.editionFormWidget.show() self.ui.horizontalLayout_4.addWidget(self.ui.editionFormWidget) self.connect(self.ui.editionFormWidget, QtCore.SIGNAL('saved'), self.scheduleTreeWidget.updateData) But it doesn't work and all the widgets are stacked up on each other : . Do you know how I can remove the old widget and next display the new one ?

    Read the article

  • verbose_name for a model's method

    - by mawimawi
    How can I set a verbose_name for a model's method, so that it might be displayed in the admin's change_view form? example: class Article(models.Model): title = models.CharField(max_length=64) created_date = models.DateTimeField(....) def created_weekday(self): return self.created_date.strftime("%A") in admin.py: class ArticleAdmin(admin.ModelAdmin): readonly_fields = ('created_weekday',) fields = ('title', 'created_weekday') Now the label for created_weekday is "Created Weekday", but I'd like it to have a different label which should be i18nable using ugettext_lazy as well. I've tried created_weekday.verbose_name=... after the method, but that did not show any result. Is there a decorator or something I can use, so I could make my own "verbose_name" / "label" / whateverthename is?

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • SelfReferenceProperty vs. ListProperty Google App Engine

    - by John
    Hi All, I am experimenting with the Google App Engine and have a question. For the sake of simplicity, let's say my app is modeling a computer network (a fairly large corporate network with 10,000 nodes). I am trying to model my Node class as follows: class Node(db.Model): name = db.StringProperty() neighbors = db.SelfReferenceProperty() Let's suppose, for a minute, that I cannot use a ListProperty(). Based on my experiments to date, I can assign only a single entity to 'neighbors' - and I cannot use the "virtual" collection (node_set) to access the list of Node neighbors. So... my questions are: Does SelfReferenceProperty limit you to a single entity that you can reference? If I instead use a ListProperty, I believe I am limited to 5,000 keys, which I need to exceed. Thoughts? Thanks, John

    Read the article

  • Condition checking vs. Exception handling

    - by Aidas Bendoraitis
    When is exception handling more preferable than condition checking? There are many situations where I can choose using one or the other. For example, this is a summing function which uses a custom exception: # module mylibrary class WrongSummand(Exception): pass def sum_(a, b): """ returns the sum of two summands of the same type """ if type(a) != type(b): raise WrongSummand("given arguments are not of the same type") return a + b # module application using mylibrary from mylibrary import sum_, WrongSummand try: print sum_("A", 5) except WrongSummand: print "wrong arguments" And this is the same function, which avoids using exceptions # module mylibrary def sum_(a, b): """ returns the sum of two summands if they are both of the same type """ if type(a) == type(b): return a + b # module application using mylibrary from mylibrary import sum_ c = sum_("A", 5) if c is not None: print c else: print "wrong arguments" I think that using conditions is always more readable and manageable. Or am I wrong? What are the proper cases for defining APIs which raise exceptions and why?

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >