Search Results

Search found 14486 results on 580 pages for 'python idle'.

Page 373/580 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • Url open encoding

    - by badc0re
    I have the following code for urllib and BeautifulSoup: getSite = urllib.urlopen(pageName) # open current site getSitesoup = BeautifulSoup(getSite.read()) # reading the site content print getSitesoup.originalEncoding for value in getSitesoup.find_all('link'): # extract all <a> tags defLinks.append(value.get('href')) The result of it: /usr/lib/python2.6/site-packages/bs4/dammit.py:231: UnicodeWarning: Some characters could not be decoded, and were replaced with REPLACEMENT CHARACTER. "Some characters could not be decoded, and were " And when i try to read the site i get: ?7?e????0*"I??G?H????F??????9-??????;??E?YÞBs????????????4i???)?????^W?????`w?Ke??%??*9?.'OQB???V??@?????]???(P??^??q?$?S5???tT*?Z

    Read the article

  • Raising events and object persistence in Django

    - by Mridang Agarwalla
    Hi, I have a tricky Django problem which didn't occur to me when I was developing it. My Django application allows a user to sign up and store his login credentials for a sites. The Django application basically allows the user to search this other site (by scraping content off it) and returns the result to the user. For each query, it does a couple of queries of the other site. This seemed to work fine but sometimes, the other site slaps me with a CAPTCHA. I've written the code to get the CAPTCHA image and I need to return this to the user so he can type it in but I don't know how. My search request (the query, the username and the password) in my Django application gets passed to a view which in turn calls the backend that does the scraping/search. When a CAPTCHA is detected, I'd like to raise a client side event or something on those lines and display the CAPTCHA to the user and wait for the user's input so that I can resume my search. I would somehow need to persist my backend object between calls. I've tried pickling it but it doesn't work because I get the Can't pickle 'lock' object error. I don't know to implement this though. Any help/ideas? Thanks a ton.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Refactoring code/consolidating functions (e.g. nested for-loop order)

    - by bmay2
    Just a little background: I'm making a program where a user inputs a skeleton text, two numbers (lower and upper limit), and a list of words. The outputs are a series of modifications on the skeleton text. Sample inputs: text = "Player # likes @." (replace # with inputted integers and @ with words in list) lower = 1 upper = 3 list = "apples, bananas, oranges" The user can choose to iterate over numbers first: Player 1 likes apples. Player 2 likes apples. Player 3 likes apples. Or words first: Player 1 likes apples. Player 1 likes bananas. Player 1 likes oranges. I chose to split these two methods of outputs by creating a different type of dictionary based on either number keys (integers inputted by the user) or word keys (from words in the inputted list) and then later iterating over the values in the dictionary. Here are the two types of dictionary creation: def numkey(dict): # {1: ['Player 1 likes apples', 'Player 1 likes...' ] } text, lower, upper, list = input_sort(dict) d = {} for num in range(lower,upper+1): l = [] for i in list: l.append(text.replace('#', str(num)).replace('@', i)) d[num] = l return d def wordkey(dict): # {'apples': ['Player 1 likes apples', 'Player 2 likes apples'..] } text, lower, upper, list = input_sort(dict) d = {} for i in list: l = [] for num in range(lower,upper+1): l.append(text.replace('#', str(num)).replace('@', i)) d[i] = l return d It's fine that I have two separate functions for creating different types of dictionaries but I see a lot of repetition between the two. Is there any way I could make one dictionary function and pass in different values to it that would change the order of the nested for loops to create the specific {key : value} pairs I'm looking for? I'm not sure how this would be done. Is there anything related to functional programming or other paradigms that might help with this? The question is a little abstract and more stylistic/design-oriented than anything.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • Tkinter Gui to read in csv file and generate buttons based on the entries in the first row

    - by Thomas Jensen
    I need to write a gui in Tkinter that can choose a csv file, read it in and generate a sequence of buttons based on the names in the first row of the csv file (later the data in the csv file should be used to run a number of simulations). So far I have managed to write a Tkinter gui that will read the csv file, but I am stomped as to how I should proceed: from Tkinter import * import tkFileDialog import csv class Application(Frame): def __init__(self, master = None): Frame.__init__(self,master) self.grid() self.createWidgets() def createWidgets(self): top = self.winfo_toplevel() self.menuBar = Menu(top) top["menu"] = self.menuBar self.subMenu = Menu(self.menuBar) self.menuBar.add_cascade(label = "File", menu = self.subMenu) self.subMenu.add_command( label = "Read Data",command = self.readCSV) def readCSV(self): self.filename = tkFileDialog.askopenfilename() f = open(self.filename,"rb") read = csv.reader(f, delimiter = ",") app = Application() app.master.title("test") app.mainloop() Any help is greatly appreciated!

    Read the article

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >