Search Results

Search found 19664 results on 787 pages for 'python for ever'.

Page 383/787 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • How to override inner class methods if the inner class is defined as a property of the top class

    - by Maddy
    I have a code snippet like this class A(object): class b: def print_hello(self): print "Hello world" b = property(b) And I want to override the inner class b (please dont worry about the lowercase name) behaviour. Say, I want to add a new method or I want to change an existing method, like: class C(A): class b(A.b): def print_hello(self): print "Inner Class: Hello world" b = property(b) Now if I create C's object as c = C(), and call c.b I get TypeError: 'property' object is not callable error. How would I get pass this and call print_hello of the extended inner class? Disclaimer: I dont want to change the code for A class.

    Read the article

  • Can pydoc/help hide the documentation for inherited class methods and attributes?

    - by EOL
    When declaring a class that inherits from a specific class: class C(dict): added_attribute = 0 the documentation for C lists all the methods of dict (either through help(C) or pydoc). Is there a way to hide the inherited methods from the automatically generated documentation (the documentation string can refer to the base class, for non-overwritten methods)? This would be useful: pydoc lists the functions defined in a module after its classes. Thus, when the classes have a very long documentation, a lot of less than useful information is printed before the new functions provided by the module are presented, which makes the documentation harder to exploit (you have to skip all the documentation for the inherited methods until you reach something specific to the module being documented).

    Read the article

  • Trying and expand the contrib.auth.user model and add a "relatipnships" manage

    - by dotty
    I have the following model setup. from django.db import models from django.contrib.auth.models import User class SomeManager(models.Manager): def friends(self): # return friends bla bla bla class Relationship(models.Model): """(Relationship description)""" from_user = models.ForeignKey(User, related_name='from_user') to_user = models.ForeignKey(User, related_name='to_user') has_requested_friendship = models.BooleanField(default=True) is_friend = models.BooleanField(default=False) objects = SomeManager() relationships = models.ManyToManyField(User, through=Relationship, symmetrical=False) relationships.contribute_to_class(User, 'relationships') Here i take the User object and use contribute_to_class to add 'relationships' to the User object. The relationship show up, but if call User.relationships.friends it should run the friends() method, but its failing. Any ideas how i would do this? Thanks

    Read the article

  • Simple numpy question

    - by dassouki
    I can't get this snippet to work: #base code A = array([ [ 1, 2, 10 ], [ 1, 3, 20 ], [ 1, 4, 30 ], [ 2, 1, 15 ], [ 2, 3, 25 ], [ 2, 4, 35 ], [ 3, 1, 17 ], [ 3, 2, 27 ], [ 3, 4, 37 ], [ 4, 1, 13 ], [ 4, 2, 23 ], [ 4, 3, 33 ] ]) # Number of zones zones = unique1d(A[:,0]) for origin in zones: for destination in zones: if origin != destination: A_ik = A[(A[:,0] == origin & A[:,1] == destination), 2]

    Read the article

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • errors with gae-sessions and nose

    - by Kekito
    I'm running into a few problems with adding gae-sessions to a relatively mature GAE app. I followed the readme carefully and also looked at the demo. First, just adding the gaesesions directory to my app causes the following error when running tests with nose and nose-gae: Exception ImportError: 'No module named threading' in <bound method local.__del__ of <_threading_local.local object at 0x103e10628>> ignored All the tests run fine so not a big problem but suggests that something isn't right. Next, if I add the following two lines of code: from gaesessions import get_current_session session = get_current_session() I get the following error: Traceback (most recent call last): File "/Users/.../unit_tests.py", line 1421, in testParseFBRequest data = tasks.parse_fb_request(sr) File "/Users/.../tasks.py", line 220, in parse_fb_request session = get_current_session() File "/Users/.../gaesessions/__init__.py", line 36, in get_current_session return _tls.current_session File "/Library/.../python2.7/_threading_local.py", line 193, in __getattribute__ return object.__getattribute__(self, name) AttributeError: 'local' object has no attribute 'current_session' Any suggestions on fixing the above would be greatly appreciated.

    Read the article

  • Sort a list of dicts by dict values

    - by ensnare
    I have a list of dictionaries: [{'title':'New York Times', 'title_url':'New_York_Times','id':4}, {'title':'USA Today','title_url':'USA_Today','id':6}, {'title':'Apple News','title_url':'Apple_News','id':2}] I'd like to sort it by the title, so elements with A go before Z: [{'title':'Apple News','title_url':'Apple_News','id':2}, {'title':'New York Times', 'title_url':'New_York_Times','id':4}, {'title':'USA Today','title_url':'USA_Today','id':6}] What's the best way to do this? Also, is there a way to ensure the order of each dictionary key stays constant, e.g., always title, title_url, then id? Thank you.

    Read the article

  • django link format words joined with hypens

    - by soField
    href="http://www.torontolife.com/daily/daily-dish/restauranto/2010/03/10/best-new-restaurants-2010-james-chatto-names-five-honourable-mentions/"Best new restaurants 2010: honourable mentions is django has built in mechanism to format links above i mean words joined with hypens how can achieve this ?

    Read the article

  • My QFileSystemModel doesn't work as expected in PyQt

    - by Skilldrick
    I'm learning the Qt Model/View architecture at the moment, and I've found something that doesn't work as I'd expect it to. I've got the following code (adapted from Qt Model Classes): from PyQt4 import QtCore, QtGui model = QtGui.QFileSystemModel() parentIndex = model.index(QtCore.QDir.currentPath()) print model.isDir(parentIndex) #prints True print model.data(parentIndex).toString() #prints name of current directory childIndex = model.index(0, 0, parentIndex) print model.data(childIndex).toString() rows = model.rowCount(parentIndex) print rows #prints 0 (even though the current directory has directory and file children) The question: Is this a problem with PyQt, have I just done something wrong, or am I completely misunderstanding QFileSystemModel? According to the documentation, model.rowCount(parentIndex) should return the number of children in the current directory. The QFileSystemModel docs say that it needs an instance of a Gui application, so I've also placed the above code in a QWidget as follows, but with the same result: import sys from PyQt4 import QtCore, QtGui class Widget(QtGui.QWidget): def __init__(self, parent=None): QtGui.QWidget.__init__(self, parent) model = QtGui.QFileSystemModel() parentIndex = model.index(QtCore.QDir.currentPath()) print model.isDir(parentIndex) print model.data(parentIndex).toString() childIndex = model.index(0, 0, parentIndex) print model.data(childIndex).toString() rows = model.rowCount(parentIndex) print rows def main(): app = QtGui.QApplication(sys.argv) widget = Widget() widget.show() sys.exit(app.exec_()) if __name__ == '__main__': main()

    Read the article

  • How can I merge two lists and sort them working in 'linear' time?

    - by Sergio Tapia
    I have this, and it works: # E. Given two lists sorted in increasing order, create and return a merged # list of all the elements in sorted order. You may modify the passed in lists. # Ideally, the solution should work in "linear" time, making a single # pass of both lists. def linear_merge(list1, list2): finalList = [] for item in list1: finalList.append(item) for item in list2: finalList.append(item) finalList.sort() return finalList # +++your code here+++ return But, I'd really like to learn this stuff well. :) What does 'linear' time mean?

    Read the article

  • How do I create a Status Icon / System Tray Icon with custom text and transparent background using P

    - by Raugturi
    Here is the code that I have so far to define the icon: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, w, h) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 0, 0, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) This works to get the png into the icon, but falls short in two areas. First, transparency is not working. If I use a 22x22 png with transparent background and the image centered, I end up with sections of other active icons showing up inside of mine, like this: http://i237.photobucket.com/albums/ff311/Raugturi/22x22_image_with_transparency.png The icon it choose to steal from is somewhat random. Sometimes it's part of the dropbox icon, others the NetworkManager Applet. If I instead use this code: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, 22, 22) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 3, 6, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) And an image that is only 16x11 with the transparent edges removed, what I end up with is this: Same URL but file is 16x11_image_positioned_in_middle.png So how do I end up with a transparent block like the 1st one that doesn't pull in stuff from other icons? As for the second problem, I need the ability to write on the image before converting it to the icon. I tried using draw_glyphs and it told me I should be using Pango layout/context instead. Unfortunately all the Pango tutorials I could find deal with actual windows, not the status icon. Is there a good tutorial out there for Pango that would apply to this issue (and also maybe have at least some explanation of how to tell it what font to use as all of them that I found seem to lack this and it won't write anything without it). Note: Sorry for the lack of actual images and only one working link, apparently this is a spam prevention feature due to my lack of reputation.

    Read the article

  • List all form related errors in django

    - by Mridang Agarwalla
    Hi, Is there a direct way of listing out 'all' form errors in Django templates. I'd like to list out both field and non-field errors and any other form errors. I've found out how to do this on a per-field basis but as said earlier, I'd like to list out everything. The method I'm using doesn't seem to list out everything. {% for error in form.errors %} {{ error|escape }} {% endfor %} Thanks.

    Read the article

  • Histogram in Matplotlib with input file

    - by Arkapravo
    I wish to make a Histogram in Matplotlib from an input file containing the raw data (.txt). I am facing issues in referring to the input file. I guess it should be a rather small program. Any Matplotlib gurus, any help ? I am not asking for the code, some inputs should put me on the right way !

    Read the article

  • Good looking programs that are built using wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • How to retrieve view of MultiIndex DataFrame

    - by Henry S. Harrison
    This question was inspired by this question. I had the same problem, updating a MultiIndex DataFrame by selection. The drop_level=False solution in Pandas 0.13 will allow me to achieve the same result, but I am still wondering why I cannot get a view from the MultiIndex DataFrame. In other words, why does this not work?: >>> sat = d.xs('sat', level='day', copy=False) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "C:\Python27\lib\site-packages\pandas\core\frame.py", line 2248, in xs raise ValueError('Cannot retrieve view (copy=False)') ValueError: Cannot retrieve view (copy=False) Of course it could be only because it is not implemented, but is there a reason? Is it somehow ambiguous or impossible to implement? Returning a view is more intuitive to me than returning a copy then later updating the original. I looked through the source and it seems this situation is checked explicitly to raise an error. Alternatively, is it possible to get the same sort of view from any of the other indexing methods? I've experimented but have not been successful. [edit] Some potential implementations are discussed here. I guess with the last question above I'm wondering what the current best solution is to index into arbitrary multiindex slices and cross-sections.

    Read the article

  • add a decorate function to a class

    - by wiso
    I have a decorated function (simplified version): class Memoize: def __init__(self, function): self.function = function self.memoized = {} def __call__(self, *args, **kwds): hash = args try: return self.memoized[hash] except KeyError: self.memoized[hash] = self.function(*args) return self.memoized[hash] @Memoize def _DrawPlot(self, options): do something... now I want to add this method to a pre-esisting class. ROOT.TChain.DrawPlot = _DrawPlot when I call this method: chain = TChain() chain.DrawPlot(opts) I got: self.memoized[hash] = self.function(*args) TypeError: _DrawPlot() takes exactly 2 arguments (1 given) why doesn't it propagate self?

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • class inheretence of a attribute which is itself a class

    - by alex
    i have a class which inherets a attribute from a super-class. this attribute is a class itself. class classA(superClass): def func(self,x): if self.attributeB is None: do somthing and in the other class i have class superClass: self.attributB = classB() i get the error AttributeError: class classA has no attribute 'attributeB' when i access the attribute like i showed but if on command line i can see it works, x = classA() x.attributeB is None True so the test works. whats going on in the above code?

    Read the article

  • How to catch YouTube embed code and turn into URL

    - by Jonathan Vanasco
    I need to strip YouTube embed codes down to their URL only. This is the exact opposite of all but one question on StackOverflow. Most people want to turn the URL into an embed code. This question addresses the usage patttern I want, but is tied to a specific embed code's regex ( Strip YouTube Embed Code Down to URL Only ) I'm not familiar with how YouTube has offered embeds over the years - or how the sizes differ. According to their current site, there are 2 possible embed templates and a variety of options. If that's it, I can handle a regex myself -- but I was hoping someone had more knowledge they could share, so I could write a proper regex pattern that matches them all and not run into endless edge-cases. The full use case scenario : user enters content in web based wysiwig editor backend cleans out youtube & other embed codes; reformats approved embeds into an internal format as the text is all converted to markdown. on display, appropriate current template/code display for youtube or other 3rd party site is generated At a previous company, our tech-team devised a plan where YouTube videos were embedded by listing the URL only. That worked great , but it was in a CMS where everyone was trained. I'm trying to create a similar storage, but for user-generated-content.

    Read the article

  • differences between "d.clear()" and "d={}"

    - by Tshepang
    On my machine, the execution speed between "d.clear()" and "d={}" is over 100ns so am curious why one would use one over the other. import timeit def timing(): d = dict() if __name__=='__main__': t = timeit.Timer('timing()', 'from __main__ import timing') print t.repeat()

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Validation on ManyToManyField before Save in Models.py

    - by Heyl1
    I have the following models: class Application(models.Model): users = models.ManyToManyField(User, through='Permission') folder = models.ForeignKey(Folder) class Folder(models.Model): company = models.ManyToManyField(Compnay) class UserProfile(models.Model): user = models.OneToOneField(User, related_name='profile') company = models.ManyToManyField(Company) What I would like to do is to check whether one of the users of the Application has the same company as the Application (via Folder). If this is the case the Application instance should not be saved. The problem is that the ManyToManyFields aren't updated until after the 'post-save' signal. The only option seems to be the new m2m_changed signal. But I'm not sure how I then roll back the save that has already happened. Another option would be to rewrite the save function (in models.py, because I'm talking about the admin here), but I'm not sure how I could access the manytomanyfield content. Finally I've read something about rewriting the save function in the admin of the model in admin.py, however I still wouldn't know how you would access the manytomanyfield content. I have been searching for this everywhere but nothing I come across seems to work for me. If anything is unclear, please tell me. Thanks for your help! Heleen

    Read the article

  • Can anyone tell me why these lines are not working?

    - by user343934
    I am trying to generate tree with fasta file input and Alignment with MuscleCommandline import sys,os, subprocess from Bio import AlignIO from Bio.Align.Applications import MuscleCommandline cline = MuscleCommandline(input="c:\Python26\opuntia.fasta") child= subprocess.Popen(str(cline), stdout = subprocess.PIPE, stderr=subprocess.PIPE, shell=(sys.platform!="win32")) align=AlignIO.read(child.stdout,"fasta") outfile=open('c:\Python26\opuntia.phy','w') AlignIO.write([align],outfile,'phylip') outfile.close() I always encounter with these problems Traceback (most recent call last): File "", line 244, in run_nodebug File "C:\Python26\muscleIO.py", line 11, in align=AlignIO.read(child.stdout,"fasta") File "C:\Python26\Lib\site-packages\Bio\AlignIO_init_.py", line 423, in read raise ValueError("No records found in handle") ValueError: No records found in handle

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >