Search Results

Search found 20677 results on 828 pages for 'python team'.

Page 399/828 | < Previous Page | 395 396 397 398 399 400 401 402 403 404 405 406  | Next Page >

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • Counting amount of items in Pythons 'for'

    - by Markum
    Kind of hard to explain, but when I run something like this: fruits = ['apple', 'orange', 'banana', 'strawberry', 'kiwi'] for fruit in fruits: print fruit.capitalize() It gives me this, as expected: Apple Orange Banana Strawberry Kiwi How would I edit that code so that it would "count" the amount of times it's performing the for, and print this? 1 Apple 2 Orange 3 Banana 4 Strawberry 5 Kiwi

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Ternary operator

    - by Antoine Leclair
    In PHP, I often use the ternary operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • How to repeatedly show a Dialog with PyGTK / Gtkbuilder?

    - by Julian
    I have created a PyGTK application that shows a Dialog when the user presses a button. The dialog is loaded in my __init__ method with: builder = gtk.Builder() builder.add_from_file("filename") builder.connect_signals(self) self.myDialog = builder.get_object("dialog_name") In the event handler, the dialog is shown with the command self.myDialog.run(), but this only works once, because after run() the dialog is automatically destroyed. If I click the button a second time, the application crashes. I read that there is a way to use show() instead of run() where the dialog is not destroyed, but I feel like this is not the right way for me because I would like the dialog to behave modally and to return control to the code only after the user has closed it. Is there a simple way to repeatedly show a dialog using the run() method using gtkbuilder? I tried reloading the whole dialog using the gtkbuilder, but that did not really seem to work, the dialog was missing all child elements (and I would prefer to have to use the builder only once, at the beginning of the program). [SOLUTION] As pointed out by the answer below, using hide() does the trick. But one has to take care that the dialog is in fact destroyed if one does not catch its "delete-event". A simple example that works is: import pygtk import gtk class DialogTest: def rundialog(self, widget, data=None): self.dia.show_all() result = self.dia.run() def destroy(self, widget, data=None): gtk.main_quit() def closedialog(self, widget, data=None): self.dia.hide() return True def __init__(self): self.window = gtk.Window(gtk.WINDOW_TOPLEVEL) self.window.connect("destroy", self.destroy) self.dia = gtk.Dialog('TEST DIALOG', self.window, gtk.DIALOG_MODAL | gtk.DIALOG_DESTROY_WITH_PARENT) self.dia.vbox.pack_start(gtk.Label('This is just a Test')) self.dia.connect("delete-event", self.closedialog) self.button = gtk.Button("Run Dialog") self.button.connect("clicked", self.rundialog, None) self.window.add(self.button) self.button.show() self.window.show() if __name__ == "__main__": testApp = DialogTest() gtk.main()

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Using Range Function

    - by Michael Alexander Riechmann
    My goal is to make a program that takes an input (Battery_Capacity) and ultimately spits out a list of the (New_Battery_Capacity) and the Number of (Cycle) it takes for it ultimately to reach maximum capacity of 80. Cycle = range (160) Charger_Rate = 0.5 * Cycle Battery_Capacity = float(raw_input("Enter Current Capacity:")) New_Battery_Capacity = Battery_Capacity + Charger_Rate if Battery_Capacity < 0: print 'Battery Reading Malfunction (Negative Reading)' elif Battery_Capacity > 80: print 'Battery Reading Malfunction (Overcharged)' elif float(Battery_Capacity) % 0.5 !=0: print 'Battery Malfunction (Charges Only 0.5 Interval)' while Battery_Capacity >= 0 and Battery_Capacity < 80: print New_Battery_Capacity I was wondering why my Cycle = range(160) isn't working in my program?

    Read the article

  • SQLAlchemy declarative syntax with autoload in Pylons

    - by Juliusz Gonera
    I would like to use autoload to use an existings database. I know how to do it without declarative syntax (model/_init_.py): def init_model(engine): """Call me before using any of the tables or classes in the model""" t_events = Table('events', Base.metadata, schema='events', autoload=True, autoload_with=engine) orm.mapper(Event, t_events) Session.configure(bind=engine) class Event(object): pass This works fine, but I would like to use declarative syntax: class Event(Base): __tablename__ = 'events' __table_args__ = {'schema': 'events', 'autoload': True} Unfortunately, this way I get: sqlalchemy.exc.UnboundExecutionError: No engine is bound to this Table's MetaData. Pass an engine to the Table via autoload_with=<someengine>, or associate the MetaData with an engine via metadata.bind=<someengine> The problem here is that I don't know where to get the engine from (to use it in autoload_with) at the stage of importing the model (it's available in init_model()). I tried adding meta.Base.metadata.bind(engine) to environment.py but it doesn't work. Anyone has found some elegant solution?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Infinite loop when adding a row to a list in a class in python3

    - by Margaret
    I have a script which contains two classes. (I'm obviously deleting a lot of stuff that I don't believe is relevant to the error I'm dealing with.) The eventual task is to create a decision tree, as I mentioned in this question. Unfortunately, I'm getting an infinite loop, and I'm having difficulty identifying why. I've identified the line of code that's going haywire, but I would have thought the iterator and the list I'm adding to would be different objects. Is there some side effect of list's .append functionality that I'm not aware of? Or am I making some other blindingly obvious mistake? class Dataset: individuals = [] #Becomes a list of dictionaries, in which each dictionary is a row from the CSV with the headers as keys def field_set(self): #Returns a list of the fields in individuals[] that can be used to split the data (i.e. have more than one value amongst the individuals def classified(self, predicted_value): #Returns True if all the individuals have the same value for predicted_value def fields_exhausted(self, predicted_value): #Returns True if all the individuals are identical except for predicted_value def lowest_entropy_value(self, predicted_value): #Returns the field that will reduce <a href="http://en.wikipedia.org/wiki/Entropy_%28information_theory%29">entropy</a> the most def __init__(self, individuals=[]): and class Node: ds = Dataset() #The data that is associated with this Node links = [] #List of Nodes, the offspring Nodes of this node level = 0 #Tree depth of this Node split_value = '' #Field used to split out this Node from the parent node node_value = '' #Value used to split out this Node from the parent Node def split_dataset(self, split_value): fields = [] #List of options for split_value amongst the individuals datasets = {} #Dictionary of Datasets, each one with a value from fields[] as its key for field in self.ds.field_set()[split_value]: #Populates the keys of fields[] fields.append(field) datasets[field] = Dataset() for i in self.ds.individuals: #Adds individuals to the datasets.dataset that matches their result for split_value datasets[i[split_value]].individuals.append(i) #<---Causes an infinite loop on the second hit for field in fields: #Creates subnodes from each of the datasets.Dataset options self.add_subnode(datasets[field],split_value,field) def add_subnode(self, dataset, split_value='', node_value=''): def __init__(self, level, dataset=Dataset()): My initialisation code is currently: if __name__ == '__main__': filename = (sys.argv[1]) #Takes in a CSV file predicted_value = "# class" #Identifies the field from the CSV file that should be predicted base_dataset = parse_csv(filename) #Turns the CSV file into a list of lists parsed_dataset = individual_list(base_dataset) #Turns the list of lists into a list of dictionaries root = Node(0, Dataset(parsed_dataset)) #Creates a root node, passing it the full dataset root.split_dataset(root.ds.lowest_entropy_value(predicted_value)) #Performs the first split, creating multiple subnodes n = root.links[0] n.split_dataset(n.ds.lowest_entropy_value(predicted_value)) #Attempts to split the first subnode.

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • socket.accept error 24: To many open files

    - by Creotiv
    I have a problem with open files under my Ubuntu 9.10 when running server in Python2.6 And main problem is that, that i don't know why it so.. I have set ulimit -n = 999999 net.core.somaxconn = 999999 fs.file-max = 999999 and lsof gives me about 12000 open files when server is running. And also i'm using epoll. But after some time it's start giving exeption: File "/usr/lib/python2.6/socket.py", line 195, in accept error: [Errno 24] Too many open files And i don't know how it can reach file limit when it isn't reached. Thanks for help)

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • how to speed up the code??

    - by kaushik
    i have very huge code about 600 lines plus. cant post the whole thing here. but a particular code snippet is taking so much time,leading to problems. here i post that part of code please tell me what to do speed up the processing.. please suggest the part which may be the reason and measure to improve them if this small part of code is understandable. using_data={} def join_cost(a , b): global using_data #print a #print b save_a=[] save_b=[] print 1 #for i in range(len(m)): #if str(m[i][0])==str(a): save_a=database_index[a] #for i in range(len(m)): # if str(m[i][0])==str(b): #print 'save_a',save_a #print 'save_b',save_b print 2 save_b=database_index[b] using_data[save_a[0]]=save_a s=str(save_a[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') print 3 for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) end_time=save_a[4] #print end_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(end_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 q=[] print 4 l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') q=k3.split(' ') #print q print 5 s=str(save_b[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) strt_time=save_b[3] #print strt_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(strt_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 w=[] l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') w=k3.split(' ') #print w cost=0 for i in range(12): #print q[i] #print w[i] h=float(q[i])-float(w[i]) cost=cost+math.pow(h,2) j_cost=math.sqrt(cost) #print cost return j_cost def target_cost(a , b): a=(b+1)*3 b=(a+1)*2 t_cost=(a+b)*5/2 return t_cost r1='shht:ra_77' r2='grx_18' g=[] nodes=[] nodes=nodes+[[r1]] for i in range(len(y_in_db_format)): g=y_in_db_format[i] #print g #print g[0] g.remove(str(g[0])) nodes=nodes+[g] nodes=nodes+[[r2]] print nodes print "lenght of nodes",len(nodes) lists=[] #lists=lists+[r1] for i in range(len(nodes)): for j in range(len(nodes[i])): lists=lists+[nodes[i][j]] #lists=lists+[r2] print lists distance={} for i in range(len(lists)): if i==0: distance[str(lists[i])]=0 else: distance[str(lists[i])]=long(123231223) #print distance group_dist=[] infinity=long(123232323) for i in range(len(nodes)): distances=[] for j in range(len(nodes[i])): #distances=[] if i==0: distances=distances+[[nodes[i][j], 0]] else: distances=distances+[[nodes[i][j],infinity]] group_dist=group_dist+[distances] #print distances print "group_distances",group_dist #print "check",group_dist[0][0][1] #costs={} #for i in range(len(lists)): #if i==0: # costs[str(lists[i])]=1 #else: # costs[str(lists[i])]=get_selfcost(lists[i]) path=[] for i in range(len(nodes)): mini=[] if i!=(len(nodes)-1): #temp=long(123234324) #Now calculate the cost between the current node and each of its neighbour for k in range(len(nodes[(i+1)])): for j in range(len(nodes[i])): current=nodes[i][j] #print "current_node",current j_distance=join_cost( current , nodes[i+1][k]) #t_distance=target_cost( current , nodes[i+1][k]) t_distance=34 #print distance #print "distance between current and neighbours",distance total_distance=(.5*(float(group_dist[i][j][1])+float(j_distance))+.5*(float(t_distance))) #print "total distance between the intial_nodes and current neighbour",total_distance if int(group_dist[i+1][k][1]) > int(total_distance): group_dist[i+1][k][1]=total_distance #print "updated distance",group_dist[i+1][k][1] a=current #print "the neighbour",nodes[i+1][k],"updated the value",a mini=mini+[[str(nodes[i+1][k]),a]] print mini

    Read the article

  • how to speed up the code??

    - by kaushik
    in my program i have a method which requires about 4 files to be open each time it is called,as i require to take some data.all this data from the file i have been storing in list for manupalation. I approximatily need to call this method about 10,000 times.which is making my program very slow? any method for handling this files in a better ways and is storing the whole data in list time consuming what is better alternatives for list? I can give some code,but my previous question was closed as that only confused everyone as it is a part of big program and need to be explained completely to understand,so i am not giving any code,please suggest ways thinking this as a general question... thanks in advance

    Read the article

  • Django finding which field matched in a multiple OR query

    - by Greg Hinch
    I've got a couple models which are set up something like this: class Bar(models.Model): baz = models.CharField() class Foo(models.Model): bar1 = models.ForeignKey(Bar) bar2 = models.ForeignKey(Bar) bar3 = models.ForeignKey(Bar) And elsewhere in the code, I end up with an instance of Bar, and need to find the Foo it is attached to in some capacity. Right now I came up with doing a multiple OR query using Q, something like this: foo_inst = Foo.objects.get(Q(bar1=bar_inst) | Q(bar2=bar_inst) | Q(bar3=bar_inst)) What I need to figure out is, which of the 3 cases actually hit, at least the name of the member (bar1, bar2, or bar3). Is there a good way to do this? Is there a better way to structure the query to glean that information?

    Read the article

  • Pygame, sounds don't play

    - by terabytest
    I'm trying to play sound files (.wav) with pygame but when I start it I never hear anything. This is the code: import pygame pygame.init() pygame.mixer.init() sounda= pygame.mixer.Sound("desert_rustle.wav") sounda.play() I also tried using channels but the result is the same

    Read the article

< Previous Page | 395 396 397 398 399 400 401 402 403 404 405 406  | Next Page >