Search Results

Search found 19662 results on 787 pages for 'python module'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 405/787 | < Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >

  • Create a color generator in matplotlib

    - by Brendan
    I have a series of lines that each need to be plotted with a separate colour. Each line is actually made up of several data sets (positive, negative regions etc.) and so I'd like to be able to create a generator that will feed one colour at a time across a spectrum, for example the gist_rainbow map shown here. I have found the following works but it seems very complicated and more importantly difficult to remember, from pylab import * NUM_COLORS = 22 mp = cm.datad['gist_rainbow'] get_color = matplotlib.colors.LinearSegmentedColormap.from_list(mp, colors=['r', 'b'], N=NUM_COLORS) ... # Then in a for loop this_color = get_color(float(i)/NUM_COLORS) Moreover, it does not cover the range of colours in the gist_rainbow map, I have to redefine a map. Maybe a generator is not the best way to do this, if so what is the accepted way?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • how to pass in dynamic data to decorators

    - by steve
    Hi, I am trying to write a base crud controller class that does the following: class BaseCrudController: model = "" field_validation = {} template_dir = "" @expose(self.template_dir) def new(self, *args, **kwargs) .... @validate(self.field_validation, error_handler=new) @expose() def post(self, *args, **kwargs): ... My intent is to have my controllers extend this base class, set the model, field_validation, and template locations, and am ready to go. Unfortunately, decorators (to my understanding), are interpreted when the function is defined. Hence it won't have access to instance's value. Is there a way to pass in dynamic data or values from the sub class? If not, I guess I could use override_template as a workaround to expose and set the template within the controller action. How would I go about validating the form within the controller action? Thanks, Steve

    Read the article

  • Why does Module::Build's testcover gives me "use of uninitialized value" warnings?

    - by Kurt W. Leucht
    I'm kinda new to Module::Build, so maybe I did something wrong. Am I the only one who gets warnings when I change my dispatch from "test" to "testcover"? Is there a bug in Devel::Cover? Is there a bug in Module::Build? I probably just did something wrong. I'm using ActiveState Perl v5.10.0 with Module::Build version 0.31012 and Devel::Cover 0.64 and Eclipse 3.4.1 with EPIC 0.6.34 for my IDE. UPDATE: I upgraded to Module::Build 0.34 and the warnings are still output. *UPDATE: Looks like a bug in B::Deparse. Hope it gets fixed someday.* Here's my unit test build file: use strict; use warnings; use Module::Build; my $build = Module::Build->resume ( properties => { config_dir => '_build', }, ); $build->dispatch('test'); When I run this unit test build file, I get the following output: t\MyLib1.......ok t\MyLib2.......ok t\MyLib3.......ok All tests successful. Files=3, Tests=24, 0 wallclock secs ( 0.00 cusr + 0.00 csys = 0.00 CPU) But when I change the dispatch line to 'testcover' I get the following output which always includes a bunch of "use of uninitialized value in bitwise and" warning messages: Deleting database D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db t\MyLib1.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. t\MyLib2.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. t\MyLib3.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. All tests successful. Files=3, Tests=24, 0 wallclock secs ( 0.00 cusr + 0.00 csys = 0.00 CPU) Reading database from D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db ---------------------------- ------ ------ ------ ------ ------ ------ ------ File stmt bran cond sub pod time total ---------------------------- ------ ------ ------ ------ ------ ------ ------ .../lib/ActivePerl/Config.pm 0.0 0.0 0.0 0.0 0.0 n/a 0.0 ...l/lib/ActiveState/Path.pm 0.0 0.0 0.0 0.0 100.0 n/a 4.8 <SNIP> blib/lib/<SNIP>/MyLib2.pm 100.0 90.0 n/a 100.0 100.0 0.0 98.5 blib/lib/<SNIP>/MyLib3.pm 100.0 90.9 100.0 100.0 100.0 0.6 98.0 Total 14.4 6.7 3.8 18.3 20.0 100.0 11.6 ---------------------------- ------ ------ ------ ------ ------ ------ ------ Writing HTML output to D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db/coverage.html ... done.

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • How to add a context processor from a Django app

    - by Edan Maor
    Say I'm writing a Django app, and all the templates in the app require a certain variable. The "classic" way to deal with this, afaik, is to write a context processor and add it to TEMPLATE_CONTEXT_PROCESSORS in the settings.py. My question is, is this the right way to do it, considering that apps are supposed to be "independent" from the actual project using them? In other words, when deploying that app to a new project, is there any way to avoid the project having to explicitly mess around with its settings?

    Read the article

  • SQLAlchemy - select for update example

    - by Mark
    I'm looking for a complete example of using select for update in SQLAlchemy, but haven't found one googling. I need to lock a single row and update a column, the following code doesn't work (blocks forever): s = table.select(table.c.user=="test",for_update=True) u = table.update().where(table.c.user=="test") u.execute(email="foo") Do I need a commit? How do I do that? As far as I know you need to: begin transaction select ... for update update commit

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • How to get bit rotation function to accept any bit size?

    - by calccrypto
    i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • How do I use Django to insert a Geometry Field into the database?

    - by alex
    class LocationLog(models.Model): user = models.ForeignKey(User) utm = models.GeometryField(spatial_index=True) This is my database model. I would like to insert a row. I want to insert a circle at point -55, 333. With a radius of 10. How can I put this circle into the geometry field? Of course, then I would want to check which circles overlap a given circle. (my select statement)

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • Twisted - how to create multi protocol process and send the data between the protocols

    - by SpankMe
    Hey, Im trying to write a program that would be listening for data (simple text messages) on some port (say tcp 6666) and then pass them to one or more different protocols - irc, xmpp and so on. I've tried many approaches and digged the Internet, but I cant find easy and working solution for such task. The code I am currently fighting with is here: http://pastebin.com/ri7caXih I would like to know how to from object like: ircf = ircFactory('asdfasdf', '#asdf666') get access to self protocol methods, because this: self.protocol.dupa1(msg) returns error about self not being passed to active protocol object. Or maybe there is other, better, easier and more kosher way to create single reactor with multiple protocols and have actions triggeres when a message arrives on any of them, and then pass that message to other protocols for handling/processing/sending? Any help will be highly appreciated!

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • Is using os.path.abspath to validate an untrusted filename's location secure?

    - by mcmt
    I don't think I'm missing anything. Then again I'm kind of a newbie. def GET(self, filename): name = urllib.unquote(filename) full = path.abspath(path.join(STATIC_PATH, filename)) #Make sure request is not tricksy and tries to get out of #the directory, e.g. filename = "../.ssh/id_rsa". GET OUTTA HERE assert full[:len(STATIC_PATH)] == STATIC_PATH, "bad path" return open(full).read() Edit: I realize this will return the wrong HTTP error code if the file doesn't exist (at least under web.py). I will fix this.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >