Search Results

Search found 35149 results on 1406 pages for 'yield return'.

Page 484/1406 | < Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++: Trouble with Pointers, loop variables, and structs

    - by Rosarch
    Consider the following example: #include <iostream> #include <sstream> #include <vector> #include <wchar.h> #include <stdlib.h> using namespace std; struct odp { int f; wchar_t* pstr; }; int main() { vector<odp> vec; ostringstream ss; wchar_t base[5]; wcscpy_s(base, L"1234"); for (int i = 0; i < 4; i++) { odp foo; foo.f = i; wchar_t loopStr[1]; foo.pstr = loopStr; // wchar_t* = wchar_t ? Why does this work? foo.pstr[0] = base[i]; vec.push_back(foo); } for (vector<odp>::iterator iter = vec.begin(); iter != vec.end(); iter++) { cout << "Vec contains: " << iter->f << ", " << *(iter->pstr) << endl; } } This produces: Vec contains: 0, 52 Vec contains: 1, 52 Vec contains: 2, 52 Vec contains: 3, 52 I would hope that each time, iter->f and iter->pstr would yield a different result. Unfortunately, iter->pstr is always the same. My suspicion is that each time through the loop, a new loopStr is created. Instead of copying it into the struct, I'm only copying a pointer. The location that the pointer writes to is getting overwritten. How can I avoid this? Is it possible to solve this problem without allocating memory on the heap?

    Read the article

  • Big O Complexity of a method

    - by timeNomad
    I have this method: public static int what(String str, char start, char end) { int count=0; for(int i=0;i<str.length(); i++) { if(str.charAt(i) == start) { for(int j=i+1;j<str.length(); j++) { if(str.charAt(j) == end) count++; } } } return count; } What I need to find is: 1) What is it doing? Answer: counting the total number of end occurrences after EACH (or is it? Not specified in the assignment, point 3 depends on this) start. 2) What is its complexity? Answer: the first loops iterates over the string completely, so it's at least O(n), the second loop executes only if start char is found and even then partially (index at which start was found + 1). Although, big O is all about worst case no? So in the worst case, start is the 1st char & the inner iteration iterates over the string n-1 times, the -1 is a constant so it's n. But, the inner loop won't be executed every outer iteration pass, statistically, but since big O is about worst case, is it correct to say the complexity of it is O(n^2)? Ignoring any constants and the fact that in 99.99% of times the inner loop won't execute every outer loop pass. 3) Rewrite it so that complexity is lower. What I'm not sure of is whether start occurs at most once or more, if once at most, then method can be rewritten using one loop (having a flag indicating whether start has been encountered and from there on incrementing count at each end occurrence), yielding a complexity of O(n). In case though, that start can appear multiple times, which most likely it is, because assignment is of a Java course and I don't think they would make such ambiguity. Solving, in this case, is not possible using one loop... WAIT! Yes it is..! Just have a variable, say, inc to be incremented each time start is encountered & used to increment count each time end is encountered after the 1st start was found: inc = 0, count = 0 if (current char == start) inc++ if (inc > 0 && current char == end) count += inc This would also yield a complexity of O(n)? Because there is only 1 loop. Yes I realize I wrote a lot hehe, but what I also realized is that I understand a lot better by forming my thoughts into words...

    Read the article

  • Fake ISAPI Handler to serve static files with extention that are rewritted by url rewriter

    - by developerit
    Introduction I often map html extention to the asp.net dll in order to use url rewritter with .html extentions. Recently, in the new version of www.nouvelair.ca, we renamed all urls to end with .html. This works great, but failed when we used FCK Editor. Static html files would not get serve because we mapped the html extension to the .NET Framework. We can we do to to use .html extension with our rewritter but still want to use IIS behavior with static html files. Analysis I thought that this could be resolve with a simple HTTP handler. We would map urls of static files in our rewriter to this handler that would read the static file and serve it, just as IIS would do. Implementation This is how I coded the class. Note that this may not be bullet proof. I only tested it once and I am sure that the logic behind IIS is more complicated that this. If you find errors or think of possible improvements, let me know. Imports System.Web Imports System.Web.Services ' Author: Nicolas Brassard ' For: Solutions Nitriques inc. http://www.nitriques.com ' Date Created: April 18, 2009 ' Last Modified: April 18, 2009 ' License: CPOL (http://www.codeproject.com/info/cpol10.aspx) ' Files: ISAPIDotNetHandler.ashx ' ISAPIDotNetHandler.ashx.vb ' Class: ISAPIDotNetHandler ' Description: Fake ISAPI handler to serve static files. ' Usefull when you want to serve static file that has a rewrited extention. ' Example: It often map html extention to the asp.net dll in order to use url rewritter with .html. ' If you want to still serve static html file, add a rewritter rule to redirect html files to this handler Public Class ISAPIDotNetHandler Implements System.Web.IHttpHandler Sub ProcessRequest(ByVal context As HttpContext) Implements IHttpHandler.ProcessRequest ' Since we are doing the job IIS normally does with html files, ' we set the content type to match html. ' You may want to customize this with your own logic, if you want to serve ' txt or xml or any other text file context.Response.ContentType = "text/html" ' We begin a try here. Any error that occurs will result in a 404 Page Not Found error. ' We replicate the behavior of IIS when it doesn't find the correspoding file. Try ' Declare a local variable containing the value of the query string Dim uri As String = context.Request("fileUri") ' If the value in the query string is null, ' throw an error to generate a 404 If String.IsNullOrEmpty(uri) Then Throw New ApplicationException("No fileUri") End If ' If the value in the query string doesn't end with .html, then block the acces ' This is a HUGE security hole since it could permit full read access to .aspx, .config, etc. If Not uri.ToLower.EndsWith(".html") Then ' throw an error to generate a 404 Throw New ApplicationException("Extention not allowed") End If ' Map the file on the server. ' If the file doesn't exists on the server, it will throw an exception and generate a 404. Dim fullPath As String = context.Server.MapPath(uri) ' Read the actual file Dim stream As IO.StreamReader = FileIO.FileSystem.OpenTextFileReader(fullPath) ' Write the file into the response context.Response.Output.Write(stream.ReadToEnd) ' Close and Dipose the stream stream.Close() stream.Dispose() stream = Nothing Catch ex As Exception ' Set the Status Code of the response context.Response.StatusCode = 404 'Page not found ' For testing and bebugging only ! This may cause a security leak ' context.Response.Output.Write(ex.Message) Finally ' In all cases, flush and end the response context.Response.Flush() context.Response.End() End Try End Sub ' Automaticly generated by Visual Studio ReadOnly Property IsReusable() As Boolean Implements IHttpHandler.IsReusable Get Return False End Get End Property End Class Conclusion As you see, with our static files map to this handler using query string (ex.: /ISAPIDotNetHandler.ashx?fileUri=index.html) you will have the same behavior as if you ask for the uri /index.html. Finally, test this only in IIS with the html extension map to aspnet_isapi.dll. Url rewritting will work in Casini (Internal Web Server shipped with Visual Studio) but it’s not the same as with IIS since EVERY request is handle by .NET. Versions First release

    Read the article

  • CascadingDropDown jQuery Plugin for ASP.NET MVC

    - by rajbk
    CascadingDropDown is a jQuery plugin that can be used by a select list to get automatic population using AJAX. A sample ASP.NET MVC project is attached at the bottom of this post.   Usage The code below shows two select lists : <select id="customerID" name="customerID"> <option value="ALFKI">Maria Anders</option> <option value="ANATR">Ana Trujillo</option> <option value="ANTON">Antonio Moreno</option> </select>   <select id="orderID" name="orderID"> </select> When a customer is selected in the first select list, the second list will auto populate itself with the following code: $("#orderID").CascadingDropDown("#customerID", '/Sales/AsyncOrders'); Internally, an AJAX post is made to ‘/Sales/AsyncOrders’ with the post body containing  customerID=[selectedCustomerID]. This executes the action AsyncOrders on the SalesController with signature AsyncOrders(string customerID).  The AsyncOrders method returns JSON which is then used to populate the select list. The JSON format expected is shown below : [{ "Text": "John", "Value": "10326" }, { "Text": "Jane", "Value": "10801" }] Details $(targetID).CascadingDropDown(sourceID, url, settings) targetID The ID of the select list that will auto populate.  sourceID The ID of the select list, which, on change, causes the targetID to auto populate. url The url to post to Options promptText Text for the first item in the select list Default : -- Select -- loadingText Optional text to display in the select list while it is being loaded. Default : Loading.. errorText Optional text to display if an error occurs while populating the list Default: Error loading data. postData Data you want posted to the url in place of the default Example : { postData : { customerID : $(‘#custID’), orderID : $(‘#orderID’) }} will cause customerID=ALFKI&orderID=2343 to be sent as the POST body. Default: A text string obtained by calling serialize on the sourceID onLoading (event) Raised before the list is populated. onLoaded (event) Raised after the list is populated, The code below shows how to “animate” the  select list after load. Example using custom options: $("#orderID").CascadingDropDown("#customerID", '/Sales/AsyncOrders', { promptText: '-- Pick an Order--', onLoading: function () { $(this).css("background-color", "#ff3"); }, onLoaded: function () { $(this).animate({ backgroundColor: '#ffffff' }, 300); } }); To return JSON from our action method, we use the Json ActionResult passing in an IEnumerable<SelectListItem>. public ActionResult AsyncOrders(string customerID) { var orders = repository.GetOrders(customerID).ToList().Select(a => new SelectListItem() { Text = a.OrderDate.HasValue ? a.OrderDate.Value.ToString("MM/dd/yyyy") : "[ No Date ]", Value = a.OrderID.ToString(), }); return Json(orders); } Sample Project using VS 2010 RTM NorthwindCascading.zip

    Read the article

  • ASP.NET JavaScript Routing for ASP.NET MVC–Constraints

    - by zowens
    If you haven’t had a look at my previous post about ASP.NET routing, go ahead and check it out before you read this post: http://weblogs.asp.net/zowens/archive/2010/12/20/asp-net-mvc-javascript-routing.aspx And the code is here: https://github.com/zowens/ASP.NET-MVC-JavaScript-Routing   Anyways, this post is about routing constraints. A routing constraint is essentially a way for the routing engine to filter out route patterns based on the day from the URL. For example, if I have a route where all the parameters are required, I could use a constraint on the required parameters to say that the parameter is non-empty. Here’s what the constraint would look like: Notice that this is a class that inherits from IRouteConstraint, which is an interface provided by System.Web.Routing. The match method returns true if the value is a match (and can be further processed by the routing rules) or false if it does not match (and the route will be matched further along the route collection). Because routing constraints are so essential to the route matching process, it was important that they be part of my JavaScript routing engine. But the problem is that we need to somehow represent the constraint in JavaScript. I made a design decision early on that you MUST put this constraint into JavaScript to match a route. I didn’t want to have server interaction for the URL generation, like I’ve seen in so many applications. While this is easy to maintain, it causes maintenance issues in my opinion. So the way constraints work in JavaScript is that the constraint as an object type definition is set on the route manager. When a route is created, a new instance of the constraint is created with the specific parameter. In its current form the constraint function MUST return a function that takes the route data and will return true or false. You will see the NotEmpty constraint in a bit. Another piece to the puzzle is that you can have the JavaScript exist as a string in your application that is pulled in when the routing JavaScript code is generated. There is a simple interface, IJavaScriptAddition, that I have added that will be used to output custom JavaScript. Let’s put it all together. Here is the NotEmpty constraint. There’s a few things at work here. The constraint is called “notEmpty” in JavaScript. When you add the constraint to a parameter in your C# code, the route manager generator will look for the JsConstraint attribute to look for the name of the constraint type name and fallback to the class name. For example, if I didn’t apply the “JsConstraint” attribute, the constraint would be called “NotEmpty”. The JavaScript code essentially adds a function to the “constraintTypeDefs” object on the “notEmpty” property (this is how constraints are added to routes). The function returns another function that will be invoked with routing data. Here’s how you would use the NotEmpty constraint in C# and it will work with the JavaScript routing generator. The only catch to using route constraints currently is that the following is not supported: The constraint will work in C# but is not supported by my JavaScript routing engine. (I take pull requests so if you’d like this… go ahead and implement it).   I just wanted to take this post to explain a little bit about the background on constraints. I am looking at expanding the current functionality, but for now this is a good start. Thanks for all the support with the JavaScript router. Keep the feedback coming!

    Read the article

  • PHP PSR-0 + several namespaces in one file and autoload

    - by Nemoden
    I've been thinking for a while about defining several namespaces in one php file and so, having several classes inside this file. Suppose, I want to implement something like Doctrine\ORM\Query\Expr: Expr.php Expr |-- Andx.php |-- Base.php |-- Comparison.php |-- Composite.php |-- From.php |-- Func.php |-- GroupBy.php |-- Join.php |-- Literal.php |-- Math.php |-- OrderBy.php |-- Orx.php `-- Select.php It would be nice if I had all of this in one file - Expr.php: namespace Doctrine\ORM\Query; class Expr { // code } namespace Doctrine\ORM\Query\Expr; class Func { // code } // etc... What I'm thinking of is directories naming convention and, unlike PSR-0 having several classes and namespaces in one file. It's best explained by the code: ls Doctrine/orm/query Expr.php that's it - only Expr.php Since Expr.php is somewhat I call a "meta-namespace" for Expr\Func, it make sense to place all the classes inside Expr.php (as shown above). So, the vendor name is still starts with an uppercased letter (Doctrine) and the other parts of namespace start with lowercased letter. We can write an autoload so it would respect this notion: function load_class($class) { if (class_exists($class)) { return true; } $tokenized_path = explode(array("_", "\\"), DIRECTORY_SEPARATOR, $class); // array('Doctrine', 'orm', 'query', 'Expr', 'Func'); // ^^^^ // first, we are looking for first uppercased namespace part // and if it's not last (not the class name), we use it as a filename // and wiping away the rest to compose a path to a file we need to include if (FALSE !== ($meta_class_index = find_meta_class($tokenized_path))) { $new_tokenized_path = array_slice($tokenized_path, 0, $meta_class_index); $path_to_class = implode(DIRECTORY_SEPARATOR, $new_tokenized_path); } else { // no meta class found $path_to_class = implode(DIRECTORY_SEPARATOR, $tokenized_path); } if (file_exists($path_to_class.'.php')) { require_once $path_to_class.'.php'; } return false; } Another reason to do so is to reduce a number of php files scattered among directories. Usually you check file existence before you require a file to fail gracefully: file_exists($path_to_class.'.php'); If you take a look at actual Doctrine\ORM\Query\Expr code, you'll see they use all of the "inner-classes", so you actually do: file_exists("/path/to/Doctrine/ORM/Query/Expr.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/AndX.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Base.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Comparison.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Composite.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/From.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Func.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/GroupBy.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Join.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Literal.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Math.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/OrderBy.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Orx.php"); file_exists("/path/to/Doctrine/ORM/Query/Expr/Select.php"); in your autoload which causes quite a few I/O reads. Isn't it too much to check on each user's hit? I'm just putting this on a discussion. I want to hear from another PHP programmers what do they think of it. And, of course, if you have a silver bullet addressing this problems I've designated here, please share. I also have been thinking if my vogue question fits here and according to the FAQ it seems like this question addresses "software architecture" problem slash proposal. I'm sorry if my scribble may seem a bit clunky :) Thanks.

    Read the article

  • Code snippets for ASP.NET MVC2 in VS 2010

    - by rajbk
    VS 2010 comes with ready made snippets which helps you save time while coding. You insert a snippet by typing the name of the code snippet and hitting the Tab key twice. You can also use the following method if you wish to see a listing of snippets available. Press Ctrl + K, Ctrl + X Select ASP.NET MVC2 with the arrow keys and hit enter to see a list of snippets available.   The MVC related snippets you get out of the box (for C#) are listed below: HTML actionlink Markup snippet for an ASP.NET MVC action link helper <%= Html.ActionLink("linktext", "actionname") %>   beginformajaxcs Markup snippet for an ASP.NET MVC AJAX-enabled form helper in C# <% using (Ajax.BeginForm("actionname", new AjaxOptions {UpdateTargetId= "elementid" })) { %> <% } %>   beginformcs Markup snippet for an ASP.NET MVC form helper in C# <% using (Html.BeginForm()) { %> <% } %>   displayforcs Markup snippet for an ASP.NET MVC templated helper. <%= Html.DisplayFor(x => x.Property) %>   editorforcs Markup snippet for an ASP.NET MVC templated helper. <%= Html.EditorFor(x => x.Property) %>   foreachcs Markup snippet for an ASP.NET MVC foreach statement in C# <% foreach (var item in collection) { %> <% } %>   ifcs Markup snippet for a code-nugget if else statement in C# <% if (true) { %> <% } %>   ifelsecs Markup snippet for a code-nugget if else statement in C# <% if (true) { %> <% } else { %> <% } %>   renderpartialcs Markup snippet for an ASP.NET MVC partial view rendering in C# <% Html.RenderPartial("viewname"); %>   textboxmvc Markup snippet for an ASP.NET MVC textbox helper <%= Html.TextBox("name") %>   validationsummarymvc Markup snippet for an ASP.NET MVC validation summary helper <%= Html.ValidationSummary() %> CS mvcaction Code snippet for an action. public ActionResult Action() {     return View(); }   mvcpostaction Code snippet for an action via http post. [HttpPost] public ActionResult Action() {     return View(); }   Enjoy!

    Read the article

  • Add Windows 7’s AeroSnap Feature to Vista and XP

    - by Asian Angel
    Are you using Windows Vista or XP and want that Windows 7 AeroSnap goodness on your own system? Then join us as we look at AeroSnap for Windows Vista and XP. Note: Requires .NET Framework 2.0 or higher (link provided at bottom of article). Setup What exactly does AeroSnap do you might ask…here is a quote directly from the website: “AeroSnap is a simple but powerful application that allows you to resize, arrange or maximize your desktop windows with just drag’n'drop. Simply drag a window to a side of your desktop to snap it or drag it to the top to maximize. When you drag it back to the last position, the last window size will be restored.” As soon as you have finished installing AeroSnap and started it for the first time the only item that will be visible is the “System Tray Icon”. Before going any further you should take a moment to view and make any desired adjustments in the “Options”. Note: AeroSnap works with multiple monitors. You may want to have AeroSnap start with Windows each time but the really nice setting to enable here is the “Snap Preview”. If you are using AeroSnap on Vista and have Aero enabled this will really be nice. The second portion may be of interest for those who would like to enable the keyboard shortcut function. One point worth noting about this screen is that the highest number of pixels from the screen’s edge that you can set AeroSnap for is 20 pixels. AeroSnap in Action AeroSnap is extremely easy to use…just grab the top of an app window and drag it to the left, right, or top of your screen. Since we installed this on Windows Vista we made certain to enable the “Snap Preview” in the “Options”.  We started off with dragging our Firefox 3.7 window towards the left…once we got close to the edge of the screen you can see that the left half of the screen temporarily “shaded over”. Note: The “Snap Preview” displays on the left and right movements but not the top movement. Releasing Firefox snapped it right into the “shaded over” part of the screen. The great thing about AeroSnap is that it is really easy to return the app window to it former size…all that you have to do is simply click on and grab the top portion of the app window. Moving Firefox towards the top of our screen and… It quickly snaps into filling the screen. One thing that we did notice is that the window did not “Maximize” as per the function for the button in the upper right corner. Dragging towards the right side now… And snap! Tucked in all nice and neat… You can minimize the app windows to the Taskbar and they will return to their previous “snap area” when “maximized” again. Conclusion If you have been wanting to add Windows 7’s AeroSnap goodness to your Vista and XP systems then you should definitely give this app a try. AeroSnap is very easy to set up and operate… Links Download AeroSnap for Windows Vista & XP Download the .NET Framework Similar Articles Productive Geek Tips Using Windows 7 or Vista System RestoreRoundup: 16 Tweaks to Windows Vista Look & FeelSelect Files using Check Boxes in Windows VistaSpeed up Your Windows Vista Computer with ReadyBoostHow-To Geek Bounty: $103.24(Paid!) for Active Desktop for Vista TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Add a Custom Title in IE using Spybot or Spyware Blaster When You Need to Hail a Taxi in NYC Live Map of Marine Traffic NoSquint Remembers Site Specific Zoom Levels (Firefox) New Firefox release 3.6.3 fixes 1 Critical bug Dark Side of the Moon (8-bit)

    Read the article

  • Apply Skins to Add Some Flair to Windows Media Player 12

    - by DigitalGeekery
    Tired of the same look and feel of Windows Media Player in Windows 7? We’ll show you how to inject new life into your media experience by applying skins in WMP 12. Adding Skins In Library view, click on View from the Menu and select Skin Chooser. By default, WMP 12 comes with only a couple of modest skins. When you select a skin from the left pane, a preview will be displayed to the right. To apply one of the skins, simply select it from the pane on the left and click Apply Skin.   You can also switch to the currently selected skin in the Skin chooser by selecting Skin from the View menu, or by pressing Crtl + 2. Media Player will open in Now Playing mode. Click on the Switch to Library button at the top left to return to Library view.     Ok, so the included skins are a little boring. You can find additional skins by selecting Tools > Download > Skins.   Or, by clicking on More Skins from within the Skin chooser.   You will be taken the the Microsoft website where you can choose from dozens of skins to download and install. Select a skin you’d like to try and click the link to download.   If prompted with a warning message about files containing scripts that access your library, click Yes. Note: These warning boxes may look a bit different depending on your browser. We are using Chrome for this example.   Click on View Now.   Your new skin will be on display. To get back to the Library mode, find and click the Return to Full Mode button.    Some skins may launch video in a separate window.   If you want to delete one of the skins, select it from the list within the Skin chooser and click the red “X.” You can also press the delete key on your keyboard.   Then click Yes to confirm.   Conclusion Using skins is a quick and easy way to add some style to Windows Media Player and switching back and forth between skins is a breeze. Regardless of your interests, you are sure to find a skin that fits your tastes. You may find WMP skins on other sites, but sticking with Microsoft’s website will ensure maximum compatibility. Skins for Windows Media Player Similar Articles Productive Geek Tips Make VLC Player Look like Windows Media Player 10Make VLC Player Look like Windows Media Player 11Make VLC Player Look like Winamp 5 (Kinda)Fixing When Windows Media Player Library Won’t Let You Add FilesInstall and Use the VLC Media Player on Ubuntu Linux TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips VMware Workstation 7 Acronis Online Backup DVDFab 6 Revo Uninstaller Pro Use Flixtime To Create Video Slideshows Creating a Password Reset Disk in Windows Bypass Waiting Time On Customer Service Calls With Lucyphone MELTUP – "The Beginning Of US Currency Crisis And Hyperinflation" Enable or Disable the Task Manager Using TaskMgrED Explorer++ is a Worthy Windows Explorer Alternative

    Read the article

  • JavaScript: this

    - by bdukes
    JavaScript is a language steeped in juxtaposition.  It was made to “look like Java,” yet is dynamic and classless.  From this origin, we get the new operator and the this keyword.  You are probably used to this referring to the current instance of a class, so what could it mean in a language without classes? In JavaScript, this refers to the object off of which a function is referenced when it is invoked (unless it is invoked via call or apply). What this means is that this is not bound to your function, and can change depending on how your function is invoked. It also means that this changes when declaring a function inside another function (i.e. each function has its own this), such as when writing a callback. Let's see some of this in action: var obj = { count: 0, increment: function () { this.count += 1; }, logAfterTimeout = function () { setTimeout(function () { console.log(this.count); }, 1); } }; obj.increment(); console.log(obj.count); // 1 var increment = obj.increment; window.count = 'global count value: '; increment(); console.log(obj.count); // 1 console.log(window.count); // global count value: 1 var newObj = {count:50}; increment.call(newObj); console.log(newObj.count); // 51 obj.logAfterTimeout();// global count value: 1 obj.logAfterTimeout = function () { var proxiedFunction = $.proxy(function () { console.log(this.count); }, this); setTimeout(proxiedFunction, 1); }; obj.logAfterTimeout(); // 1 obj.logAfterTimeout = function () { var that = this; setTimeout(function () { console.log(that.count); }, 1); }; obj.logAfterTimeout(); // 1 The last couple of examples here demonstrate some methods for making sure you get the values you expect.  The first time logAfterTimeout is redefined, we use jQuery.proxy to create a new function which has its this permanently set to the passed in value (in this case, the current this).  The second time logAfterTimeout is redefined, we save the value of this in a variable (named that in this case, also often named self) and use the new variable in place of this. Now, all of this is to clarify what’s going on when you use this.  However, it’s pretty easy to avoid using this altogether in your code (especially in the way I’ve demonstrated above).  Instead of using this.count all over the place, it would have been much easier if I’d made count a variable instead of a property, and then I wouldn’t have to use this to refer to it.  var obj = (function () { var count = 0; return { increment: function () { count += 1; }, logAfterTimeout = function () { setTimeout(function () { console.log(count); }, 1); }, getCount: function () { return count; } }; }()); If you’re writing your code in this way, the main place you’ll run into issues with this is when handling DOM events (where this is the element on which the event occurred).  In that case, just be careful when using a callback within that event handler, that you’re not expecting this to still refer to the element (and use proxy or that/self if you need to refer to it). Finally, as demonstrated in the example, you can use call or apply on a function to set its this value.  This isn’t often needed, but you may also want to know that you can use apply to pass in an array of arguments to a function (e.g. console.log.apply(console, [1, 2, 3, 4])).

    Read the article

  • ASP.NET Web API - Screencast series with downloadable sample code - Part 1

    - by Jon Galloway
    There's a lot of great ASP.NET Web API content on the ASP.NET website at http://asp.net/web-api. I mentioned my screencast series in original announcement post, but we've since added the sample code so I thought it was worth pointing the series out specifically. This is an introductory screencast series that walks through from File / New Project to some more advanced scenarios like Custom Validation and Authorization. The screencast videos are all short (3-5 minutes) and the sample code for the series is both available for download and browsable online. I did the screencasts, but the samples were written by the ASP.NET Web API team. So - let's watch them together! Grab some popcorn and pay attention, because these are short. After each video, I'll talk about what I thought was important. I'm embedding the videos using HTML5 (MP4) with Silverlight fallback, but if something goes wrong or your browser / device / whatever doesn't support them, I'll include the link to where the videos are more professionally hosted on the ASP.NET site. Note also if you're following along with the samples that, since Part 1 just looks at the File / New Project step, the screencast part numbers are one ahead of the sample part numbers - so screencast 4 matches with sample code demo 3. Note: I started this as one long post for all 6 parts, but as it grew over 2000 words I figured it'd be better to break it up. Part 1: Your First Web API [Video and code on the ASP.NET site] This screencast starts with an overview of why you'd want to use ASP.NET Web API: Reach more clients (thinking beyond the browser to mobile clients, other applications, etc.) Scale (who doesn't love the cloud?!) Embrace HTTP (a focus on HTTP both on client and server really simplifies and focuses service interactions) Next, I start a new ASP.NET Web API application and show some of the basics of the ApiController. We don't write any new code in this first step, just look at the example controller that's created by File / New Project. using System; using System.Collections.Generic; using System.Linq; using System.Net.Http; using System.Web.Http; namespace NewProject_Mvc4BetaWebApi.Controllers { public class ValuesController : ApiController { // GET /api/values public IEnumerable<string> Get() { return new string[] { "value1", "value2" }; } // GET /api/values/5 public string Get(int id) { return "value"; } // POST /api/values public void Post(string value) { } // PUT /api/values/5 public void Put(int id, string value) { } // DELETE /api/values/5 public void Delete(int id) { } } } Finally, we walk through testing the output of this API controller using browser tools. There are several ways you can test API output, including Fiddler (as described by Scott Hanselman in this post) and built-in developer tools available in all modern browsers. For simplicity I used Internet Explorer 9 F12 developer tools, but you're of course welcome to use whatever you'd like. A few important things to note: This class derives from an ApiController base class, not the standard ASP.NET MVC Controller base class. They're similar in places where API's and HTML returning controller uses are similar, and different where API and HTML use differ. A good example of where those things are different is in the routing conventions. In an HTTP controller, there's no need for an "action" to be specified, since the HTTP verbs are the actions. We don't need to do anything to map verbs to actions; when a request comes in to /api/values/5 with the DELETE HTTP verb, it'll automatically be handled by the Delete method in an ApiController. The comments above the API methods show sample URL's and HTTP verbs, so we can test out the first two GET methods by browsing to the site in IE9, hitting F12 to bring up the tools, and entering /api/values in the URL: That sample action returns a list of values. To get just one value back, we'd browse to /values/5: That's it for Part 1. In Part 2 we'll look at getting data (beyond hardcoded strings) and start building out a sample application.

    Read the article

  • MongoDB usage best practices

    - by andresv
    The project I'm working on uses MongoDB for some stuff so I'm creating some documents to help developers speedup the learning curve and also avoid mistakes and help them write clean & reliable code. This is my first version of it, so I'm pretty sure I will be adding more stuff to it, so stay tuned! C# Official driver notes The 10gen official MongoDB driver should always be referenced in projects by using NUGET. Do not manually download and reference assemblies in any project. C# driver quickstart guide: http://www.mongodb.org/display/DOCS/CSharp+Driver+Quickstart Reference links C# Language Center: http://www.mongodb.org/display/DOCS/CSharp+Language+Center MongoDB Server Documentation: http://www.mongodb.org/display/DOCS/Home MongoDB Server Downloads: http://www.mongodb.org/downloads MongoDB client drivers download: http://www.mongodb.org/display/DOCS/Drivers MongoDB Community content: http://www.mongodb.org/display/DOCS/CSharp+Community+Projects Tutorials Tutorial MongoDB con ASP.NET MVC - Ejemplo Práctico (Spanish):http://geeks.ms/blogs/gperez/archive/2011/12/02/tutorial-mongodb-con-asp-net-mvc-ejemplo-pr-225-ctico.aspx MongoDB and C#:http://www.codeproject.com/Articles/87757/MongoDB-and-C C# driver LINQ tutorial:http://www.mongodb.org/display/DOCS/CSharp+Driver+LINQ+Tutorial C# driver reference: http://www.mongodb.org/display/DOCS/CSharp+Driver+Tutorial Safe Mode Connection The C# driver supports two connection modes: safe and unsafe. Safe connection mode (only applies to methods that modify data in a database like Inserts, Deletes and Updates. While the current driver defaults to unsafe mode (safeMode == false) it's recommended to always enable safe mode, and force unsafe mode on specific things we know aren't critical. When safe mode is enabled, the driver internal code calls the MongoDB "getLastError" function to ensure the last operation is completed before returning control the the caller. For more information on using safe mode and their implicancies on performance and data reliability see: http://www.mongodb.org/display/DOCS/getLastError+Command If safe mode is not enabled, all data modification calls to the database are executed asynchronously (fire & forget) without waiting for the result of the operation. This mode could be useful for creating / updating non-critical data like performance counters, usage logging and so on. It's important to know that not using safe mode implies that data loss can occur without any notification to the caller. As with any wait operation, enabling safe mode also implies dealing with timeouts. For more information about C# driver safe mode configuration see: http://www.mongodb.org/display/DOCS/CSharp+getLastError+and+SafeMode The safe mode configuration can be specified at different levels: Connection string: mongodb://hostname/?safe=true Database: when obtaining a database instance using the server.GetDatabase(name, safeMode) method Collection: when obtaining a collection instance using the database.GetCollection(name, safeMode) method Operation: for example, when executing the collection.Insert(document, safeMode) method Some useful SafeMode article: http://stackoverflow.com/questions/4604868/mongodb-c-sharp-safemode-official-driver Exception Handling The driver ensures that an exception will be thrown in case of something going wrong, in case of using safe mode (as said above, when not using safe mode no exception will be thrown no matter what the outcome of the operation is). As explained here https://groups.google.com/forum/?fromgroups#!topic/mongodb-user/mS6jIq5FUiM there is no need to check for any returned value from a driver method inserting data. With updates the situation is similar to any other relational database: if an update command doesn't affect any records, the call will suceed anyway (no exception thrown) and you manually have to check for something like "records affected". For MongoDB, an Update operation will return an instance of the "SafeModeResult" class, and you can verify the "DocumentsAffected" property to ensure the intended document was indeed updated. Note: Please remember that an Update method might return a null instance instead of an "SafeModeResult" instance when safe mode is not enabled. Useful Community Articles Comments about how MongoDB works and how that might affect your application: http://ethangunderson.com/blog/two-reasons-to-not-use-mongodb/ FourSquare using MongoDB had serious scalability problems: http://mashable.com/2010/10/07/mongodb-foursquare/ Is MongoDB a replacement for Memcached? http://www.quora.com/Is-MongoDB-a-good-replacement-for-Memcached/answer/Rick-Branson MongoDB Introduction, shell, when not to use, maintenance, upgrade, backups, memory, sharding, etc: http://www.markus-gattol.name/ws/mongodb.html MongoDB Collection level locking support: https://jira.mongodb.org/browse/SERVER-1240 MongoDB performance tips: http://www.quora.com/MongoDB/What-are-some-best-practices-for-optimal-performance-of-MongoDB-particularly-for-queries-that-involve-multiple-documents Lessons learned migrating from SQL Server to MongoDB: http://www.wireclub.com/development/TqnkQwQ8CxUYTVT90/read MongoDB replication performance: http://benshepheard.blogspot.com.ar/2011/01/mongodb-replication-performance.html

    Read the article

  • Subterranean IL: Pseudo custom attributes

    - by Simon Cooper
    Custom attributes were designed to make the .NET framework extensible; if a .NET language needs to store additional metadata on an item that isn't expressible in IL, then an attribute could be applied to the IL item to represent this metadata. For instance, the C# compiler uses DecimalConstantAttribute and DateTimeConstantAttribute to represent compile-time decimal or datetime constants, which aren't allowed in pure IL, and FixedBufferAttribute to represent fixed struct fields. How attributes are compiled Within a .NET assembly are a series of tables containing all the metadata for items within the assembly; for instance, the TypeDef table stores metadata on all the types in the assembly, and MethodDef does the same for all the methods and constructors. Custom attribute information is stored in the CustomAttribute table, which has references to the IL item the attribute is applied to, the constructor used (which implies the type of attribute applied), and a binary blob representing the arguments and name/value pairs used in the attribute application. For example, the following C# class: [Obsolete("Please use MyClass2", true)] public class MyClass { // ... } corresponds to the following IL class definition: .class public MyClass { .custom instance void [mscorlib]System.ObsoleteAttribute::.ctor(string, bool) = { string('Please use MyClass2' bool(true) } // ... } and results in the following entry in the CustomAttribute table: TypeDef(MyClass) MemberRef(ObsoleteAttribute::.ctor(string, bool)) blob -> {string('Please use MyClass2' bool(true)} However, there are some attributes that don't compile in this way. Pseudo custom attributes Just like there are some concepts in a language that can't be represented in IL, there are some concepts in IL that can't be represented in a language. This is where pseudo custom attributes come into play. The most obvious of these is SerializableAttribute. Although it looks like an attribute, it doesn't compile to a CustomAttribute table entry; it instead sets the serializable bit directly within the TypeDef entry for the type. This flag is fully expressible within IL; this C#: [Serializable] public class MySerializableClass {} compiles to this IL: .class public serializable MySerializableClass {} For those interested, a full list of pseudo custom attributes is available here. For the rest of this post, I'll be concentrating on the ones that deal with P/Invoke. P/Invoke attributes P/Invoke is built right into the CLR at quite a deep level; there are 2 metadata tables within an assembly dedicated solely to p/invoke interop, and many more that affect it. Furthermore, all the attributes used to specify p/invoke methods in C# or VB have their own keywords and syntax within IL. For example, the following C# method declaration: [DllImport("mscorsn.dll", SetLastError = true)] [return: MarshalAs(UnmanagedType.U1)] private static extern bool StrongNameSignatureVerificationEx( [MarshalAs(UnmanagedType.LPWStr)] string wszFilePath, [MarshalAs(UnmanagedType.U1)] bool fForceVerification, [MarshalAs(UnmanagedType.U1)] ref bool pfWasVerified); compiles to the following IL definition: .method private static pinvokeimpl("mscorsn.dll" lasterr winapi) bool marshal(unsigned int8) StrongNameSignatureVerificationEx( string marshal(lpwstr) wszFilePath, bool marshal(unsigned int8) fForceVerification, bool& marshal(unsigned int8) pfWasVerified) cil managed preservesig {} As you can see, all the p/invoke and marshal properties are specified directly in IL, rather than using attributes. And, rather than creating entries in CustomAttribute, a whole bunch of metadata is emitted to represent this information. This single method declaration results in the following metadata being output to the assembly: A MethodDef entry containing basic information on the method Four ParamDef entries for the 3 method parameters and return type An entry in ModuleRef to mscorsn.dll An entry in ImplMap linking ModuleRef and MethodDef, along with the name of the function to import and the pinvoke options (lasterr winapi) Four FieldMarshal entries containing the marshal information for each parameter. Phew! Applying attributes Most of the time, when you apply an attribute to an element, an entry in the CustomAttribute table will be created to represent that application. However, some attributes represent concepts in IL that aren't expressible in the language you're coding in, and can instead result in a single bit change (SerializableAttribute and NonSerializedAttribute), or many extra metadata table entries (the p/invoke attributes) being emitted to the output assembly.

    Read the article

  • ASP.NET MVC for the php/asp noob

    - by dotjosh
    I was talking to a friend today, who's foremost a php developer, about his thoughts on Umbraco and he said "Well they're apparently working feverishly on the new version of Umbraco, which will be MVC... which i still don't know what that means, but I know you like it." I ended up giving him a ground up explanation of ASP.NET MVC, so I'm posting this so he can link this to his friends and for anyone else who finds it useful.  The whole goal was to be as simple as possible, not being focused on proper syntax. Model-View-Controller (or MVC) is just a pattern that is used for handling UI interaction with your backend.  In a typical web app, you can imagine the *M*odel as your database model, the *V*iew as your HTML page, and the *C*ontroller as the class inbetween.  MVC handles your web request different than your typical php/asp app.In your php/asp app, your url maps directly to a php/asp file that contains html, mixed with database access code and redirects.In an MVC app, your url route is mapped to a method on a class (the controller).  The body of this method can do some database access and THEN decide which *V*iew (html/aspx page) should be displayed;  putting the controller in charge and not the view... a clear seperation of concerns that provides better reusibility and generally promotes cleaner code. Mysite.com, a quick example:Let's say you hit the following url in your application: http://www.mysite.com/Product/ShowItem?Id=4 To avoid tedious configuration, MVC uses a lot of conventions by default. For instance, the above url in your app would automatically make MVC search for a .net class with the name "Product" and a method named "ShowItem" based on the pattern of the url.  So if you name things properly, your method would automatically be called when you entered the above url.  Additionally, it would automatically map/hydrate the "int id" parameter that was in your querystring, matched by name.Product.cspublic class Product : Controller{    public ViewResult ShowItem(int id)    {        return View();    }} From this point you can write the code in the body of this method to do some database access and then pass a "bag" (also known as the ViewData) of data to your chosen *V*iew (html page) to use for display.  The view(html) ONLY needs to be worried about displaying the flattened data that it's been given in the best way it can;  this allows the view to be reused throughout your application as *just* a view, and not be coupled to HOW the data for that view get's loaded.. Product.cspublic class Product : Controller{    public ViewResult ShowItem(int id)    {        var database = new Database();        var item = database.GetItem(id);        ViewData["TheItem"] = item;        return View();    }} Again by convention, since the class' method name is "ShowItem", it'll search for a view named "ShowItem.aspx" by default, and pass the ViewData bag to it to use. ShowItem.aspx<html>     <body>      <%        var item =(Item)ViewData["TheItem"]       %>       <h1><%= item.FullProductName %></h1>     </body></html> BUT WAIT! WHY DOES MICROSOFT HAVE TO DO THINGS SO DIFFERENTLY!?They aren't... here are some other frameworks you may have heard of that use the same pattern in a their own way: Ruby On Rails Grails Spring MVC Struts Django    

    Read the article

  • Understanding MotionEvent to implement a virtual DPad and Buttons on Android (Multitouch)

    - by Fabio Gomes
    I once implemented a DPad in XNA and now I'm trying to port it to android, put, I still don't get how the touch events work in android, the more I read the more confused I get. Here is the code I wrote so far, it works, but guess that it will only handle one touch point. public boolean onTouchEvent(MotionEvent event) { if (event.getPointerCount() == 0) return true; int touchX = -1; int touchY = -1; pressedDirection = DPadDirection.None; int actionCode = event.getAction() & MotionEvent.ACTION_MASK; if (actionCode == MotionEvent.ACTION_UP) { if (event.getPointerId(0) == idDPad) { pressedDirection = DPadDirection.None; idDPad = -1; } } else if (actionCode == MotionEvent.ACTION_DOWN || actionCode == MotionEvent.ACTION_MOVE) { touchX = (int)event.getX(); touchY = (int)event.getY(); if (rightRect.contains(touchX, touchY)) pressedDirection = DPadDirection.Right; else if (leftRect.contains(touchX, touchY)) pressedDirection = DPadDirection.Left; else if (upRect.contains(touchX, touchY)) pressedDirection = DPadDirection.Up; else if (downRect.contains(touchX, touchY)) pressedDirection = DPadDirection.Down; if (pressedDirection != DPadDirection.None) idDPad = event.getPointerId(0); } return true; } The logic is: Test if there is a "DOWN" or "MOVED" event, then if one of this events collides with one of the 4 rectangles of my DPad, I set the pressedDirectin variable to the side of the touch event, then I read the DPad actual pressed direction in my Update() event on another class. The thing I'm not sure, is how do I get track of the touch points, I store the ID of the touch point which generated the diretion that is being stored (last one), so when this ID is released I set the Direction to None, but I'm really confused about how to handle this in android, here is the code I had in XNA: public override void Update(GameTime gameTime) { PressedDirection = DpadDirection.None; foreach (TouchLocation _touchLocation in TouchPanel.GetState()) { if (_touchLocation.State == TouchLocationState.Released) { if (_touchLocation.Id == _idDPad) { PressedDirection = DpadDirection.None; _idDPad = -1; } } else if (_touchLocation.State == TouchLocationState.Pressed || _touchLocation.State == TouchLocationState.Moved) { _intersectRect.X = (int)_touchLocation.Position.X; _intersectRect.Y = (int)_touchLocation.Position.Y; _intersectRect.Width = 1; _intersectRect.Height = 1; if (_intersectRect.Intersects(_rightRect)) PressedDirection = DpadDirection.Right; else if (_intersectRect.Intersects(_leftRect)) PressedDirection = DpadDirection.Left; else if (_intersectRect.Intersects(_upRect)) PressedDirection = DpadDirection.Up; else if (_intersectRect.Intersects(_downRect)) PressedDirection = DpadDirection.Down; if (PressedDirection != DpadDirection.None) { _idDPad = _touchLocation.Id; continue; } } } base.Update(gameTime); } So, first of all: Am I doing this correctly? if not, why? I don't want my DPad to handle multiple directions, but I still didn't get how to handle the multiple touch points, is the event called for every touch point, or all touch points comes in a single call? I still don't get it.

    Read the article

  • Take,Skip and Reverse Operator in Linq

    - by Jalpesh P. Vadgama
    I have found three more new operators in Linq which is use full in day to day programming stuff. Take,Skip and Reverse. Here are explanation of operators how it works. Take Operator: Take operator will return first N number of element from entities. Skip Operator: Skip operator will skip N number of element from entities and then return remaining elements as a result. Reverse Operator: As name suggest it will reverse order of elements of entities. Here is the examples of operators where i have taken simple string array to demonstrate that. C#, using GeSHi 1.0.8.6 using System; using System.Collections.Generic; using System.Linq; using System.Text;     namespace ConsoleApplication1 {     class Program     {         static void Main(string[] args)         {             string[] a = { "a", "b", "c", "d" };                           Console.WriteLine("Take Example");             var TkResult = a.Take(2);             foreach (string s in TkResult)             {                 Console.WriteLine(s);             }               Console.WriteLine("Skip Example");             var SkResult = a.Skip(2);             foreach (string s in SkResult)             {                 Console.WriteLine(s);             }               Console.WriteLine("Reverse Example");             var RvResult = a.Reverse();             foreach (string s in RvResult)             {                 Console.WriteLine(s);             }                       }     } } Parsed in 0.020 seconds at 44.65 KB/s Here is the output as expected. hope this will help you.. Technorati Tags: Linq,Linq-To-Sql,ASP.NET,C#.NET

    Read the article

  • asynchrony is viral

    - by Daniel Moth
    It is becoming hard to write code today without introducing some form of asynchrony and, if you are using .NET (e.g. for Windows Phone 8 or Windows Store apps), that means sooner or later you have to await something and mark your method as async. My most recent examples included introducing speech recognition in my Translator By Moth phone app where I had to await mySpeechRecognizerUI.RecognizeWithUIAsync() and when moving that code base to a Windows Store project just to show a MessageBox I had to await myMessageDialog.ShowAsync(). Any time you need to invoke an asynchronous method in your code, you have a choice to make: kick off the operation but don’t wait for it to complete (otherwise known as fire-and-forget), synchronously wait for it to complete (which will entail blocking, which can be bad, especially on a UI thread), or asynchronously wait for it to complete before continuing on with the rest of the method’s work. In most cases, you want the latter, and the await keyword makes that trivial to implement.  When you use the magical await keyword in front of an API call, then you typically have to make additional changes to your code: This await usage is within a method of course, and now you have to annotate that method with async. Furthermore, you have to change the return type of the method you just annotated so it returns a Task (if it previously returned void), or Task<myOldReturnType> (if it previously returned myOldReturnType). Note that if it returns void, in some cases you could cheat and stop there. Furthermore, any method that called this method you just annotated with async will now also be invoking an asynchronous operation, so you have to make that change in the body of the caller method to introduce the await keyword before the call to the method. …you guessed it, you now have to change this caller method to be annotated with async and have its return types tweaked... …and it goes on virally… At some point you reach the root of your user code, e.g. a GUI event handler, and whoever calls that void method can already deal with the fact that you marked it as async and the viral introduction of the keywords stops there… This is all wonderful progress and a very powerful mechanism, and I just wish someone had written a refactoring tool to take care of this… anyone? I mentioned earlier that you have a choice when invoking an asynchronous operation. If the first time you encounter this you wish to localize the impact of all these changes and essentially try to turn the asynchronous behavior into synchronous by blocking - don't! For reasons why you don't want to do that, read Toub's excellent blog post (and check out the rest of his blog with gems on async programming starting with the Async FAQ). Just embrace the pattern knowing that when you use one instance of an await, you'll propagate the change all the way to the root user code method, e.g. typically an event handler. Related aside: I just finished re-writing my MessageBox wrapper class for Phone projects, including making it work in Windows Store projects, and it does expect you to use it with an await :-). I'll share that in an upcoming post for those of you that have the same need… Comments about this post by Daniel Moth welcome at the original blog.

    Read the article

  • Ambient occlusion shader just shows models as all white

    - by dvds414
    Okay so I have this shader for ambient occlusion. It loads to world correctly, but it just shows all the models as being white. I do not know why. I am just running the shader while the model is rendering, is that correct? or do I need to make a render target or something? If so then how? I'm using C++. Here is my shader: float sampleRadius; float distanceScale; float4x4 xProjection; float4x4 xView; float4x4 xWorld; float3 cornerFustrum; struct VS_OUTPUT { float4 pos : POSITION; float2 TexCoord : TEXCOORD0; float3 viewDirection : TEXCOORD1; }; VS_OUTPUT VertexShaderFunction( float4 Position : POSITION, float2 TexCoord : TEXCOORD0) { VS_OUTPUT Out = (VS_OUTPUT)0; float4 WorldPosition = mul(Position, xWorld); float4 ViewPosition = mul(WorldPosition, xView); Out.pos = mul(ViewPosition, xProjection); Position.xy = sign(Position.xy); Out.TexCoord = (float2(Position.x, -Position.y) + float2( 1.0f, 1.0f ) ) * 0.5f; float3 corner = float3(-cornerFustrum.x * Position.x, cornerFustrum.y * Position.y, cornerFustrum.z); Out.viewDirection = corner; return Out; } texture depthTexture; texture randomTexture; sampler2D depthSampler = sampler_state { Texture = <depthTexture>; ADDRESSU = CLAMP; ADDRESSV = CLAMP; MAGFILTER = LINEAR; MINFILTER = LINEAR; }; sampler2D RandNormal = sampler_state { Texture = <randomTexture>; ADDRESSU = WRAP; ADDRESSV = WRAP; MAGFILTER = LINEAR; MINFILTER = LINEAR; }; float4 PixelShaderFunction(VS_OUTPUT IN) : COLOR0 { float4 samples[16] = { float4(0.355512, -0.709318, -0.102371, 0.0 ), float4(0.534186, 0.71511, -0.115167, 0.0 ), float4(-0.87866, 0.157139, -0.115167, 0.0 ), float4(0.140679, -0.475516, -0.0639818, 0.0 ), float4(-0.0796121, 0.158842, -0.677075, 0.0 ), float4(-0.0759516, -0.101676, -0.483625, 0.0 ), float4(0.12493, -0.0223423, -0.483625, 0.0 ), float4(-0.0720074, 0.243395, -0.967251, 0.0 ), float4(-0.207641, 0.414286, 0.187755, 0.0 ), float4(-0.277332, -0.371262, 0.187755, 0.0 ), float4(0.63864, -0.114214, 0.262857, 0.0 ), float4(-0.184051, 0.622119, 0.262857, 0.0 ), float4(0.110007, -0.219486, 0.435574, 0.0 ), float4(0.235085, 0.314707, 0.696918, 0.0 ), float4(-0.290012, 0.0518654, 0.522688, 0.0 ), float4(0.0975089, -0.329594, 0.609803, 0.0 ) }; IN.TexCoord.x += 1.0/1600.0; IN.TexCoord.y += 1.0/1200.0; normalize (IN.viewDirection); float depth = tex2D(depthSampler, IN.TexCoord).a; float3 se = depth * IN.viewDirection; float3 randNormal = tex2D( RandNormal, IN.TexCoord * 200.0 ).rgb; float3 normal = tex2D(depthSampler, IN.TexCoord).rgb; float finalColor = 0.0f; for (int i = 0; i < 16; i++) { float3 ray = reflect(samples[i].xyz,randNormal) * sampleRadius; //if (dot(ray, normal) < 0) // ray += normal * sampleRadius; float4 sample = float4(se + ray, 1.0f); float4 ss = mul(sample, xProjection); float2 sampleTexCoord = 0.5f * ss.xy/ss.w + float2(0.5f, 0.5f); sampleTexCoord.x += 1.0/1600.0; sampleTexCoord.y += 1.0/1200.0; float sampleDepth = tex2D(depthSampler, sampleTexCoord).a; if (sampleDepth == 1.0) { finalColor ++; } else { float occlusion = distanceScale* max(sampleDepth - depth, 0.0f); finalColor += 1.0f / (1.0f + occlusion * occlusion * 0.1); } } return float4(finalColor/16, finalColor/16, finalColor/16, 1.0f); } technique SSAO { pass P0 { VertexShader = compile vs_3_0 VertexShaderFunction(); PixelShader = compile ps_3_0 PixelShaderFunction(); } }

    Read the article

  • Amazon Product Advertising API SOAP Namespace Changes

    - by Rick Strahl
    About two months ago (twowards the end of February 2012 I think) Amazon decided to change the namespace of the Product Advertising API. The error that would come up was: <ItemSearchResponse > was not expected. If you've used the Amazon Product Advertising API you probably know that Amazon has made it a habit to break the services every few years or so and I guess last month was about the time for another one. Basically the service namespace of the document has been changed and responses from the service just failed outright even though the rest of the schema looks fine. Now I looked around for a while trying to find a recent update to the Product Advertising API - something semi-official looking but everything is dated around 2009. Really??? And it's not just .NET - the newest thing on the sample/APIs is dated early 2011 and a handful of 2010 samples. There are newer full APIs for the 'cloud' offerings, but the Product Advertising API apparently isn't part of that. After searching for quite a bit trying to trace this down myself and trying some of the newer samples (which also failed) I found an obscure forum post that describes the solution of getting past the namespace issue. FWIW, I've been using an old version of the Product Advertising API using the old Microsoft WSE3 services (pre-WCF), which provides some of the WS* security features required by the Amazon service. The fix for this code is to explicitly override the namespace declaration on each of the imported service method signatures. The old service namespace (at least on my build) was: http://webservices.amazon.com/AWSECommerceService/2009-03-31 and it should be changed to: http://webservices.amazon.com/AWSECommerceService/2011-08-01 Change it on the class header:[Microsoft.Web.Services3.Messaging.SoapService("http://webservices.amazon.com/AWSECommerceService/2011-08-01")] [System.Xml.Serialization.XmlIncludeAttribute(typeof(Property[]))] [System.Xml.Serialization.XmlIncludeAttribute(typeof(BrowseNode[]))] [System.Xml.Serialization.XmlIncludeAttribute(typeof(TransactionItem[]))] public partial class AWSECommerceService : Microsoft.Web.Services3.Messaging.SoapClient { and on all method signatures:[Microsoft.Web.Services3.Messaging.SoapMethodAttribute("http://soap.amazon.com/ItemSearch")] [return: System.Xml.Serialization.XmlElementAttribute("ItemSearchResponse", Namespace="http://webservices.amazon.com/AWSECommerceService/2011-08-01")] public ItemSearchResponse ItemSearch(ItemSearch ItemSearch1) { Microsoft.Web.Services3.SoapEnvelope results = base.SendRequestResponse("ItemSearch", ItemSearch1); return ((ItemSearchResponse)(results.GetBodyObject(typeof(ItemSearchResponse), this.SoapServiceAttribute.TargetNamespace))); } It's easy to do with a Search and Replace on the above strings. Amazon Services <rant> FWIW, I've not been impressed by Amazon's service offerings. While the services work well, their documentation and tool support is absolutely horrendous. I was recently working with a customer on an old AWS application and their old API had been completely removed with a new API that wasn't even a close match. One old API call resulted in requiring three different APIs to perform the same functionality. We had to re-write the entire piece from scratch essentially. The documentation was downright wrong, and incomplete and so scattered it was next to impossible to follow. The examples weren't examples at all - they're mockups of real service calls with fake data that didn't even provide everything that was required to make same service calls work. Additionally there appears to be just about no public support from Amazon, only peer support which is sparse at best - and getting a hold of somebody at Amazon, even for pay seems to be mythical task. It's a terrible business model they have going. I can't see why anybody would put themselves through this sort of customer and development experience. Sad really, but an experience we see more and more these days. Nobody puts in the time to document anything anymore, leaving it to devs to figure this stuff out over and over again… </rant>© Rick Strahl, West Wind Technologies, 2005-2012Posted in CSharp  Web Services   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

  • How to fix Software Center crashes?

    - by shandna towns
    E: Type '<!DOCTYPE' is not known on line 1 in source list /etc/apt/sources.list.d/medibuntu.list E: The list of sources could not be read. shandanatowns@ubuntu:~$ software-center 2012-09-25 12:23:35,115 - softwarecenter.ui.gtk3.app - INFO - setting up proxy 'None' 2012-09-25 12:23:35,123 - softwarecenter.db.database - INFO - open() database: path=None use_axi=True use_agent=True (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:34:20: Not using units is deprecated. Assuming 'px'. (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:34:22: Not using units is deprecated. Assuming 'px'. (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:56:20: Not using units is deprecated. Assuming 'px'. (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:56:22: Not using units is deprecated. Assuming 'px'. (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:60:20: Not using units is deprecated. Assuming 'px'. (software-center:4524): Gtk-WARNING **: Theme parsing error: softwarecenter.css:60:22: Not using units is deprecated. Assuming 'px'. 2012-09-25 12:23:35,472 - softwarecenter.backend.reviews - WARNING - Could not get usefulness from server, no username in config file 2012-09-25 12:23:35,477 - softwarecenter.fixme - WARNING - logs to the root logger: '('/usr/lib/python2.7/dist-packages/gi/importer.py', 51, 'find_module')' 2012-09-25 12:23:35,477 - root - ERROR - Could not find any typelib for LaunchpadIntegration 2012-09-25 12:23:35,605 - softwarecenter.ui.gtk3.app - INFO - show_available_packages: search_text is '', app is None. 2012-09-25 12:23:35,987 - softwarecenter.db.pkginfo_impl.aptcache - INFO - aptcache.open() Traceback (most recent call last): File "/usr/share/software-center/softwarecenter/db/pkginfo_impl/aptcache.py", line 257, in open self._cache = apt.Cache(progress) File "/usr/lib/python2.7/dist-packages/apt/cache.py", line 102, in __init__ self.open(progress) File "/usr/lib/python2.7/dist-packages/apt/cache.py", line 149, in open self._list.read_main_list() SystemError: E:Type '<!DOCTYPE' is not known on line 1 in source list /etc/apt/sources.list.d/medibuntu.list 2012-09-25 12:23:37,000 - softwarecenter.db.enquire - ERROR - _get_estimate_nr_apps_and_nr_pkgs failed Traceback (most recent call last): File "/usr/share/software-center/softwarecenter/db/enquire.py", line 115, in _get_estimate_nr_apps_and_nr_pkgs tmp_matches = enquire.get_mset(0, len(self.db), None, xfilter) File "/usr/share/software-center/softwarecenter/db/appfilter.py", line 89, in __call__ if (not pkgname in self.cache and File "/usr/share/software-center/softwarecenter/db/pkginfo_impl/aptcache.py", line 277, in __contains__ return self._cache.__contains__(k) AttributeError: 'NoneType' object has no attribute '__contains__' Traceback (most recent call last): File "/usr/bin/software-center", line 182, in <module> app.run(args) File "/usr/share/software-center/softwarecenter/ui/gtk3/app.py", line 1385, in run self.show_available_packages(args) File "/usr/share/software-center/softwarecenter/ui/gtk3/app.py", line 1323, in show_available_packages self.view_manager.set_active_view(ViewPages.AVAILABLE) File "/usr/share/software-center/softwarecenter/ui/gtk3/session/viewmanager.py", line 151, in set_active_view view_widget.init_view() File "/usr/share/software-center/softwarecenter/ui/gtk3/panes/availablepane.py", line 173, in init_view self.cache, self.db, self.icons, self.apps_filter) File "/usr/share/software-center/softwarecenter/ui/gtk3/views/lobbyview.py", line 81, in __init__ self.build() File "/usr/share/software-center/softwarecenter/ui/gtk3/views/lobbyview.py", line 322, in build self._build_homepage_view() File "/usr/share/software-center/softwarecenter/ui/gtk3/views/lobbyview.py", line 120, in _build_homepage_view self._append_whats_new() File "/usr/share/software-center/softwarecenter/ui/gtk3/views/lobbyview.py", line 251, in _append_whats_new whats_new_cat = self._update_whats_new_content() File "/usr/share/software-center/softwarecenter/ui/gtk3/views/lobbyview.py", line 236, in _update_whats_new_content docs = whats_new_cat.get_documents(self.db) File "/usr/share/software-center/softwarecenter/db/categories.py", line 132, in get_documents nonblocking_load=False) File "/usr/share/software-center/softwarecenter/db/enquire.py", line 317, in set_query self._blocking_perform_search() File "/usr/share/software-center/softwarecenter/db/enquire.py", line 212, in _blocking_perform_search matches = enquire.get_mset(0, self.limit, None, xfilter) File "/usr/share/software-center/softwarecenter/db/appfilter.py", line 89, in __call__ if (not pkgname in self.cache and File "/usr/share/software-center/softwarecenter/db/pkginfo_impl/aptcache.py", line 277, in __contains__ return self._cache.__contains__(k) AttributeError: 'NoneType' object has no attribute '__contains__'

    Read the article

  • Routes for IIS Classic and Integrated Mode

    - by imran_ku07
         Introduction:             ASP.NET MVC Routing feature makes it very easy to provide clean URLs. You just need to configure routes in global.asax file to create an application with clean URLs. In most cases you define routes works in IIS 6, IIS 7 (or IIS 7.5) Classic and Integrated mode. But in some cases your routes may only works in IIS 7 Integrated mode, like in the case of using extension less URLs in IIS 6 without a wildcard extension map. So in this article I will show you how to create different routes which works in IIS 6 and IIS 7 Classic and Integrated mode.       Description:             Let's say that you need to create an application which must work both in Classic and Integrated mode. Also you have no control to setup a wildcard extension map in IIS. So you need to create two routes. One with extension less URL for Integrated mode and one with a URL with an extension for Classic Mode.   routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults );               Now you have set up two routes, one for Integrated mode and one for Classic mode. Now you only need to ensure that Integrated mode route should only match if the application is running in Integrated mode and Classic mode route should only match if the application is running in Classic mode. For making this work you need to create two custom constraint for Integrated and Classic mode. So replace the above routes with these routes,     routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new ClassicModeConstraint() }// Constraints ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new IntegratedModeConstraint() }// Constraints );            The first route which is for Classic mode adds a ClassicModeConstraint and second route which is for Integrated mode adds a IntegratedModeConstraint. Next you need to add the implementation of these constraint classes.     public class ClassicModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return !HttpRuntime.UsingIntegratedPipeline; } } public class IntegratedModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return HttpRuntime.UsingIntegratedPipeline; } }             HttpRuntime.UsingIntegratedPipeline returns true if the application is running on Integrated mode; otherwise, it returns false. So routes for Integrated mode only matched when the application is running on Integrated mode and routes for Classic mode only matched when the application is not running on Integrated mode.       Summary:             During developing applications, sometimes developers are not sure that whether this application will be host on IIS 6 or IIS 7 (or IIS 7.5) Integrated mode or Classic mode. So it's a good idea to create separate routes for both Classic and Integrated mode so that your application will use extension less URLs where possible and use URLs with an extension where it is not possible to use extension less URLs. In this article I showed you how to create separate routes for IIS Integrated and Classic mode. Hope you will enjoy this article too.   SyntaxHighlighter.all()

    Read the article

  • Expert F# &ndash; Pattern Matching with Adam and Eve

    - by MarkPearl
    So I am loving my Expert F# book. I wish I had more time with it, but the little time I get I really enjoy. However today I was completely stumped by what the book was trying to get across with regards to pattern matching. On Page 38 – Chapter 3, it briefly describes F# option values. On this page it gives the code snippet along the code lines below and then goes on to speak briefly about pattern matching... open System type 'a option = | None | Some of 'a let people = [ ("Adam", None); ("Eve", None); ("Cain", Some("Adam", "Eve")); ("Abel", Some("Adam", "Eve")) ] let showParents(name, parents) = match parents with | Some(dad, mum) -> printfn "%s has father %s, mother %s" name dad mum | None -> printfn "%s has no parents!" name Console.WriteLine(showParents("Adam", None))   Originally when I read this code I think I misunderstood the purpose of the example code. I for some reason thought that the showParents function would magically be parsing the people array and looking for a match of name and then showing the parents. But obviously it cannot do this since there is no reference to the people array in the showParents method. After rereading the page I realized that I had just combined the two segments of code together, possibly incorrectly, and that a better example would have been to have a code snippet like the following. let showParents(name, parents) = match parents with | Some(dad, mum) -> printfn "%s has father %s, mother %s" name dad mum | None -> printfn "%s has no parents!" name Console.WriteLine(showParents("Adam", None)) Console.WriteLine(showParents("Cain", Some("Adam", "Eve"))) Console.ReadLine()   However, what if I wanted to have a function that was passed a list of people and a name would then show the parents of the name if there were any, and if not would show that they had no parents… so that doesnt seem to difficult does it… lets look at my very unoptimized noob F# code to try and achieve this… open System let people = [ ("Adam", None); ("Eve", None); ("Cain", Some("Adam", "Eve")); ("Abel", Some("Adam", "Eve")) ] // // returns the name of the person // let showName(person : string * (string * string) option) = let name = fst(person) name // // Returns a string with the parents details or not // let showParents(itemData : string * (string * string) option) = let name = fst(itemData) let parents = snd(itemData) match parents with | Some(dad, mum) -> "Father " + dad + " and Mother " + mum | None -> "Has no parents!" // // Prints the details // let showDetails(person : string * (string * string) option) = Console.WriteLine(showName(person)) Console.WriteLine(showParents(person)) // // Check if the name matches the first portion of person // if so, return true, else return false // let nameMatch(name : string , person : string * (string * string) option) = match name with | x when x = fst(person) -> true | _ -> false // // Searches an array of people and looks for a match of names // let findPerson(name : string, people : (string * (string * string) option) list) = let o = Seq.tryFind(fun x -> nameMatch(name, x)) people if Option.isSome o then o else Option.None // // Try and find a person, if found show their details // else show no match // let FoundPerson = findPerson("Cain", people) match FoundPerson with | None -> Console.WriteLine("Not found") | Some(x) -> showDetails(x) Console.ReadLine() So, my code isn’t the cleanest but it did teach me a bit more F#. The area that I learnt about was the option keyword. The challenge being, if a match of the name isn’t found – and if a name is found but the person doesn’t have parents it should react accordingly. I’m pretty sure I can optimize this code quite a bit more and I think I may come back to it sometime in the future and relook at it, but for now at least I was able to achieve what I wanted.. and my brain has gone just that wee little bit more functional.

    Read the article

  • Lazy Evaluation &ndash; Why being lazy in F# blows my mind!

    - by MarkPearl
    First of all – shout out to Peter Adams – from the feedback I have gotten from him on the last few posts of F# that I have done – my mind has just been expanded. I did a blog post a few days ago about infinite sequences – I didn’t really understand what was going on with it, and I still don’t really get it – but I am getting closer. In Peter’s last comment he made mention of Lazy Evaluation. I am ashamed to say that up till then I had never heard about lazy evaluation – how can evaluation be lazy? I mean, I know about lazy loading and that makes sense… but surely something is either evaluated or not! Well… a bit of reading today and I have been enlightened to a point – if you do know of any good articles explaining lazy evaluation please send them to me. So what is lazy evaluation and why is it useful? Lazy evaluation is a process whereby the system only computes the values needed and “ignores” the computations not needed. I’m going out on a limb here, but with this explanation in hand, imagine the following C# code… public int CalculatedVal() { int Val1 = 0; int Val2 = 0; for (int Count = 0; Count < 1000000; Count++) { Val1++; } return Val2; }   Normally, even though Val1 is never needed, the system would loop 1000000 times and add 1 to the current value of Val1. Imagine if the system realized this and so just skipped this segment of code and instead did the following…. public int CalculatedVal() { int Val1 = 0; return Val2; }   A massive saving in computation and wasted effort. Now I am pretty sure it isn’t as simple as this but I think this is the basic idea. For a more detailed explanation of lazy evaluation in c#, Pedram Rezei has a wonderful post on lazy evaluation and makes some C# comparisons. I am not going to take any thunder from him by repeating everything he said since I think he did such a good job of explaining it himself. What I am interested in though is how in F# do you tell something to have lazy evalution, and how do you know if something will be eager or lazy by looking at it. I found this post was useful. From reading around F# by default uses eager evaluation unless explicitly told to use lazy evaluation. One exception to this is sequences, which are lazy by default. Now reading about lazy evaluation has helped me understand more about F# coding… From my understanding of F# because of its declarative nature, most of the actual code you are declaring properties and rules – very little code is actually saying do this right now - but when it comes to a “do this” code section, it then evaluates and optimizes code and applies the rules. So props to lazy evaluation and its optimizations…

    Read the article

  • XNA 4 Deferred Rendering deforms the model

    - by Tomáš Bezouška
    I have a problem when rendering a model of my World - when rendered using BasicEffect, it looks just peachy. Problem is when I render it using deferred rendering. See for yourselves: what it looks like: http://imageshack.us/photo/my-images/690/survival.png/ what it should look like: http://imageshack.us/photo/my-images/521/survival2.png/ (Please ignora the cars, they shouldn't be there. Nothing changes when they are removed) Im using Deferred renderer from www.catalinzima.com/tutorials/deferred-rendering-in-xna/introduction-2/ except very simplified, without the custom content processor. Here's the code for the GBuffer shader: float4x4 World; float4x4 View; float4x4 Projection; float specularIntensity = 0.001f; float specularPower = 3; texture Texture; sampler diffuseSampler = sampler_state { Texture = (Texture); MAGFILTER = LINEAR; MINFILTER = LINEAR; MIPFILTER = LINEAR; AddressU = Wrap; AddressV = Wrap; }; struct VertexShaderInput { float4 Position : POSITION0; float3 Normal : NORMAL0; float2 TexCoord : TEXCOORD0; }; struct VertexShaderOutput { float4 Position : POSITION0; float2 TexCoord : TEXCOORD0; float3 Normal : TEXCOORD1; float2 Depth : TEXCOORD2; }; VertexShaderOutput VertexShaderFunction(VertexShaderInput input) { VertexShaderOutput output; float4 worldPosition = mul(input.Position, World); float4 viewPosition = mul(worldPosition, View); output.Position = mul(viewPosition, Projection); output.TexCoord = input.TexCoord; //pass the texture coordinates further output.Normal = mul(input.Normal,World); //get normal into world space output.Depth.x = output.Position.z; output.Depth.y = output.Position.w; return output; } struct PixelShaderOutput { half4 Color : COLOR0; half4 Normal : COLOR1; half4 Depth : COLOR2; }; PixelShaderOutput PixelShaderFunction(VertexShaderOutput input) { PixelShaderOutput output; output.Color = tex2D(diffuseSampler, input.TexCoord); //output Color output.Color.a = specularIntensity; //output SpecularIntensity output.Normal.rgb = 0.5f * (normalize(input.Normal) + 1.0f); //transform normal domain output.Normal.a = specularPower; //output SpecularPower output.Depth = input.Depth.x / input.Depth.y; //output Depth return output; } technique Technique1 { pass Pass1 { VertexShader = compile vs_2_0 VertexShaderFunction(); PixelShader = compile ps_2_0 PixelShaderFunction(); } } And here are the rendering parts in XNA: public void RednerModel(Model model, Matrix world) { Matrix[] boneTransforms = new Matrix[model.Bones.Count]; model.CopyAbsoluteBoneTransformsTo(boneTransforms); Game.GraphicsDevice.DepthStencilState = DepthStencilState.Default; Game.GraphicsDevice.BlendState = BlendState.Opaque; Game.GraphicsDevice.RasterizerState = RasterizerState.CullCounterClockwise; foreach (ModelMesh mesh in model.Meshes) { foreach (ModelMeshPart meshPart in mesh.MeshParts) { GBufferEffect.Parameters["View"].SetValue(Camera.Instance.ViewMatrix); GBufferEffect.Parameters["Projection"].SetValue(Camera.Instance.ProjectionMatrix); GBufferEffect.Parameters["World"].SetValue(boneTransforms[mesh.ParentBone.Index] * world); GBufferEffect.Parameters["Texture"].SetValue(meshPart.Effect.Parameters["Texture"].GetValueTexture2D()); GBufferEffect.Techniques[0].Passes[0].Apply(); RenderMeshpart(mesh, meshPart); } } } private void RenderMeshpart(ModelMesh mesh, ModelMeshPart part) { Game.GraphicsDevice.SetVertexBuffer(part.VertexBuffer); Game.GraphicsDevice.Indices = part.IndexBuffer; Game.GraphicsDevice.DrawIndexedPrimitives(PrimitiveType.TriangleList, 0, 0, part.NumVertices, part.StartIndex, part.PrimitiveCount); } I import the model using the built in content processor for FBX. The FBX is created in 3DS Max. I don't know the exact details of that export, but if you think it might be relevant, I will get them from my collegue who does them. What confuses me though is why the BasicEffect approach works... seems the FBX shouldnt be a problem. Any thoughts? They will be greatly appreciated :)

    Read the article

< Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >