Search Results

Search found 14799 results on 592 pages for 'instance eval'.

Page 506/592 | < Previous Page | 502 503 504 505 506 507 508 509 510 511 512 513  | Next Page >

  • User will input some filter criteria -- how can I turn it into a regular expression for String.match

    - by envinyater
    I have a program where the user will enter a string such as PropertyA = "abc_*" and I need to have the asterisk match any character. In my code, I'm grabbing the property value and replacing PropertyA with the actual value. For instance, it could be abc_123. I also pull out the equality symbol into a variable. It should be able to cover this type of criteria PropertyB = 'cba' PropertyC != '*-this' valueFromHeader is the lefthand side and value is the righthand side. if (equality.equals("=")) { result = valueFromHeader.matches(value); } else if (equality.equals("!=")) { result = !valueFromHeader.matches(value); } EDIT: The existing code had this type of replacement for regular expressions final String ESC = "\\$1"; final String NON_ALPHA = "([^A-Za-z0-9@])"; final String WILD = "*"; final String WILD_RE_TEMP = "@"; final String WILD_RE = ".*"; value = value.replace(WILD, WILD_RE_TEMP); value = value.replaceAll(NON_ALPHA,ESC); value = value.replace(WILD_RE_TEMP, WILD_RE); It doesn't like the underscore here... abcSite_123 != abcSite_123 (evaluates to true) abcSite_123$1.matches("abcSite$1123") It doesn't like the underscore...

    Read the article

  • MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

    - by user768113
    I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

    Read the article

  • Using static variables for Strings

    - by Vivart
    below content is taken from Best practice: Writing efficient code but i didn't understand why private static String x = "example"; faster than private static final String x ="example"; Can anybody explain this. Using static variables for Strings When you define static fields (also called class fields) of type String, you can increase application speed by using static variables (not final) instead of constants (final). The opposite is true for primitive data types, such as int. For example, you might create a String object as follows: private static final String x = "example"; For this static constant (denoted by the final keyword), each time that you use the constant, a temporary String instance is created. The compiler eliminates "x" and replaces it with the string "example" in the bytecode, so that the BlackBerry® Java® Virtual Machine performs a hash table lookup each time that you reference "x". In contrast, for a static variable (no final keyword), the String is created once. The BlackBerry JVM performs the hash table lookup only when it initializes "x", so access is faster. private static String x = "example"; You can use public constants (that is, final fields), but you must mark variables as private.

    Read the article

  • CREATE VIEW called multiple times not creating all views

    - by theninepoundhammer
    Noticing strange behavior in SQL 2005, both Express and Enterprise Edition: In my code I need to loop through a series of values (about five in a row), and for each value, I need to insert the value into a table and dynamically create a new view using that value as part of the where clause and the name of the view. The code runs pretty quickly, but what I'm noticing is that all the values are inserted into the table correctly but only the LAST view is being created. Every time. For example, if the values I'm using are X1, X2, X3, X4, and X5, I'll run the process, open up Mgmt Studio, and see five rows in the table with the correct five values, but only one view named MyView_x5 that has the correct WHERE clause. At first, I had this loop in an SSIS package as part of a larger data flow. When I started noticing this behavior, I created a stored proc that would create the CREATE VIEW statement dynamically after the insert and called EXECUTE to create the view. Same result. Finally, I created some C# code using the Enterprise Library DAAB, and did the insert and CREATE VIEW statements from my DLL. Same result every time. Most recently, I turned on Profiler while running against the Enterprise Edition and was able to verify that the Batch Started and Batch Completed events were being fired off for each instance of the view. However, like I said, only the last view is actually being created. Does anyone have any idea why this might be happening? Or any suggestions about what else to check or profile? I've profiled for error messages, exceptions, etc. but don't see any in my trace file. My express edition is 9.00.1399.06. Not sure about the Enterprise edition but think it is SP2.

    Read the article

  • Java constructor using generic types

    - by Beer Me
    I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method breweryMethod() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // breweryMethod() is an instance method // of Brewery, of which <T> is a subclass (right?) c.breweryMethod(); // "The method breweryMethod() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void brewerySubClassMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

    Read the article

  • Dynamic use of :default_url in Paperclip

    - by dgilperez
    I'm trying to configure Paperclip to provide different missing images based on the instance's category attribute. Every category of the object has its own missing image. This is my first take: EDIT to add full models: class Service < ActiveRecord::Base attr_accessible :logo, :logo_file_name, :logo_content_type, :logo_file_size, :logo_updated_at belongs_to :category, :counter_cache => true has_attached_file :logo, :path => "/:id-:style-:filename", :url => ":s3_eu_url", :default_url => "/logos/:style/#{self.category.name]}.png", :styles => { :large => "600x400>", :medium => "300x200>", :small => "100x75>", :thumb => "60x42>" } end class Category < ActiveRecord::Base attr_accessible nil has_many :services end In my view, image_tag service.logo.url(:thumb) outputs: undefined method `category' for #<Class:0x0000010a731620> Any ideas? EDIT2: A working default_url is :default_url => "/logos/:style/missing.png", SOLUTION: See my own answer below.

    Read the article

  • How can I find the common ancestor of two nodes in a binary tree?

    - by Siddhant
    The Binary Tree here is not a Binary Search Tree. Its just a Binary Tree. The structure could be taken as - struct node { int data; struct node *left; struct node *right; }; The maximum solution I could work out with a friend was something of this sort - Consider this binary tree (from http://lcm.csa.iisc.ernet.in/dsa/node87.html) : The inorder traversal yields - 8, 4, 9, 2, 5, 1, 6, 3, 7 And the postorder traversal yields - 8, 9, 4, 5, 2, 6, 7, 3, 1 So for instance, if we want to find the common ancestor of nodes 8 and 5, then we make a list of all the nodes which are between 8 and 5 in the inorder tree traversal, which in this case happens to be [4, 9, 2]. Then we check which node in this list appears last in the postorder traversal, which is 2. Hence the common ancestor for 8 and 5 is 2. The complexity for this algorithm, I believe is O(n) (O(n) for inorder/postorder traversals, the rest of the steps again being O(n) since they are nothing more than simple iterations in arrays). But there is a strong chance that this is wrong. :-) But this is a very crude approach, and I'm not sure if it breaks down for some case. Is there any other (possibly more optimal) solution to this problem?

    Read the article

  • Adding li element only if it not already there?

    - by Legend
    I am constructing an <li> element like this: var element = $("<li></li>") .html(mHTML) .attr('id', "elemid"); I am trying to add this element to a <ul> element only if it doesn't already exist. Any ideas on how to do this? Am I supposed to use contains() to see if the ul element contain the html and then decide? For instance, <ul id="elemul"> <li id="elemli1">Element 1</li> <li id="elemli2">Element 2</li> <li id="elemli3">Element 3</li> </ul> If I try adding Element 1, it should not add it. What should I do if its a longer string (not really long but about 150 characters). Note: I cannot rely on IDs to determine the uniqueness. i.e. I might end up forming something like: <li id="elemli3">Element 1</li> Do I go about using hashmaps?

    Read the article

  • Code won't work under mono, any ideas whats wrong?

    - by JL
    Mono won't fire the following code: I get internal server error 500, error writing request error. Code works perfectly under normal .net.... any ideas why its broken and how to fix it? [WebServiceBinding] public class testService : System.Web.Services.Protocols.SoapHttpClientProtocol { private string DummySoapRequest = @"<?xml version=""1.0"" encoding=""utf-8""?> <soap:Envelope xmlns:soap=""http://schemas.xmlsoap.org/soap/envelope/"" xmlns:xsi=""http://www.w3.org/2001/XMLSchema-instance"" xmlns:xsd=""http://www.w3.org/2001/XMLSchema""> <soap:Body> <DummyOperation xmlns=""http://mynamespace.com""> </DummyOperation> </soap:Body> </soap:Envelope>"; public void SendDummyRequest() { System.Net.WebRequest req = GetWebRequest(new Uri(Url)); req.Headers.Add("SOAPAction", ""); req.ContentType = "text/xml;charset=\"utf-8\""; req.Method = "POST"; using (Stream stm = req.GetRequestStream()) { using (StreamWriter stmw = new StreamWriter(stm)) { stmw.Write(DummySoapRequest); } } System.Net.WebResponse response = req.GetResponse(); } }

    Read the article

  • How to handle window closed in the middle of a long running operation gracefully?

    - by Marek
    We have the following method called directly from the UI thread: void DoLengthyProcessing() { DoStuff(); var items = DoMoreStuff(); //do even more stuff - 200 lines of code trimmed this.someControl.PrepareForBigThing(); //someControl is a big user control //additional 100 lines of code that access this.someControl this.someControl.Finish(items); } Many of the called methods call Application.DoEvents() (and they do so many times) (do not ask me why, this is black magic written by black magic programmers and it can not be changed because everyone is scared what the impact would be) and there is also an operation running on a background thread involved in the processing. As a result, the window is not fully nonresponsive and can be closed manually during the processing. The Dispose method of the form "releases" the someControl variable by setting it to null. As a result, in case the user closes the window during the lengthy process, a null reference exception is thrown. How to handle this gracefully without just catching and logging the exception caused by disposal? Assigning the someControl instance to a temporary variable in the beginning of the method - but the control contains many subcontrols with similar disposal scheme - sets them to null and this causes null reference exceptions in other place put if (this.IsDisposed) return; calls before every access of the someControl variable. - making the already nasty long method even longer and unreadable. in Closing event, just indicate that we should close and only hide the window. Dispose it at the end of the lengthy operation. This is not very viable because there are many other methods involved (think 20K LOC for a single control) that would need to handle this mechanism as well. How to most effectively handle window disposal (by user action) in the middle of this kind of processing?

    Read the article

  • Consuming PHP webservice with .Net C#, error with array

    - by Faber
    I've a problem calling a PHP Web Service from .Net application. This is the XML response and I think there is a problem with the return node <?xml version="1.0" encoding="ISO-8859-1"?> <SOAP-ENV:Envelope SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/"> <SOAP-ENV:Body> <ns1:infoprodottoResponse xmlns:ns1="http://wan3.edc.it"> <result xsi:type="SOAP-ENC:Array" SOAP-ENC:arrayType=":[0]"></result> <error xsi:type="xsd:string">8u9lvDe3RBiGuXyL9lvM2tODlRMtcN77ya3S2LDEWEetBeRz/k4mXkK4hSqpgZOKilHYXgycj6Jtu8iBTfR1FQ==</error> <token xsi:type="xsd:string">5o58H00T96AWedhG1tnSc4xR+yXg7PQfQzXYVpri2AY=</token> </ns1:infoprodottoResponse> </SOAP-ENV:Body> In result node the SOAP-ENC:arrayType attribute hasn't declared the array type. The array type must be declare if the SOAP-ENC:arrayType is present, isn't it? It must be declared also if the array is empty?

    Read the article

  • Sql Server Replication: Snapshot vs Merge

    - by Zyphrax
    Background information Let's say I have two database servers, both SQL Server 2008. One is in my LAN (ServerLocal), the other one is on a remote hosting environment (ServerRemote). I have created a database on ServerLocal and have an exact copy of that database on ServerRemote. The database on ServerRemote is part of a web application and I would like to keep it's data up-to-date with the data in the database ServerLocal. ServerLocal is able to communicate with ServerRemote, this is one-way traffic. Communication from ServerRemote to ServerLocal isn't available. Current solution I thought it would be a nice solution to use replication. So I've made ServerLocal a publisher and subscriptions are pushed to the ServerRemote. This works fine, when a snapshot is transfered to ServerRemote the existing data will be purged and the ServerRemote database is once again an exact replica of the database on ServerLocal. The problem Records that exist on ServerRemote that don't exist on ServerLocal are removed. This doesn't matter for most of my tables but in some of my tables I'd like to keep the existing data (aspnet_users for instance), and update the records if necessary. What kind of replication fits my problem?

    Read the article

  • How to check at runtime if a class implements certain interface?

    - by mare
    Let's say I have some content classes like Page, TabGroup, Tab, etc. Certain of those will be implementing my IWidgetContainer interface - it means they will geet an additional field named ContainedItems from the interface and some methods for manipulating this field. Now I need to reflect the fact that some class implements this interface by rendering out some special custom controls in my ASP.NET MVC Views (like jQuery Add/Remove/Move/Reorder buttons). For instance, TabGroup will implement IWidgetContainer because it will contain tabs but a tab will not implement it because it won't have the ability to contain anything. So I have to somehow check in my view, when I render my content objects (The problem is, I use my base class as strong type in my view not concrete classes), whether it implements IWidgetContainer. How is that possible or have I completely missed something? To rephrase the question, how do you reflect some special properties of a class (like interface implementation) in the UI in general (not necessarily ASP.NET MVC)? Here's my code so far: [DataContract] public class ContentClass { [DataMember] public string Slug; [DataMember] public string Title; [DataMember] protected ContentType Type; } [DataContract] public class Group : ContentClass, IWidgetContainer { public Group() { Type = ContentType.TabGroup; } public ContentList ContainedItems { get; set; } public void AddContent(ContentListItem toAdd) { throw new NotImplementedException(); } public void RemoveContent(ContentListItem toRemove) { throw new NotImplementedException(); } } [DataContract] public class GroupElement : ContentClass { public GroupElement() { Type = ContentType.Tab; } } Interface: interface IWidgetContainer { [DataMember] ContentList ContainedItems { get; set; } void AddContent(ContentListItem toAdd); void RemoveContent(ContentListItem toRemove); }

    Read the article

  • PyGTK: Manually render an existing widget at a given Rectangle? (TextView in a custom CellRenderer)

    - by NicDumZ
    Hello! I am trying to draw a TextView into the cell of a TreeView. (Why? I would like to have custom tags on text, so they can be clickable and trigger different actions/popup menus depending on where user clicks). I have been trying to write a customized CellRenderer for this purpose, but so far I failed because I find it extremely difficult to find generic documentation on rendering design in gtk. More than an answer at the specific question (that might be hard/not doable, and I'm not expecting you to do everything for me), I am first looking for documentation on how a widget is rendered, to understand how one is supposed to implement a CellRenderer. Can you share any link that explains, either for gtk or for pygtk, the rendering mechanism? More specifically: size allocation mechanism (should I say protocol?). I understand that a window has a defined size, and then queries its children, saying "my size is w x h, what would be your ideal size, buddy?", and then sometimes shrinks children when all children cant fit together at their ideal sizes. Any specific documentation on that, and on particular on when this happens during rendering? How are rendered "builtin" widgets? What kind of methods do they call on Widget base class? On the parent Window? When? Do they use pango.Layout? can you manually draw a TextView onto a pango.Layout object? This link gives an interesting example showing how you can draw content in a pango.Layout object and use it in a CellRenderer. I guess that I could adapt it if only I understood how TextView widget are rendered. Or perhaps, to put it more simply: given an existing widget instance, how does one render it at a specific gdk.Rectangle? Thanks a lot.

    Read the article

  • objective-c having issues with an NSDictioary object

    - by Mark
    I have a simple iPhone app that Im learning and I want to have an instance variable called urlLists which is an NSDictionary I have declared it like so: @interface MyViewController : UIViewController <UIPickerViewDataSource, UIPickerViewDelegate>{ IBOutlet UIPickerView *pickerView; NSMutableArray *categories; NSDictionary *urlLists; } @property(retain) NSDictionary *urlLists; @end and in the implementation: @implementation MyViewController @synthesize urlLists; ... - (void)viewDidLoad { [super viewDidLoad]; categories = [[NSMutableArray alloc] init]; [categories addObject:@"Sport"]; [categories addObject:@"Entertainment"]; [categories addObject:@"Technology"]; [categories addObject:@"Political"]; NSArray *objects = [NSArray arrayWithObjects:@"value1", @"value2", @"value3", @"value4", nil]; urlLists = [NSDictionary dictionaryWithObjects:objects forKeys:categories]; for (id key in urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } ... @end And, this all works up to here. I have added a UIPicker to my app, and when I select one of the items, I want to Log the one picked and its related entry in my dictionary. -(void) pickerView:(UIPickerView *)thePickerView didSelectRow:(NSInteger)row inComponent:(NSInteger) component { for (id key in self.urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } but I get the old EXC_BAD_ACCESS error... I know Im missing something small, but what? Thanks

    Read the article

  • Is is possible to do an end-run around generics covariance in C# < 4 in this hypothetical situation?

    - by John Feminella
    Suppose I have a small inheritance hierarchy of Animals: public interface IAnimal { string Speak(); } public class Animal : IAnimal { public Animal() {} public string Speak() { return "[Animal] Growl!"; } } public class Ape : IAnimal { public string Speak() { return "[Ape] Rawrrrrrrr!"; } } public class Bat : IAnimal { public string Speak() { return "[Bat] Screeeeeee!"; } } Next, here's an interface offering a way to turn strings into IAnimals. public interface ITransmogrifier<T> where T : IAnimal { T Transmogrify(string s); } And finally, here's one strategy for doing that: public class Transmogrifier<T> : ITransmogrifier<T> where T : IAnimal, new() { public T Transmogrify(string s) { T t = default(T); if (typeof(T).Name == s) t = new T(); return t; } } Now, the question. Is it possible to replace the sections marked [1], [2], and [3] such that this program will compile and run correctly? If you can't do it without touching parts other than [1], [2], and [3], can you still get an IAnimal out of each instance of a Transmogrifier in a collection containing arbitrary implementations of an IAnimal? Can you even form such a collection to begin with? static void Main(string[] args) { var t = new Transmogrifier<Ape>(); Ape a = t.Transmogrify("Ape"); Console.WriteLine(a.Speak()); // Works! // But can we make an arbitrary collection of such animals? var list = new List<Transmogrifier< [1] >>() { // [2] }; // And how about we call Transmogrify() on each one? foreach (/* [3] */ transmogrifier in list) { IAnimal ia = transmogrifier.Transmogrify("Bat"); } } }

    Read the article

  • Scalability 101: How can I design a scalable web application using PHP?

    - by Legend
    I am building a web-application and have a couple of quick questions. From what I learnt, one should not worry about scalability when initially building the app and should only start worrying when the traffic increases. However, this being my first web-application, I am not quite sure if I should take an approach where I design things in an ad-hoc manner and later "fix" them. I have been reading stories about how people start off with an app that gets millions of users in a week or two. Not that I will face the same situation but I can't help but wonder, how do these people do it? Currently, I bought a shared hosting account on Lunarpages and that got me started in building and testing the application. However, I am interested in learning how to build the same application in a scalable-manner using the cloud, for instance, Amazon's EC2. From my understanding, I can see a couple of components: There is a load balancer that first receives requests and then decides where to route each request This request is then handled by a server replica that then processes the request and updates (if required) the database and sends back the response to the client If a similar request comes in, then a caching mechanism like memcached kicks into picture and returns objects from the cache A blackbox that handles database replication Specifically, I am trying to do the following: Setting up a load balancer (my homework revealed that HAProxy is one such load balancer) Setting up replication so that databases can be synchronized Using memcached Configuring Apache to work with multiple web servers Partitioning application to use Amazon EC2 and Amazon S3 (my application is something that will need great deal of storage) Finally, how can I avoid burning myself when using Amazon services? Because this is just a learning phase, I can probably do with 2-3 servers with a simple load balancer and replication but until I want to avoid paying loads of money accidentally. I am able to find resources on individual topics but am unable to find something that starts off from the big picture. Can someone please help me get started?

    Read the article

  • Pattern for version-specific implementations of a Java class

    - by Mike Monkiewicz
    So here's my conundrum. I am programming a tool that needs to work on old versions of our application. I have the code to the application, but can not alter any of the classes. To pull information out of our database, I have a DTO of sorts that is populated by Hibernate. It consumes a data object for version 1.0 of our app, cleverly named DataObject. Below is the DTO class. public class MyDTO { private MyWrapperClass wrapper; public MyDTO(DataObject data) { wrapper = new MyWrapperClass(data); } } The DTO is instantiated through a Hibernate query as follows: select new com.foo.bar.MyDTO(t1.data) from mytable t1 Now, a little logic is needed on top of the data object, so I made a wrapper class for it. Note the DTO stores an instance of the wrapper class, not the original data object. public class MyWrapperClass { private DataObject data; public MyWrapperClass(DataObject data) { this.data = data; } public String doSomethingImportant() { ... version-specific logic ... } } This works well until I need to work on version 2.0 of our application. Now DataObject in the two versions are very similar, but not the same. This resulted in different sub classes of MyWrapperClass, which implement their own version-specific doSomethingImportant(). Still doing okay. But how does myDTO instantiate the appropriate version-specific MyWrapperClass? Hibernate is in turn instantiating MyDTO, so it's not like I can @Autowire a dependency in Spring. I would love to reuse MyDTO (and my dozens of other DTOs) for both versions of the tool, without having to duplicate the class. Don't repeat yourself, and all that. I'm sure there's a very simple pattern I'm missing that would help this. Any suggestions?

    Read the article

  • Automatically creating DynaActionForms in Mockrunner via struts-config.xml

    - by T Reddy
    I'm switching from MockStrutsTestCase to Mockrunner and I'm finding that having to manually re-create all of my DynaActionForms in Mockrunner is a pain...there has to be an easier way?! Can somebody offer a tip to simplify this process? For instance, this form bean definition in struts-config.xml: <form-bean name="myForm" type="org.apache.struts.action.DynaActionForm"> <form-property name="property" type="java.lang.String"/> </form-bean> results in this code in Mockrunner: //define form config FormBeanConfig config = new FormBeanConfig(); config.setName("myForm"); config.setType(DynaActionForm.class.getName()); FormPropertyConfig property = new FormPropertyConfig(); property.setName("property"); property.setType("java.lang.String"); config.addFormPropertyConfig(property); //create mockrunner objects ActionMockObjectFactory factory = new ActionMockObjectFactory(); ActionTestModule module = new ActionTestModule(factory); DynaActionForm form = module.createDynaActionForm(config); Now imagine that I have dozens of DynaActionForms with dozens of attributes...that stinks!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Inversion of control domain objects construction problem

    - by Andrey
    Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

    Read the article

  • Random number generation in MVC applications

    - by SlimShaggy
    What is the correct way of generating random numbers in an ASP.NET MVC application if I need exactly one number per request? According to MSDN, in order to get randomness of sufficient quality, it is necessary to generate multiple numbers using a single System.Random object, created once. Since a new instance of a controller class is created for each request in MVC, I cannot use a private field initialized in the controller's constructor for the Random object. So in what part of the MVC app should I create and store the Random object? Currently I store it in a static field of the controller class and lazily initialize it in the action method that uses it: public class HomeController : Controller { ... private static Random random; ... public ActionResult Download() { ... if (random == null) random = new Random(); ... } } Since the "random" field can be accessed by multiple instances of the controller class, is it possible for its value to become corrupted if two instances attempt to initialize it simultaneously? And one more question: I know that the lifetime of statics is the lifetime of the application, but in case of an MVC app what is it? Is it from IIS startup till IIS shutdown?

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Contrary to Python 3.1 Docs, hash(obj) != id(obj). So which is correct?

    - by Don O'Donnell
    The following is from the Python v3.1.2 documentation: From The Python Language Reference Section 3.3.1 Basic Customization: object.__hash__(self) ... User-defined classes have __eq__() and __hash__() methods by default; with them, all objects compare unequal (except with themselves) and x.__hash__() returns id(x). From The Glossary: hashable ... Objects which are instances of user-defined classes are hashable by default; they all compare unequal, and their hash value is their id(). This is true up through version 2.6.5: Python 2.6.5 (r265:79096, Mar 19 2010 21:48:26) ... ... >>> class C(object): pass ... >>> c = C() >>> id(c) 11335856 >>> hash(c) 11335856 But in version 3.1.2: Python 3.1.2 (r312:79149, Mar 21 2010, 00:41:52) ... ... >>> class C: pass ... >>> c = C() >>> id(c) 11893680 >>> hash(c) 743355 So which is it? Should I report a documentation bug or a program bug? And if it's a documentation bug, and the default hash() value for a user class instance is no longer the same as the id() value, then it would be interesting to know what it is or how it is calculated, and why it was changed in version 3.

    Read the article

  • How do you calculate div and mod of floating point numbers?

    - by boost
    In Perl, the % operator seems to assume integers. For instance: sub foo { my $n1 = shift; my $n2 = shift; print "perl's mod=" . $n1 % $n2, "\n"; my $res = $n1 / $n2; my $t = int($res); print "my div=$t", "\n"; $res = $res - $t; $res = $res * $n2; print "my mod=" . $res . "\n\n"; } foo( 3044.952963, 7.1 ); foo( 3044.952963, -7.1 ); foo( -3044.952963, 7.1 ); foo( -3044.952963, -7.1 ); gives perl's mod=6 my div=428 my mod=6.15296300000033 perl's mod=-1 my div=-428 my mod=6.15296300000033 perl's mod=1 my div=-428 my mod=-6.15296300000033 perl's mod=-6 my div=428 my mod=-6.15296300000033 Now as you can see, I've come up with a "solution" already for calculating div and mod. However, what I don't understand is what effect the sign of each argument should have on the result. Wouldn't the div always be positive, being the number of times n2 fits into n1? How's the arithmetic supposed to work in this situation?

    Read the article

< Previous Page | 502 503 504 505 506 507 508 509 510 511 512 513  | Next Page >