Search Results

Search found 14799 results on 592 pages for 'instance eval'.

Page 506/592 | < Previous Page | 502 503 504 505 506 507 508 509 510 511 512 513  | Next Page >

• Problem inserting Pygames on a wxPython panel using Boa Constructor

  - by Kohwalter

  Hello, im new in Python so im hoping to to get some help to figure out what is going wrong. Im trying to run a Pygames from within wxPython panel (made on Boa Constructor). To do that i followed the instructions on the http://wiki.wxpython.org/IntegratingPyGame but still it isn't working. Here is the Panel code that was used to make the integration: class PG_panel(wx.Panel): def __init__(self, ID, name, parent, mypos, mysize): # pygame is imported in this class # make it globally available global pygame #self.Fit() wx.Panel.__init__(self, id=wxID_FRMMAINPANELTABULEIRO, name='panelTabuleiro', parent=self, pos=(16, 96), size=mysize) # pygame uses SDL, set the environment variables os.environ['SDL_WINDOWID'] = str(self.GetHandle()) os.environ['SDL_VIDEODRIVER'] = 'windib' # do the pygame stuff after setting the environment variables import pygame pygame.display.init() # create the pygame window/screen screen = pygame.display.set_mode(464, 464) #(424,450) # start the thread instance self.thread = PG_thread(screen) self.thread.start() def __del__(self): self.thread.stop() And im trying to use that panel on an interface from Boa Constructor, here is the code: class frmMain(wx.Frame): def _init_ctrls(self, prnt): # generated method, don't edit wx.Frame.__init__(self, id=wxID_FRMMAIN, name='frmMain', parent=prnt, pos=wx.Point(660, 239), size=wx.Size(815, 661), style=wx.DEFAULT_FRAME_STYLE, title='Grupo 1 - Jogo de Damas') self._init_utils() self.SetClientSize(wx.Size(799, 623)) self.SetBackgroundColour(wx.Colour(225, 225, 225)) self.SetMinSize(wx.Size(784, 650)) self.Center(wx.BOTH) self.SetMenuBar(self.menuBar1) #here begins my code mysize = (464, 464) mypos = (16, 96) self.panelTabuleiro = PG_panel(wxID_FRMMAINPANELTABULEIRO, 'panelTabuleiro', self, mypos, mysize) The original that was auto-made by the Boa Constructor is the following: self.panelTabuleiro = wx.Panel(id=wxID_FRMMAINPANELTABULEIRO, name='panelTabuleiro', parent=self, pos=wx.Point(16, 96), size=wx.Size(464, 464), style=wx.TAB_TRAVERSAL) self.panelTabuleiro.SetBackgroundColour(wx.Colour(232, 249, 240)) self.panelTabuleiro.SetThemeEnabled(True) self.panelTabuleiro.SetHelpText('Tabuleiro') The error that it gives is: Type error: in method 'new_Panel', expected argument 1 of type 'wxWindow*1 Exception AttributeError: "'PG_panel' object has no attribute 'thread' in ignored Any thoughts ? I appreciate any help. Thank you.

  Read the article

• MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

  - by user768113

  I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

  Read the article

• Java reflection appropriateness

  - by jsn

  This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

  Read the article

• WPF ObservableCollection in xaml

  - by Cloverness

  Hi, I have created an ObservableCollection in the code behind of a user control. It is created when the window loads: private void UserControl_Loaded(object sender, RoutedEventArgs e) { Entities db = new Entities(); ObservableCollection<Image> _imageCollection = new ObservableCollection<Image>(); IEnumerable<library> libraryQuery = from c in db.ElectricalLibraries select c; foreach (ElectricalLibrary c in libraryQuery) { Image finalImage = new Image(); finalImage.Width = 80; BitmapImage logo = new BitmapImage(); logo.BeginInit(); logo.UriSource = new Uri(c.url); logo.EndInit(); finalImage.Source = logo; _imageCollection.Add(finalImage); } } I need to get the ObservableCollection of images which are created based on the url saved in a database. But I need a ListView or other ItemsControl to bind to it in XAML file like this: But I can't figure it out how to pass the ObservableCollection to the ItemsSource of that control. I tried to create a class and then create an instance of a class in xaml file but it did not work. Should I create a static resource somehow Any help will be greatly appreciated.

  Read the article

• Read from plist insted of Code array

  - by BoSoud

  Hi Guys am Using [URL="http://www.iphonesdkarticles.com/2009/01/uitableview-searching-table-view.html"]UITableView - Searching table view[/URL] its really nice easy tutorial but i really have bad time try to read from plist that what i did change - (void)viewDidLoad { [super viewDidLoad]; //Initialize the array. listOfItems = [[NSMutableArray alloc] init]; TableViewAppDelegate *AppDelegate = (TableViewAppDelegate *)[[UIApplication sharedApplication] delegate]; listOfItems = [AppDelegate.data objectForKey:@"Countries"]; //Initialize the copy array. copyListOfItems = [[NSMutableArray alloc] init]; //Set the title self.navigationItem.title = @"Countries"; //Add the search bar self.tableView.tableHeaderView = searchBar; searchBar.autocorrectionType = UITextAutocorrectionTypeNo; searching = NO; letUserSelectRow = YES; } and This How i read plist from My AppDelegate.m - (void)applicationDidFinishLaunching:(UIApplication *)application { NSString *Path = [[NSBundle mainBundle] bundlePath]; NSString *DataPath = [Path stringByAppendingPathComponent:@"Data.plist"]; NSDictionary *tempDict = [[NSDictionary alloc] initWithContentsOfFile:DataPath]; self.data = tempDict; [tempDict release]; // Configure and show the window [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } and this my plist <plist version="1.0"> <dict> <key>Countries</key> <array> <array> <string>USA</string> </array> <dict/> </array> </dict> </plist> and i get this error *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFArray objectForKey:]: unrecognized selector sent to instance 0x1809dc0' help please am stock with this

  Read the article

• Random number generation in MVC applications

  - by SlimShaggy

  What is the correct way of generating random numbers in an ASP.NET MVC application if I need exactly one number per request? According to MSDN, in order to get randomness of sufficient quality, it is necessary to generate multiple numbers using a single System.Random object, created once. Since a new instance of a controller class is created for each request in MVC, I cannot use a private field initialized in the controller's constructor for the Random object. So in what part of the MVC app should I create and store the Random object? Currently I store it in a static field of the controller class and lazily initialize it in the action method that uses it: public class HomeController : Controller { ... private static Random random; ... public ActionResult Download() { ... if (random == null) random = new Random(); ... } } Since the "random" field can be accessed by multiple instances of the controller class, is it possible for its value to become corrupted if two instances attempt to initialize it simultaneously? And one more question: I know that the lifetime of statics is the lifetime of the application, but in case of an MVC app what is it? Is it from IIS startup till IIS shutdown?

  Read the article

• Inversion of control domain objects construction problem

  - by Andrey

  Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

  Read the article

• WP7 - Cancelling ContextMenu click event propagation

  - by Praetorian

  I'm having a problem when the Silverlight toolkit's ContextMenu is clicked while it is over a UIElement that has registered a Tap event GestureListener. The context menu click propagates to the underlying element and fires its tap event. For instance, say I have a ListBox and each ListBoxItem within it has registered both a ContextMenu and a Tap GestureListener. Assume that clicking context menu item2 is supposed to take you to Page1.xaml, while tapping on any of ListBox items themselves is supposed to take you to Page2.xaml. If I open the context menu on item1 in the ListBox, then context menu item2 is on top of ListBox item2. When I click on context menu item2 I get weird behavior where the app navigates to Page1.xaml and then immediately to Page2.xaml because the click event also triggered the Tap gesture for ListBox item2. I've verified in the debugger that it is always the context menu that receives the click event first. How do I cancel the context menu item click's routed event propagation so it doesn't reach ListBox item2? Thanks for your help!

  Read the article

• Retrieving a unique result set with Core Data

  - by randombits

  I have a core data based app that manages a bunch of entities. I'm looking to be able to do the following. I have an entity "SomeEntity" with the attributes: name, type, rank, foo1, foo2. Now, SomeEntity has several rows if when we're speaking strictly in SQL terms. What I'm trying to accomplish is to retrieve only available types, even though each instance can have duplicate types. I also need them returned in order according to rank. So in SQL, what I'm looking for is the following: SELECT DISTINCT(type) ORDER BY rank ASC Here is the code I have so far that's breaking: NSError *error = NULL; NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; [fetchRequest setReturnsDistinctResults:YES]; [fetchRequest setPropertiesToFetch:[NSArray arrayWithObjects:@"type", @"rank", nil]]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SomeEntity" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // sort by rank NSSortDescriptor *rankDescriptor = [[NSSortDescriptor alloc] initWithKey:@"rank" ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:rankDescriptor,nil]; [fetchRequest setSortDescriptors:sortDescriptors]; [sortDescriptors release]; [rankDescriptor release]; NSArray *fetchResults = [managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; return fetchResults; Right now that is crashing with the following: Invalid keypath section passed to setPropertiesToFetch:

  Read the article

• Automatically creating DynaActionForms in Mockrunner via struts-config.xml

  - by T Reddy

  I'm switching from MockStrutsTestCase to Mockrunner and I'm finding that having to manually re-create all of my DynaActionForms in Mockrunner is a pain...there has to be an easier way?! Can somebody offer a tip to simplify this process? For instance, this form bean definition in struts-config.xml: <form-bean name="myForm" type="org.apache.struts.action.DynaActionForm"> <form-property name="property" type="java.lang.String"/> </form-bean> results in this code in Mockrunner: //define form config FormBeanConfig config = new FormBeanConfig(); config.setName("myForm"); config.setType(DynaActionForm.class.getName()); FormPropertyConfig property = new FormPropertyConfig(); property.setName("property"); property.setType("java.lang.String"); config.addFormPropertyConfig(property); //create mockrunner objects ActionMockObjectFactory factory = new ActionMockObjectFactory(); ActionTestModule module = new ActionTestModule(factory); DynaActionForm form = module.createDynaActionForm(config); Now imagine that I have dozens of DynaActionForms with dozens of attributes...that stinks!

  Read the article

• Pattern for version-specific implementations of a Java class

  - by Mike Monkiewicz

  So here's my conundrum. I am programming a tool that needs to work on old versions of our application. I have the code to the application, but can not alter any of the classes. To pull information out of our database, I have a DTO of sorts that is populated by Hibernate. It consumes a data object for version 1.0 of our app, cleverly named DataObject. Below is the DTO class. public class MyDTO { private MyWrapperClass wrapper; public MyDTO(DataObject data) { wrapper = new MyWrapperClass(data); } } The DTO is instantiated through a Hibernate query as follows: select new com.foo.bar.MyDTO(t1.data) from mytable t1 Now, a little logic is needed on top of the data object, so I made a wrapper class for it. Note the DTO stores an instance of the wrapper class, not the original data object. public class MyWrapperClass { private DataObject data; public MyWrapperClass(DataObject data) { this.data = data; } public String doSomethingImportant() { ... version-specific logic ... } } This works well until I need to work on version 2.0 of our application. Now DataObject in the two versions are very similar, but not the same. This resulted in different sub classes of MyWrapperClass, which implement their own version-specific doSomethingImportant(). Still doing okay. But how does myDTO instantiate the appropriate version-specific MyWrapperClass? Hibernate is in turn instantiating MyDTO, so it's not like I can @Autowire a dependency in Spring. I would love to reuse MyDTO (and my dozens of other DTOs) for both versions of the tool, without having to duplicate the class. Don't repeat yourself, and all that. I'm sure there's a very simple pattern I'm missing that would help this. Any suggestions?

  Read the article

• objective-c having issues with an NSDictioary object

  - by Mark

  I have a simple iPhone app that Im learning and I want to have an instance variable called urlLists which is an NSDictionary I have declared it like so: @interface MyViewController : UIViewController <UIPickerViewDataSource, UIPickerViewDelegate>{ IBOutlet UIPickerView *pickerView; NSMutableArray *categories; NSDictionary *urlLists; } @property(retain) NSDictionary *urlLists; @end and in the implementation: @implementation MyViewController @synthesize urlLists; ... - (void)viewDidLoad { [super viewDidLoad]; categories = [[NSMutableArray alloc] init]; [categories addObject:@"Sport"]; [categories addObject:@"Entertainment"]; [categories addObject:@"Technology"]; [categories addObject:@"Political"]; NSArray *objects = [NSArray arrayWithObjects:@"value1", @"value2", @"value3", @"value4", nil]; urlLists = [NSDictionary dictionaryWithObjects:objects forKeys:categories]; for (id key in urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } ... @end And, this all works up to here. I have added a UIPicker to my app, and when I select one of the items, I want to Log the one picked and its related entry in my dictionary. -(void) pickerView:(UIPickerView *)thePickerView didSelectRow:(NSInteger)row inComponent:(NSInteger) component { for (id key in self.urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } but I get the old EXC_BAD_ACCESS error... I know Im missing something small, but what? Thanks

  Read the article

• Using static variables for Strings

  - by Vivart

  below content is taken from Best practice: Writing efficient code but i didn't understand why private static String x = "example"; faster than private static final String x ="example"; Can anybody explain this. Using static variables for Strings When you define static fields (also called class fields) of type String, you can increase application speed by using static variables (not final) instead of constants (final). The opposite is true for primitive data types, such as int. For example, you might create a String object as follows: private static final String x = "example"; For this static constant (denoted by the final keyword), each time that you use the constant, a temporary String instance is created. The compiler eliminates "x" and replaces it with the string "example" in the bytecode, so that the BlackBerry® Java® Virtual Machine performs a hash table lookup each time that you reference "x". In contrast, for a static variable (no final keyword), the String is created once. The BlackBerry JVM performs the hash table lookup only when it initializes "x", so access is faster. private static String x = "example"; You can use public constants (that is, final fields), but you must mark variables as private.

  Read the article

• How to make Spring load a JDBC Driver BEFORE initializing Hibernate's SessionFactory?

  - by Bill_BsB

  I'm developing a Spring(2.5.6)+Hibernate(3.2.6) web application to connect to a custom database. For that I have custom JDBC Driver and Hibernate Dialect. I know for sure that these custom classes work (hard coded stuff on my unit tests). The problem, I guess, is with the order on which things get loaded by Spring. Basically: Custom Database initializes Spring load beans from web.xml Spring loads ServletBeans(applicationContext.xml) Hibernate kicks in: shows version and all the properties correctly loaded. Hibernate's HbmBinder runs (maps all my classes) LocalSessionFactoryBean - Building new Hibernate SessionFactory DriverManagerConnectionProvider - using driver: MyCustomJDBCDriver at CustomDBURL I get a SQLException: No suitable driver found for CustomDBURL Hibernate loads the Custom Dialect My CustomJDBCDriver finally gets registered with DriverManager (log messages) SettingsFactory runs SchemaExport runs (hbm2ddl) I get a SQLException: No suitable driver found for CustomDBURL (again?!) Application get successfully deployed but there are no tables on my custom Database. Things that I tried so far: Different techniques for passing hibernate properties: embedded in the 'sessionFactory' bean, loaded from a hibernate.properties file. Nothing worked but I didn't try with hibernate.cfg.xml file neither with a dataSource bean yet. MyCustomJDBCDriver has a static initializer block that registers it self with the DriverManager. Tried different combinations of lazy initializing (lazy-init="true") of the Spring beans but nothing worked. My custom JDBC driver should be the first thing to be loaded - not sure if by Spring but...! Can anyone give me a solution for this or maybe a hint for what else I could try? I can provide more details (huge stack traces for instance) if that helps. Thanks in advance.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Move SELECT to SQL Server side

  - by noober

  Hello all, I have an SQLCLR trigger. It contains a large and messy SELECT inside, with parts like: (CASE WHEN EXISTS(SELECT * FROM INSERTED I WHERE I.ID = R.ID) THEN '1' ELSE '0' END) AS IsUpdated -- Is selected row just added? as well as JOINs etc. I like to have the result as a single table with all included. Question 1. Can I move this SELECT to SQL Server side? If yes, how to do this? Saying "move", I mean to create a stored procedure or something else that can be executed before reading dataset in while cycle. The 2 following questions make sense only if answer is "yes". Why do I want to move SELECT? First off, I don't like mixing SQL with C# code. At second, I suppose that server-side queries run faster, since the server have more chances to cache them. Question 2. Am I right? Is it some sort of optimizing? Also, the SELECT contains constant strings, but they are localizable. For instance, WHERE R.Status = "Enabled" "Enabled" should be changed for French, German etc. So, I want to write 2 static methods -- OnCreate and OnDestroy -- then mark them as stored procedures. When registering/unregistering my assembly on server side, just call them respectively. In OnCreate format the SELECT string, replacing {0}, {1}... with required values from the assembly resources. Then I can localize resources only, not every script. Question 3. Is it good idea? Is there an existing attribute to mark methods to be executed by SQL Server automatically after (un)registartion an assembly? Regards,

  Read the article

• Mercurial Subrepos, how to control which changeset I want to use for a subrepo?

  - by Lasse V. Karlsen

  I am reading up on subrepos, and have been running some tests locally, seems to work OK so far, but I have one question. How do I specify/control which changeset I want to use for a particular subrepo? For instance, let's say I have the following two projects: class library application o fourth commit o second commit, added a feature | | o third commit o initial commit | | o second commit |/ o initial commit Now, I want the class library as a subrepo of my application, but due to the immaturity of the longest branch (the one ending up as fourth commit), I want to temporarily use the "second commit" tip. How do I go about configuring that, assuming it is even possible? Here's a batch file that sets up the above two repos + adds the library as a subrepo. If you run the batch file, it will output: [C:\Temp] :test ... v4 As you can see from that last line there, it verifies the contents of the file in the class library, which is "v4" from the fourth commit. I'd like it to be "v2", and persist as "v2" until I'm ready to pull down a newer version from the class library repository. Can anyone tell me if it is possible to do what I want, and if so, what I need to do in order to lock my subrepo to the right changeset? Batch-file: @echo off if exist app rd /s /q app if exist lib rd /s /q lib if exist app-clone rd /s /q app-clone rem == app == hg init app cd app echo program>main.txt hg add main.txt hg commit -m "initial commit" echo program+feature1>main.txt hg commit -m "second commit, added a feature" cd .. rem == lib == hg init lib cd lib echo v1>lib.txt hg add lib.txt hg commit -m "initial commit" echo v2>lib.txt hg commit -m "second commit" hg update 0 echo v3>lib.txt hg commit -m "third commit" echo v4>lib.txt hg commit -m "fourth commit" cd .. rem == subrepos == cd app hg clone ..\lib lib echo lib = ..\lib >.hgsub hg add .hgsub hg commit -m "added subrepo" cd .. rem == clone == hg clone app app-clone type app-clone\lib\lib.txt

  Read the article

• Best way to organize a Go interface

  - by Metropolis

  Hey Everyone, Its been a long time since I have programmed in C++, and if I remember correctly the best way to organize classes was to create your class in the .h file, and then your implementation in your .cpp file. Well I am trying to learn Go now and I was reading over the Go for C++ Programmers article when I came upon interfaces. The article explains that interfaces in Go essentially take the place of classes, and shows how to set them up pretty well. What I am trying to figure out though is how should I organize an interface into files? For instance, should the interface be in one file while the implementation is in another? myInterface.go type myInterface interface { get() int set(i int) } myImplementation.go type myType struct { i int } func (p *myType) set(i int) { p.i = i } func (p *myType) get() int { return p.i } My code here may be wrong since I do not completely know what I am doing yet (and if I am wrong please correct me), but would this be the best way to set this up? Im having a very hard time trying to wrap my head around how to organize code in Go so any help is appreciated! Metropolis

  Read the article

• Catch a PHP Object Instantiation Error

  - by Rob Wilkerson

  It's really irking me that PHP considers the failure to instantiate an object a Fatal Error (which can't be caught) for the application as a whole. I have set of classes that aren't strictly necessary for my application to function--they're really a convenience. I have a factory object that attempts to instantiate the class variant that's indicated in a config file. This mechanism is being deployed for message storage and will support multiple store types: DatabaseMessageStore FileMessageStore MemcachedMessageStore etc. A MessageStoreFactory class will read the application's preference from a config file, instantiate and return an instance of the appropriate class. It might be easy enough to slap a conditional around the instantiation to ensure that class_exists(), but MemcachedMessageStore extends PHP's Memcached class. As a result, the class_exists() test will succeed--though instantiation will fail--if the memcached bindings for PHP aren't installed. Is there any other way to test whether a class can be instantiated properly? If it can't, all I need to do is tell the user which features won't be available to them, but let them continue one with the application. Thanks.

  Read the article

• Short snippet summarizing a webpage?

  - by Legend

  Is there a clean way of grabbing the first few lines of a given link that summarizes that link? I have seen this being done in some online bookmarking applications but have no clue on how they were implemented. For instance, if I give this link, I should be able to get a summary which is roughly like: I'll admit it, I was intimidated by MapReduce. I'd tried to read explanations of it, but even the wonderful Joel Spolsky left me scratching my head. So I plowed ahead trying to build decent pipelines to process massive amounts of data Nothing complex at first sight but grabbing these is the challenging part. Just the first few lines of the actual post should be fine. Should I just use a raw approach of grabbing the entire html and parsing the meta tags or something fancy like that (which obviously and unfortunately is not generalizable to every link out there) or is there a smarter way to achieve this? Any suggestions? Update: I just found InstaPaper do this but am not sure if it is getting the information from RSS feeds or some other way.

  Read the article

• Can't store UTF-8 in RDS despite setting up new Parameter Group using Rails on Heroku

  - by Lail

  I'm setting up a new instance of a Rails(2.3.5) app on Heroku using Amazon RDS as the database. I'd like to use UTF-8 for everything. Since RDS isn't UTF-8 by default, I set up a new Parameter Group and switched the database to use that one, basically per this. Seems to have worked: SHOW VARIABLES LIKE '%character%'; character_set_client utf8 character_set_connection utf8 character_set_database utf8 character_set_filesystem binary character_set_results utf8 character_set_server utf8 character_set_system utf8 character_sets_dir /rdsdbbin/mysql-5.1.50.R3/share/mysql/charsets/ Furthermore, I've successfully setup Heroku to use the RDS database. After rake db:migrate, everything looks good: CREATE TABLE `comments` ( `id` int(11) NOT NULL AUTO_INCREMENT, `commentable_id` int(11) DEFAULT NULL, `parent_id` int(11) DEFAULT NULL, `content` text COLLATE utf8_unicode_ci, `child_count` int(11) DEFAULT '0', `created_at` datetime DEFAULT NULL, `updated_at` datetime DEFAULT NULL, PRIMARY KEY (`id`), KEY `commentable_id` (`commentable_id`), KEY `index_comments_on_community_id` (`community_id`), KEY `parent_id` (`parent_id`) ) ENGINE=InnoDB AUTO_INCREMENT=4 DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci; In the markup, I've included: <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> Also, I've set: production: encoding: utf8 collation: utf8_general_ci ...in the database.yml, though I'm not very confident that anything is being done to honor any of those settings in this case, as Heroku seems to be doing its own config when connecting to RDS. Now, I enter a comment through the form in the app: "Úbe® ƒåiL", but in the database I've got "Úbe® Æ’Ã¥iL" It looks fine when Rails loads it back out of the database and it is rendered to the page, so whatever it is doing one way, it's undoing the other way. If I look at the RDS database in Sequel Pro, it looks fine if I set the encoding to "UTF-8 Unicode via Latin 1". So it seems Latin-1 is sneaking in there somewhere. Somebody must have done this before, right? What am I missing?

  Read the article

• Java: Typecasting to Generics

  - by bguiz

  This method that uses method-level generics, that parses the values from a custom POJO, JXlistOfKeyValuePairs (which is exactly that). The only thing is that both the keys and values in JXlistOfKeyValuePairs are Strings. This method wants to taken in, in addition to the JXlistOfKeyValuePairs instance, a Class<T> that defines which data type to convert the values to (assume that only Boolean, Integer and Float are possible). It then outputs a HashMap with the specified type for the values in its entries. This is the code that I have got, and it is obviously broken. private <T extends Object> Map<String, T> fromListOfKeyValuePairs(JXlistOfKeyValuePairs jxval, Class<T> clasz) { Map<String, T> val = new HashMap<String, T>(); List<Entry> jxents = jxval.getEntry(); T value; String str; for (Entry jxent : jxents) { str = jxent.getValue(); value = null; if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } else if (clasz.isAssignableFrom(Float.class)) { value = (T)(Float.parseFloat(str)); } else { logger.warn("Unsupported value type encountered in key-value pairs, continuing anyway: " + clasz.getName()); } val.put(jxent.getKey(), value); } return val; } This is the bit that I want to solve: if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } I get: Inconvertible types required: T found: Boolean Also, if possible, I would like to be able to do this with more elegant code, avoiding Class#isAssignableFrom. Any suggestions? Sample method invocation: Map<String, Boolean> foo = fromListOfKeyValuePairs(bar, Boolean.class);

  Read the article

• SQL Server 2008 - Full Text Query

  - by user208662

  Hello, I have two tables in a SQL Server 2008 database in my company. The first table represents the products that my company sells. The second table contains the product manufacturer’s details. These tables are defined as follows: Product ------- ID Name ManufacturerID Description Manufacturer ------------ ID Name As you can imagine, I want to make this as easy as possible for our customers to query this data. However, I’m having problems writing a forgiving, yet powerful search query. For instance, I’m anticipating people to search based on phonetical spellings. Because of this, the data may not match the exact data in my database. In addition, I think some individuals will search by manufacturer’s name first, but I want the matching product names to appear first. Based on these requirements, I’m currently working on the following query: select p.Name as 'ProductName', m.Name as 'Manufacturer', r.Rank as 'Rank' from Product p inner join Manufacturer m on p.ManufacturerID=m.ID inner join CONTAINSTABLE(Product, Name, @searchQuery) as r Oddly, this query is throwing an error. However, I have no idea why. Squiggles appear to the right of the last parenthesis in management studio. The tool tip says "An expression of non-boolean type specified in a context where a condition is expected". I understand what this statement means. However, I guess I do not know how COntainsTable works. What am I doing wrong? Thank you

  Read the article

• How can I find the common ancestor of two nodes in a binary tree?

  - by Siddhant

  The Binary Tree here is not a Binary Search Tree. Its just a Binary Tree. The structure could be taken as - struct node { int data; struct node *left; struct node *right; }; The maximum solution I could work out with a friend was something of this sort - Consider this binary tree (from http://lcm.csa.iisc.ernet.in/dsa/node87.html) : The inorder traversal yields - 8, 4, 9, 2, 5, 1, 6, 3, 7 And the postorder traversal yields - 8, 9, 4, 5, 2, 6, 7, 3, 1 So for instance, if we want to find the common ancestor of nodes 8 and 5, then we make a list of all the nodes which are between 8 and 5 in the inorder tree traversal, which in this case happens to be [4, 9, 2]. Then we check which node in this list appears last in the postorder traversal, which is 2. Hence the common ancestor for 8 and 5 is 2. The complexity for this algorithm, I believe is O(n) (O(n) for inorder/postorder traversals, the rest of the steps again being O(n) since they are nothing more than simple iterations in arrays). But there is a strong chance that this is wrong. :-) But this is a very crude approach, and I'm not sure if it breaks down for some case. Is there any other (possibly more optimal) solution to this problem?

  Read the article

• Java constructor using generic types

  - by Beer Me

  I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method breweryMethod() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // breweryMethod() is an instance method // of Brewery, of which <T> is a subclass (right?) c.breweryMethod(); // "The method breweryMethod() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void brewerySubClassMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

  Read the article

< Previous Page | 502 503 504 505 506 507 508 509 510 511 512 513  | Next Page >