Search Results

Search found 23754 results on 951 pages for 'unobtrusive javascript'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 631/951 | < Previous Page | 627 628 629 630 631 632 633 634 635 636 637 638  | Next Page >

  • How to get parallel behavior in Java Script ?

    - by Biswanath
    More or less I want to execute two functions in parallel. One way as I see is doing through SetTimeOut function. I have not completely gone through the ReactiveExentension, although it looks promising but may be overkill for my needs. Is there any framework which supports parallelism ? My use case is trivial, but I would like to know if anybody heavily needed parallelism in Java Script ? Thanks, Biswanath.

    Read the article

  • allignment issue of div tag

    - by Quasar the space thing
    I am trying to create a web page where on click of a button I can add div tags. What I thought to do was that I'll create two div tags within a single div so that over all presentation will be uniform and similar to a table having two columns and multiple rows and the first column contains only label's and second column will contain textbox. Here is the JS file : var counter = 0; function create_div(type){ var dynDiv = document.createElement("div"); dynDiv.id = "divid_"+counter; dynDiv.class="main"; document.body.appendChild(dynDiv); question(); if(type == 'ADDTEXTBOX'){ ADDTEXTBOX(); } counter=counter+1; } function question(){ var question_div = document.createElement("div"); question_div.class="question"; question_div.id = "question_div_"+counter; var Question = prompt("Enter The Question here:", ""); var node=document.createTextNode(Question); question_div.appendChild(node); var element=document.getElementById("divid_"+counter); element.appendChild(question_div); } function ADDTEXTBOX(){ var answer_div = document.createElement("div"); answer_div.class="answer"; answer_div.id = "answer_div_"+counter; var answer_tag = document.createElement("input"); answer_tag.id = "answer_tag_"+counter; answer_tag.setAttribute("type", "text"); answer_tag.setAttribute("name", "textbox"); answer_div.appendChild(answer_tag); var element=document.getElementById("divid_"+counter); element.appendChild(answer_div); } Here is the css file : .question { width: 40%; height: auto; float: left; display: inline-block; text-align: justify; word-wrap:break-word; } .answer { padding-left:10%; width: 40%; height: auto; float: left; overflow: auto; word-wrap:break-word; } .main { width: auto; background-color:gray; height: auto; overflow: auto; word-wrap:break-word; } My problem is that the code is working properly but both the divisions are not coming in a straight line. after the first div prints on the screen the second divisions comes in another line. How can I make both the div's come in the same line ? Thank You. PS : should I stick with the current idea of using div or should I try some other approach ? like tables ?

    Read the article

  • table sorting, paginating script problem

    - by Syom
    i'm trying to find table sorting and paginating script, and i've found a good one, but there is some problem i can't understand anyway. look at demo please the pagination must be in the center, but in IE it on the left side. i've download the script and try to correct it, but i can't. maybe you can understand what is the problem, or maybe can give the link on another such script, which works on all browsers. thanks

    Read the article

  • Pulling .live() functionality out of jQuery

    - by Daniel
    I am writing a Firefox Add-On that currently is depending on jQuery for the following things: Selectors Animations A special .live("focus") hail-mary event-catching maneuver that happens to work with jQuery 1.4.2 (but not 1.4.4) jQuery isn't well suited for functioning inside XUL, and it's a miracle we've gotten this far with it. We're trying to remove the jQuery requirements, the first two are easy (animations are simple, and we can use .querySelector() instead of jQuery), but the .live has proven impossible to do on our own. I've tried reading the source code, but I haven't been able to piece it apart. What is the jQuery .live function doing? There's clearly a lot more going on than document.addEventListener("focus"/"focusin",function_to_pick_apart_events). What else is going on here?

    Read the article

  • css to replace characters in paragraph tag

    - by Thariama
    Already checked exisitng questions for this, but didn't find an exact match. My aim is to replace characters (like spaces) on a webpage with a small image using css. Example: <p><span>This is a text</span></p> becomes: <p><span>ThisIMGisIMGaIMGtext</span></p> (where IMG stands for a visible image (middot-pic for a space f.e.)) I cannot think of a suitable css selector. But myabe one of you guys (or girls) know a solution. Is this possible at all?

    Read the article

  • jquery ajax: headers seem to not be working

    - by Will
    hello, i am trying to get the headers of an ajax request i made through jquery $.get(url, function(response, textStatus, headers ) { console.log("Response: %o", response); console.log("TextStatus: %o", textStatus); console.log("Request: %o", headers); } ); this does not seem to be working however: the response and textstatus are printing, but the "headers" object seems to be undefined i simply want to check if it is what i expect (content type='excel', etc) or if the response type is html, i can assume the page i was calling is an error

    Read the article

  • finding specific immediate children of an element using prototype

    - by tatilans
    Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

    Read the article

  • Jquery return value

    - by Anton
    I used a code: jQuery.fn.MyFunction = function(){ return this.each(function() { attributes = "test"; return attributes; });} But when I call var1 = $(this).MyFunction();alert(var1); I got an [object], but not the "test". How to allow jquery plugin return a some value?

    Read the article

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • Highlighting search words like Chrome with jQuery

    - by ilkin
    I have recently done a very simple highlighting with jQuery and a highlight plugin. It looks like this: $('myButton').click(function() { $('body').highlight($('#myInputText').val()); }); But I wonder how can I do the Chrome like highlighting, I mean highlight the letters whenever I type in some letter in textbox without submitting. I think maybe use a keyup event... Any ideas?

    Read the article

  • jQuery changing images with animation and waiting for it to trigger hyperlink

    - by user1476298
    I want to switch images on .click() using the url attr I can do so, but I can't figure out how to make it wait, until the animation is done to redirect to the new webpage. Here's the js $(function() { $('.cv').click(function(){ $("#cv img").fadeOut(2000, function() { $(this).load(function() { $(this).fadeIn(); }); $(this).attr("src", "images/cv2.png"); return true; }); }); }); Here's the html: <div id="cv" class="img one-third column"> <a class="cv" target="#" href="cv.joanlascano.com.ar"> <img src="images/cv1.png" alt="Curriculum"/> <br />CV</a> </div> Thank you in advantage!

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • How do i make form data not disappear after hitting refresh?

    - by acidzombie24
    I went to test my page on another browser. On google chrome i can fill out a form, hit back and forward and still have the data there. Now i need to refresh the page so certain data is correct (such as session id if the cookie expires or user logs out before submitting). I refresh and lose all data. Is there some option i can set so all data is kept?

    Read the article

  • why jquery can't be used in my $(document).ready() function?

    - by Firegun
    The page can be viewed at http://cistrome.org/cps/seqconfig?did=2693 When load in Firebugs, it gives me this error: TypeError: $(".open_gene").on is not a function [Break On This Error] $(".open_gene").on('change', function(event) { However, if I type in this expression in Firebug's console, it can be evaluated as a function without any problems: >>> $(".open_gene").on function() I was wondering what might be the reason to cause this issue. Does anyone have ideas about this? Thanks!

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • add html to div with jQuery

    - by mtwallet
    Hi. I am trying to add some additional html to a div with id slideshow using jQuery. My code: $("#slideshow").append("<a id="prev" title="Previous Slide">Previous Slide</a><a id="next" title="Next Slide">Next Slide</a>"); This isn't working, can anyone tell me what I am doing wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 627 628 629 630 631 632 633 634 635 636 637 638  | Next Page >