Search Results

Search found 23754 results on 951 pages for 'unobtrusive javascript'.

Page 633/951 | < Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >

  • How do I get this validationTextBox to focus?

    - by Anurag Chaudhury
    After performing an ajax request if the input in the form was wrong I am trying to get this validatationTextBox to be focussed on and display an indicator message showing the problem. The code is: dijit.byId("passwordField").focusNode.focus() The form element is as mentioned a validationTextBox. The matter that is confusing me even further is that before in dojo 1.5, this piece of code was simply dijit.byId("passwordField").focus() and this worked fine. How can I fix this?

    Read the article

  • Jquery - $.(post) data response not consistent with PHP

    - by Sasha
    Jquery code: var code = $('#code'), id = $('input[name=id]').val(), url = '<?php echo base_url() ?>mali_oglasi/mgl_check_paid'; code.on('focusout', function(){ var code_value = $(this).val(); if(code_value.length != 16 ) { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; code.after('<p role=code_msg>Pogrešan kod je unešen.</p>'); } else { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; $.post(url, {id : id, code : code_value}, function(data){ if(data != 'TRUE'){ code.after('<p role=code_msg>Uneti kod je neispravan.</p>'); } else { code.after('<p role=code_msg>Status malog oglasa je promenjen.</p>'); code.after(create_image()); code.remove(); } }); } }); PHP (Codeigniter) code: function mgl_check_paid() { $code = $this->input->post('code'); $id = $this->input->post('id'); echo ($this->mgl->mgl_check_paid($code, $id)) ? 'TRUE' : 'FALSE'; } Problem is following: When code is sent and if it is correct, PHP part will echo TRUE, and JS will execute ELSE part (after post), but for some reason it is not doing that (it is executing the first part of the statment)? What is wrong with this code?

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • How to disable an input with jQuery Validation Plugin

    - by Eelke
    This should be really simple but I can't get it to work, how do I disable and add a class to an input? Let's say I've got an input field with id = name, this is how far I got, $("input#name").attr("disabled"); What am I doing wrong here? Any help would be greatly appreciated, thanks in advance!

    Read the article

  • Detecting when HTML5 audio is finished playing (more than once)?

    - by user386911
    I am having a problem detecting when an tag is finished playing an mp3. When I do something like this: myAudio.addEventListener("ended", function() { alert("ended"); }); It only occurs the first time the audi is played. When I play the audio again, nothing happens. The same thing occurs when I use the onended=doThis(); method. I've heard maybe there is a way to do it in jquery, but I haven't been able to get it to work. I've also heard there might be a way to fix it by changing the audio div id everytime the mp3 is played, but this doesn't work for me because I need the id to stay the same. Anyone got any ideas?

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Opera bug with JS autoselecting text (if more than 1 div)

    - by E L
    Here is HTML code. It supposed to select all text in "Container" div <B onclick="SelectText(document.getElementById('Container'));">select all text</B> <Div id="Container"> <Div>123456</Div> <Div>123456</Div> <Div onclick="SelectText();">123456</Div> </Div> here is JS code of the SelectText() function function SelectText(target){ if(target==null){ var e = window.event || e; if (!e) var e = window.event; var target=e.target || e.srcElement; } var rng, sel; if ( document.createRange ) { rng = document.createRange(); rng.selectNode( target ); sel = window.getSelection(); sel.removeAllRanges(); sel.addRange( rng ); } else { var rng = document.body.createTextRange(); rng.moveToElementText( target ); rng.select(); } } Problem is that in Opera 12.02 when "select all text" is clicked, all text seems like selected, but it's not selected (I can't rightclick it and copy). (terrific, but IE works fine with it) Why not in Opera?!!! And what can I do to make Opera 12.02 believe that all text in "Container" is selected?

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >