Search Results

Search found 29753 results on 1191 pages for 'best practices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 638/1191 | < Previous Page | 634 635 636 637 638 639 640 641 642 643 644 645  | Next Page >

  • Activation Function, Initializer function, etc, effects on neural networks for face detection

    - by harry
    There's various activation functions: sigmoid, tanh, etc. And there's also a few initializer functions: Nguyen and Widrow, random, normalized, constant, zero, etc. So do these have much effect on the outcome of a neural network specialising in face detection? Right now I'm using the Tanh activation function and just randomising all the weights from -0.5 to 0.5. I have no idea if this is the best approach though, and with 4 hours to train the network each time, I'd rather ask on here than experiment!

    Read the article

  • Jquery date in a dropdown with interval

    - by Zoom Pat
    I am trying to use Jquery to display dates in a dropdown with interval of half month... so the first value would be the coming month's 1st, then second will be the coming month's 15th and third value would be next to next month's first and so on... If today date is less than 15th then the first value would be the 15th of current month. What will be the best or a cleaner way to do this... (want to display in the dropdown) Thanks

    Read the article

  • Creating SVG map from geometry stored in MySQL

    - by Barnabe
    I have a group of geometries stored in MySQl (as polygon and as well-known text) representing counties. I can build a table of geometries and color codes after querying some county data (say GDP per capita). What is the best way to export this as an SVG map? I cannot find any reference to SVG conversion in the MySQL documentation.

    Read the article

  • compare two following values in numpy array

    - by Billy Mitchell
    What is the best way to touch two following values in an numpy array? example: npdata = np.array([13,15,20,25]) for i in range( len(npdata) ): print npdata[i] - npdata[i+1] this looks really messed up and additionally needs exception code for the last iteration of the loop. any ideas? Thanks!

    Read the article

  • Bad practice to have models made up of other models?

    - by mattruma
    I have a situation where I have Model A that has a variety of properties. I have discovered that some of the properties are similar across other models. My thought was I could create Model B and Model C and have Model A be a composite with a Model B property and a Model C property. Just trying to determine if this is the best way to handle this situation.

    Read the article

  • Validating Crontab Entries w/ PHP

    - by Wilco
    What is the best way to validate a crontab entry with PHP? Should I be using a regex, or an external library? I've got a PHP script that adds/removes entries from a crontab file, but want to have some way to verify that the time interval portion is in a valid format.

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Java - Make an object collection friendly

    - by DutrowLLC
    If an object holds a unique primary key, what interfaces does it need to implement in order to be collection friendly especially in terms of being efficiently sortable, hashable, etc...? If the primary key is a string, how are these interfaces best implemented? Thanks!

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • How do I generate a custom SID?

    - by Max Schmeling
    I need to generate custom SIDs for users in my web application for use with Microsoft AzMan. What is the best way to do this? What do I need to know before doing this? This is what I'm thinking, but I'm not sure if I'm missing something: S-1-9-1234-{user_id + 1000} S-{first revision}-{resource manager authority}-{domain (unique number for the specific app)}-{unique id for user} UPDATE: Changed to resource manager authority because of David Crawford's blog entry: http://blogs.msdn.com/dc995/archive/2006/08/23/715021.aspx

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • logout code in jsp.

    - by ajay
    I am using basic level authentication. and i need best logout code in JSP / servlet. I am using JSP & servlet and MS-ACCESS as backend. Is it require a session creation in JSP? please reply as soon as possible. Thanking you.....

    Read the article

  • Distinguish between single and double click events in Qt

    - by Jesse
    I have a QAbstractItemView that needs to react to single and double click events. The actions are different depending on whether it was single clicked or double clicked. The problem that is occurring is that the single click event is received prior to the double click event. Is there a recommended way/best practice for distinguishing between the two? I don't want to perform the single click action when the user has actually double clicked. I am using Qt 4.6

    Read the article

  • Encryption messages in a queue between 2 dlls.

    - by scope-creep
    Hi, I'm sending messages between 1 dll and another, effectively posting messages onto the dll input queue and receiving a messages back from the dll output queue. These two dlls are very tightly integrated. DLL 1 is a producer,and DLL2 is the consumer. I want to encrypt the messages before they are sent. What would be the best approach? Any help would be appreciated.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 634 635 636 637 638 639 640 641 642 643 644 645  | Next Page >