Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 638/1105 | < Previous Page | 634 635 636 637 638 639 640 641 642 643 644 645  | Next Page >

  • Prevent initial array from sorting

    - by George
    I have an array where the order of the objects is important for when I finally output the array in a document. However, I'm also sorting the array in a function to find the highest value. The problem is that I after I run the function to find the highest value, I can't get the original sort order of the array back. // html document var data = [75,300,150,500,200]; createGraph(data); // js document function createGraph(data) { var maxRange = getDataRange(data); // simpleEncode() = google encoding function for graph var dataSet = simpleEncode(data,maxRange); } function getDataRange(dataArray) { var num = dataArray.sort(sortNumber); return num[0]; } I've also tried setting data to dataA and dataB and using dataB in the getDataRange function and dataA in the simpleEncode function. Either way, data always end up being sorted from highest to lowest.

    Read the article

  • Change cookies when doing jQuery.ajax requests in Chrome Extensions

    - by haskellguy
    I have wrote a plugin for facebook that sends data to testing-fb.local. The request goes through if the user is logged in. Here is the workflow: User logs in from testing-fb.local Cookies are stored When $.ajax() are fired from the Chrome extension Chrome extension listen with chrome.webRequest.onBeforeSendHeaders Chrome extension checks for cookies from chrome.cookies.get Chrome changes the Set-Cookies header to be sent And the request goes through. I wrote this part of code that shoud be this: function getCookies (callback) { chrome.cookies.get({url:"https://testing-fb.local", name: "connect.sid"}, function(a){ return callback(a) }) } chrome.webRequest.onBeforeSendHeaders.addListener( function(details) { getCookies(function(a){ // Here something happens }) }, {urls: ["https://testing-fb.local/*"]}, ['blocking']); Here is my manifest.json: { "name": "test-fb", "version": "1.0", "manifest_version": 1, "description": "testing", "permissions": [ "cookies", "webRequest", "tabs", "http://*/*", "https://*/*" ], "background": { "scripts": ["background.js"] }, "content_scripts": [ { "matches": ["http://*.facebook.com/*", "https://*.facebook.com/*"], "exclude_matches" : [ "*://*.facebook.com/ajax/*", "*://*.channel.facebook.tld/*", "*://*.facebook.tld/pagelet/generic.php/pagelet/home/morestories.php*", "*://*.facebook.tld/ai.php*" ], "js": ["jquery-1.8.3.min.js", "allthefunctions.js"] } ] } In allthefunction.js I have the $.ajax calls, and in background.js is where I put the code above which however looks not to run.. In summary, I have not clear: What I should write in Here something happens If this strategy is going to work Where should I put this code?

    Read the article

  • css to replace characters in paragraph tag

    - by Thariama
    Already checked exisitng questions for this, but didn't find an exact match. My aim is to replace characters (like spaces) on a webpage with a small image using css. Example: <p><span>This is a text</span></p> becomes: <p><span>ThisIMGisIMGaIMGtext</span></p> (where IMG stands for a visible image (middot-pic for a space f.e.)) I cannot think of a suitable css selector. But myabe one of you guys (or girls) know a solution. Is this possible at all?

    Read the article

  • jquery bind an event to a class, or something to the same effect?

    - by mna
    hi, I'd like to bind an event to a class, or any alternative to the redundant code I posted below. Any ideas? thanks, mna (function(){ $( "button", "body" ).button(); var submenu=false; $( "#about" ).click(function() { $( "#content" ).fadeOut(1000); $( "#content" ).load('about.html'); $( "#content" ).fadeIn(1000); }); $( "#community" ).click(function() { $( "#content" ).fadeOut(1000); $( "#content" ).load('community.html'); $( "#content" ).fadeIn(1000); }); $( "#store" ).click(function() { $( "#content" ).fadeOut(1000); $( "#content" ).load('store.html'); $( "#content" ).fadeIn(1000); }); $( "#projects" ).click(function() { $( "#content" ).fadeOut(1000); $( "#content" ).load('projects.html'); $( "#content" ).fadeIn(1000); }); });

    Read the article

  • Parent - child event jquery

    - by Tom Rider
    I have have a 2 div element. One is child and one is parent like : <div id="p"> <div id="c"> </div> </div> The parent div has 2 event attached click and dblclick and child div has 1 event attached click. Now my problem is when i clicked on the child div the parent div click event also executed. I tried e.stopPropagation(); but still same behavior. Help me ?

    Read the article

  • Angularjs showin time portion from date time

    - by J. Davidson
    Hi I have following input which displays datetime <div ng-repeat="item in items"> <input type="text" ng-model="item.name" /> <input ng-model="item.time" /> </div> The issue i have is that time is in following format. "2002-11-28T14:00:00Z" I want to just display the time portion. For which I would have to apply filter date: 'hh:mm a' I tried ng-model="labor.start_time | date: 'hh:mm a'" Please let me know how i can show only time portion in input box showin time only. I cant use span tag as the time a user can change so have to show in input tag. Thanks

    Read the article

  • Ajax request ERROR on IE

    - by tinti
    Hello all! I have a small problem on IE browser (actually on Google Chrome too) I have this js code function createDoc(url) { var xhttp = ajaxRequest(); var currentLocationBase = window.location.href; currentLocationBase = currentLocationBase.substr(0,currentLocationBase.lastIndexOf("/") + 1); var u = currentLocationBase + url; xhttp.open("GET", u, false); xhttp.send(null); var xml = xhttp.responseXML; return xml; } /** * Builds an AJAX reques handler. * * @return The handler. */ function ajaxRequest() { var xhttp = null; if (window.XMLHttpRequest) { xhttp = new XMLHttpRequest(); } else if (window.ActiveXObject){ // Internet Explorer 5/6 xhttp = new ActiveXObject("Microsoft.XMLHTTP"); } else { } return xhttp; } In Firefox this code works great, but not in IE and Google Chrome Seems that the error is given at the line xhttp.open("GET", u, false); Can anyone help me to understand what i'm doing wrong? Thanks

    Read the article

  • jQuery - Why doesn't combining has() and gt() work in some cases?

    - by KatieK
    I wanted to select any ul which contains more than 3 lis. This code worked with the 1.2.6 jQuery library: $("ul:has(li:gt(2))") .each( function() { $(this).css("border", "solid red 1px"); }); But not 1.3.2 or 1.4.2. This code worked with the 1.4.2 jQuery library: $('ul').has('li:nth-child(3)').css('border', 'solid red 1px'); But not v1.2.6. Why does each version work with one library version, but not the other? Am I encountering some kind of bug, or am I doing something wrong? Any help understanding , or differences to be aware of between different versions of the jQuery libraries, would be much appreciated. Thanks!

    Read the article

  • Find the clicked li number

    - by fire
    I have a standard list... <ul> <li><a href="#">blah 1</a></li> <li><a href="#">blah 2</a></li> <li><a href="#">blah 3</a></li> <li><a href="#">blah 4</a></li> </ul> And my jQuery: $('ul li a').live('click', function() { var parent = $(this).parent('li'); }); What I want to find out is the parent li's position in the list of the clicked link e.g. clicking on blah 3 would give me 2, blah 4 would give 3 etc. Any ideas?

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Checking for length of ul and removing an li element

    - by Legend
    I am trying to remove the last <li> element from a <ul> element only if it exceeds a particular length. For this, I am doing something like this: var selector = "#ulelement" if($(selector).children().length > threshold) { $(selector + " >:last").remove(); } I don't like the fact that I have to use the selector twice. Is there a shorter way to do this? Something like a "remove-if-length-greater-than-threshold" idea. I was thinking that maybe there is a way to do this using the live() function but I have no idea how.

    Read the article

  • Get backreferences values and modificate these values

    - by roasted
    Could you please explain why im not able to get values of backreferences from a matched regex result and apply it some modification before effective replacement? The expected result is replacing for example string ".coord('X','Y')" by "X * Y". But if X to some value, divide this value by 2 and then use this new value in replacement. Here the code im currently testing: See /*>>1<<*/ & /*>>2<<*/ & /*>>3<<*/, this is where im stuck! I would like to be able to apply modification on backrefrences before replacement depending of backreferences values. Difference between /*>>2<<*/ & /*>>3<<*/ is just the self call anonymous function param The method /*>>2<<*/ is the expected working solution as i can understand it. But strangely, the replacement is not working correctly, replacing by alias $1 * $2 and not by value...? You can test the jsfiddle //string to test ".coord('125','255')" //array of regex pattern and replacement //just one for the example //for this example, pattern matching alphanumerics is not necessary (only decimal in coord) but keep it as it var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { /*==>**1**/ //this one works as usual but dont let me get backreferences values $output.val(inputText.replace(regexes[i][0], regexes[i][2])); /*==>**2**/ //this one should works as i understand it $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][3]; })); /*==>**3**/ //this one is just a test by self call anonymous function $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][4]; }())); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); //HERE i should be able if lets say $1 > 200 divide it by 2 //then returning $1 value if($1 > 200) $1 = parseInt($1 / 2); return $1; }? Sure I'm missing something, but cannot get it! Thanks for your help, regards. EDIT WORKING METHOD: Finally get it, as mentionned by Eric: The key thing is that the function returns the literal text to substitute, not a string which is parsed for backreferences.?? JSFIDDLE So complete working code: (please note as pattern replacement will change for each matched pattern and optimisation of speed code is not an issue here, i will keep it like that) $('#btn').click(function() { testReg($('#input').val(), $('#output')); }); //array of regex pattern and replacement //just one for the example var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { var checkedValues = checkReplace(match, $1, $2, $3, $4); $1 = checkedValues[0]; $2 = checkedValues[1]; regexes[i][1] = regexes[i][1].replace('$1', $1).replace('$2', $2); return regexes[i][1]; })); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); if ($1 > 200) $1 = parseInt($1 / 2); if ($2 > 200) $2 = parseInt($2 / 2); return [$1,$2]; }

    Read the article

  • How do you send an array as part of an (jquery) ajax request

    - by Ankur
    I tried to send an array as part of an ajax request like this: var query = []; // in between I add some values to 'query' $.ajax({ url: "MyServlet", data: query, dataType: "json", success: function(noOfResults) { alert(noOfResults); } }); } I wanted to see what I get back in the servlet, so I used this line: System.out.println(request.getParameterMap().toString()); Which returned {} suggesting an empty map. Firebug tells me I am getting a 400 bad request error If I send a queryString like attribute=value as the 'data' then everything works fine, so it has to do with not being able to send an array as is. What do I have to do to get that data into the servlet for further processing. I don't want to pull it out and turn it into a queryString in the JS if I can avoid it. EDIT: I used the .serializeArray() (jQuery) function before sending the data. I don't get the 400 but nothing useful is being sent through.

    Read the article

  • How to trigger an event ONLY if both dropdowns are selected?

    - by DaveDev
    I have a dropdown select list on my page of class="TypeFilter". I have a jQuery event that fires when a value in that list is selected. $(".TypeFilter").change(function() { // Extract value from TypeFilter and update page accordingly )); I now have to add another list to the page, and I want to implement functionality which will prevent the .change(function() from running unless both are selected. In both lists the first option in the list is some text instructing the user to select one of the items, so I was thinking of just writing some logic to test that both lists have a selected index greater than 0. I think this is a touch unclean though, especially considering that other pages that have a TypeFilter use the same logic. Is there any nifty functionality in jQuery that can do this?

    Read the article

  • More compact way to do this?

    - by Macha
    I have a couple of functions that loop around the surrounding cells of a cell. The grid is contained inside an array. In my code, I have checks to make sure it's not one of the edge cells, as checking an undefined cell causes an error. As such, I have code like this: if(x > 0) { var firstX = x - 1; } else { var firstX = x; } if(x < 199) { var lastX = x + 1; } else { var lastX = x; } if(y > 0) { var firstY = y - 1; } else { var firstY = y; } if(y < 199) { var lastY = y + 1; } else { var lastY = y; } A lot of lines of code to do very little. Is there a more elegant way to do this?

    Read the article

  • Adding a Click event to a submit button and then submitting the form

    - by Abs
    Hello all, I have a form with a submit button. I have attached a click event to that submit button using JQuery. Once I did this my form wasn't submitting, I thought this was because of the event I added- if I remove that click event it submits the form successfully. I have tried giving my form an id and calling the submit function but this was not successful either. What can I do? $('#submit_gen').click(function() { $('#genbtn').html('<img src="images/ajax-loader.gif" alt="loading" />'); $('#action_form').submit(); }); The HTML: <form id="action_form" action="generate.php" method="post" enctype="multipart/form-data"> <input id="file_upload" type="file" name="upload" onchange="file_select();"/> <input type="text" id="overlay_input"> <div id="genbtn" class="genbtn"> <input id="submit_gen" type="submit" value="Upload"> </div> </form> Thanks all

    Read the article

  • Why ajax doesn't work unless I refresh or use location.href?

    - by Connor Tang
    I am working on a html project, which will eventually package by Phonegap. So I am trying to encode the data from html form to JSON format, then use ajax send to a php file resides on server, and receive the response to do something else. Now I use <a href='login.html'> in my index.html to open the login page. In my login page, I have this <script> $(document).ready(function(e) { $('#loginform').submit(function(){ var jData = { "email": $('#emailLogin').val(), "password": $('#Password').val()}; $.ajax({ url: 'PHP/login.php', type:'POST', data: jData, dataType: 'json', async: false, error: function(xhr,status){ //reload(); location.href='index.html'; alert('Wrong email and password'); }, success: function(data){ if(data[1] == 1){ var Id_user = data[0]; location.href='loginSuccess.html'; } } }); }); }); </script> to send my data to server. But I found that it won't work, it's still in the login page. I tried to enter data and submit again, it's still nothing happen. Until I refresh the login page and enter data again, it can give an error message or go to the loginsuccess page. However, when I use <script> function loadLogin(){ location.href='login.html'; } </script> to open the login page, everything works well. So what cause this? How can I modify this piece of code to make it better?

    Read the article

  • Trouble with Perfect Scrollbar jQuery

    - by coolpup
    I'm using the Perfect Scrollbar jQuery app (http://www.yuiazu.net/perfect-scrollbar/) for this site: http://thehummingbirdplace.com/ The scrollbar shows up when you hover over the News section, but it won't scroll down to reveal the content. I've used this scrollbar before successfully, so I'm stumped as to what is different now. I haven't been able to replicate this on a simpler page, when I experiment on another page it either works or just vanishes, so I'm not sure why it is successfully showing up, yet not scrolling on the main page. Any help would be appreciated!!

    Read the article

  • greasemonkey code modification

    - by muqtar
    Hi,all.. A user has helped me find hidden values in a page and display it using alert. If there are radio buttons and one of them is related to this value,is there a way to select the radio button automatically rathar than displaying the value in alert box.. Thanks... the code is as follows: var inputs = document.getElementsByTagName('input'); for (i=0; i<inputs.length; i++) { if (inputs[i].getAttribute("name") == "ans") { alert(inputs[i].getAttribute("value")); } } this "value" must be selected in the radio button rathar than alerting...

    Read the article

< Previous Page | 634 635 636 637 638 639 640 641 642 643 644 645  | Next Page >