Search Results

Search found 24406 results on 977 pages for 'javascript namespaces'.

Page 642/977 | < Previous Page | 638 639 640 641 642 643 644 645 646 647 648 649  | Next Page >

• How to get parallel behavior in Java Script ?

  - by Biswanath

  More or less I want to execute two functions in parallel. One way as I see is doing through SetTimeOut function. I have not completely gone through the ReactiveExentension, although it looks promising but may be overkill for my needs. Is there any framework which supports parallelism ? My use case is trivial, but I would like to know if anybody heavily needed parallelism in Java Script ? Thanks, Biswanath.

  Read the article

• Robust Way of Selecting All Text in Textbox

  - by Emil

  I'm trying to have the content of the an HTML textbox be selected fully onFocus. I know the simple solution of putting a onfocus="this.select()" on the component but this is not a good solution because if a user double clicks into the area the selection is lost and in browsers like chrome it is rarely working like it should and just reverts into input form. I have searched on Google for a little while and can't find a good solution, most suggestions are of this simple solution. What I would like it is that the selection inside the textbox not change once selected and if possible the user should not be able to edit the content of the textbox, for example if you have used AdSense when you grab code from AdSense the selection never changes and your unable to alter the code in the textbox. Any solutions would be appreciated.

  Read the article

• jQuery: Writing jquery in an object oriented way

  - by anoopkattodi

  Hi all, I am trying to write all my query code in an object oriented way. But I don't know how to implement this for each click function and hover function etc. I also wanted to know: What are the advantages of writing query in object oriented way? For query what is better the object oriented way or in the ordinary way?

  Read the article

• How to dynamically set div size?

  - by Vafello

  I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

  Read the article

• Changing class of h2 inside specific div

  - by user1985060

  I want to make it so that everytime you click on an 'h2' tag, the 'input' inside gets selected and the 'h2' tag changes background, but if another 'h2' tag is clicked, the current highlight and 'input' selection changes accordingly. problem is that I have 3 different that do the same and with my code all the 3 forms are affected rather one. How do i limit my changes to only be contained to that form. Here is some code for clarification ' <form> ... <h2 onclick="document.getElementById(1001).checked='True' $('h2').removeClass('selected'); $(this).addClass('selected'); "> CONTENT <input type="radio" name="radio" id="1001" value="1001" /> </h2> ... </form>

  Read the article

• Pulling .live() functionality out of jQuery

  - by Daniel

  I am writing a Firefox Add-On that currently is depending on jQuery for the following things: Selectors Animations A special .live("focus") hail-mary event-catching maneuver that happens to work with jQuery 1.4.2 (but not 1.4.4) jQuery isn't well suited for functioning inside XUL, and it's a miracle we've gotten this far with it. We're trying to remove the jQuery requirements, the first two are easy (animations are simple, and we can use .querySelector() instead of jQuery), but the .live has proven impossible to do on our own. I've tried reading the source code, but I haven't been able to piece it apart. What is the jQuery .live function doing? There's clearly a lot more going on than document.addEventListener("focus"/"focusin",function_to_pick_apart_events). What else is going on here?

  Read the article

• allignment issue of div tag

  - by Quasar the space thing

  I am trying to create a web page where on click of a button I can add div tags. What I thought to do was that I'll create two div tags within a single div so that over all presentation will be uniform and similar to a table having two columns and multiple rows and the first column contains only label's and second column will contain textbox. Here is the JS file : var counter = 0; function create_div(type){ var dynDiv = document.createElement("div"); dynDiv.id = "divid_"+counter; dynDiv.class="main"; document.body.appendChild(dynDiv); question(); if(type == 'ADDTEXTBOX'){ ADDTEXTBOX(); } counter=counter+1; } function question(){ var question_div = document.createElement("div"); question_div.class="question"; question_div.id = "question_div_"+counter; var Question = prompt("Enter The Question here:", ""); var node=document.createTextNode(Question); question_div.appendChild(node); var element=document.getElementById("divid_"+counter); element.appendChild(question_div); } function ADDTEXTBOX(){ var answer_div = document.createElement("div"); answer_div.class="answer"; answer_div.id = "answer_div_"+counter; var answer_tag = document.createElement("input"); answer_tag.id = "answer_tag_"+counter; answer_tag.setAttribute("type", "text"); answer_tag.setAttribute("name", "textbox"); answer_div.appendChild(answer_tag); var element=document.getElementById("divid_"+counter); element.appendChild(answer_div); } Here is the css file : .question { width: 40%; height: auto; float: left; display: inline-block; text-align: justify; word-wrap:break-word; } .answer { padding-left:10%; width: 40%; height: auto; float: left; overflow: auto; word-wrap:break-word; } .main { width: auto; background-color:gray; height: auto; overflow: auto; word-wrap:break-word; } My problem is that the code is working properly but both the divisions are not coming in a straight line. after the first div prints on the screen the second divisions comes in another line. How can I make both the div's come in the same line ? Thank You. PS : should I stick with the current idea of using div or should I try some other approach ? like tables ?

  Read the article

• "Remember" last three MySql queries; Cookie, passed variable or other method?

  - by Camran

  I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

  Read the article

• IE7 preventDefault() not working on skip links

  - by josh

  I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

  Read the article

• How to make a jquery lightbox open multiple images from one link?

  - by ritch0s

  Using a lightbox like ColorBox or jQuery Lightbox Plugin how can i make a single link which opens a gallery / array of images? For example i have 1 thumbnail and when a user clicks it i want it to open multiple pictures in the lightbox so the user can click next or previous to view all the pictures within that gallery. My thinking was that i just do it as normal 1 link to 1 picture then use jquery to hide all but the first link. There must be a better way? Thanks.

  Read the article

• Jquery: hot to sleep or delay?

  - by lazyanno

  i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

  Read the article

• jquery ajax: headers seem to not be working

  - by Will

  hello, i am trying to get the headers of an ajax request i made through jquery $.get(url, function(response, textStatus, headers ) { console.log("Response: %o", response); console.log("TextStatus: %o", textStatus); console.log("Request: %o", headers); } ); this does not seem to be working however: the response and textstatus are printing, but the "headers" object seems to be undefined i simply want to check if it is what i expect (content type='excel', etc) or if the response type is html, i can assume the page i was calling is an error

  Read the article

• Find n pefect square?[python]

  - by Dinesh

  Please solve this program.

  Read the article

• Is there a way to stop Firebug from working on a particular site?

  - by William Calleja

  Is there some way to make Firebug not work at all on a website?

  Read the article

• How do i make form data not disappear after hitting refresh?

  - by acidzombie24

  I went to test my page on another browser. On google chrome i can fill out a form, hit back and forward and still have the data there. Now i need to refresh the page so certain data is correct (such as session id if the cookie expires or user logs out before submitting). I refresh and lose all data. Is there some option i can set so all data is kept?

  Read the article

• I need a converter to make any jquery code to make no.conflict mode?

  - by jitendra

  I need a converter to make any jquery code/plugin to make with no.conflict mode? or it's just possible with find and replace.

  Read the article

• Jquery return value

  - by Anton

  I used a code: jQuery.fn.MyFunction = function(){ return this.each(function() { attributes = "test"; return attributes; });} But when I call var1 = $(this).MyFunction();alert(var1); I got an [object], but not the "test". How to allow jquery plugin return a some value?

  Read the article

• Highlighting search words like Chrome with jQuery

  - by ilkin

  I have recently done a very simple highlighting with jQuery and a highlight plugin. It looks like this: $('myButton').click(function() { $('body').highlight($('#myInputText').val()); }); But I wonder how can I do the Chrome like highlighting, I mean highlight the letters whenever I type in some letter in textbox without submitting. I think maybe use a keyup event... Any ideas?

  Read the article

• finding specific immediate children of an element using prototype

  - by tatilans

  Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

  Read the article

• Use a table as container or not?

  - by Camran

  I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

  Read the article

• Pass var to jquery from div

  - by user1518202

  I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Why is my index view not working when I implement datepicker in my rails app

  - by user3736107

  Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

  Read the article

• XMLHttpRequest.status always returning 0

  - by Michael

  html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

  Read the article

• Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

  - by josh

  I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

  Read the article

< Previous Page | 638 639 640 641 642 643 644 645 646 647 648 649  | Next Page >