Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 748/1326 | < Previous Page | 744 745 746 747 748 749 750 751 752 753 754 755  | Next Page >

  • Translating C++'s sprintf format string to C#'s string.Format

    - by thebackup
    I found the following C++ code (comments added myself): // frame_name is a char array // prefix is std::string // k is a for loop counter // frames is a std::vector string sprintf(frameName, "%s_%0*s.bmp", prefix.c_str(), k, frames[k].c_str()); I then try to translate it to C# // prefix is string // k is a for loop counter // frames is List<string> string frameName = string.Format("{0}_(what goes in here?).bmp", prefix, k, frames[k]); Basically, what would be the C# equivalent of the C++ format string "%s_%0*s.bmp"?

    Read the article

  • Conditional Formating in Excel

    - by littlevahn
    HI, Im very new to Excel and VBA and was wondering I there is a way I could make conditional formatting on drop down Lists. I currently have a warning if the user enters something that is not valid (data validation) but I want to change the cell's background color to red if invalid or green if valid. Again there only options are in a List box. Any help would be awesome. Thanks

    Read the article

  • ASP.Net 4.0 Database Created Pages

    - by Tyler
    I want to create asp.net 4.0 dynamic pages loaded from my MS SQL server. Basically, its a list of locations with informations. For example: Location1 would have the page www.site.com/location/location1.aspx Location44 would have the page www.site.com/location/location44.aspx I dont even know where to start with this, url writting maybe?

    Read the article

  • What's the right tool for this job in Google Spreadsheets?

    - by Daniel Harvey
    Is it possible to nest simple programs within a Google doc spreadsheet, similar to how you would w/Basic in Excel? Or alternatively a simple = syntax using regex, if there is a way to do that in google docs? I want to take a list of multiple names(name1, name2, name3) in a single cell from across multiple identical sheets and transpose them to another sheet within the same spreadsheet, check for duplicates and ignore capitals, etc. Is there a way to do this?

    Read the article

  • Variable number of arguments in ParamArray ArgList()

    - by Excel VBA guy
    If I want to pass a number of values for the ParamArray arglist via an array, how do I do it? From what I've read so far, on VBA, it appears that I need to explicitly list the values that I want to pass. But what if there are potentially different numbers of values to pass, so I do not know in advance how many I'll want to pass to the function? Is there not some way of using an array (a one-dimensional array) with a variable dimension?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Summary of changes for each API level?

    - by MisterSquonk
    As the title says, are there any sources (web pages etc) of summarised changes at each API level? I have an app which I've put out to a small group of beta testers and I already fell foul of Environment.getExternalFilesDir(), which I hadn't noticed was introduced in API Level 8, when a couple of the guys tried it on Android v2.1 devices. The majority of my code should be pretty generic but it would be useful if I could find a condensed/summarised list/table or similar that I can quickly glance over.

    Read the article

  • Custom security permission_types in Jetspeed

    - by shikarishambu
    Is it possible to create and manage custom permission types in Jetspeed. In addition to the default - folder, page, link, portlet I would like to add document as a type. I want to then use the list of permissions of type "document" that a principal has to manage access to documents. Thanks

    Read the article

  • Testing an application for Android.

    - by Tarmon
    Hey Everyone, I was wondering if any one had compiled a list of the most commonly used Android devices so I can get an idea of what I should test for. Even better would be suggested configurations for emulating each device. Thanks, Rob

    Read the article

  • Remove then Query fails in JPA/Hibernate (deleted entity passed to persist)

    - by Kevin
    I've got a problem with the removal of entities in my JPA application: basically, I do in this EJB Business method: load photo list ; for each photo { //UPDATE remove TagPhoto element from @OneToMany relation //DISPLAY create query involving TagPhoto ... } and this last query always throws an EntityNotFoundException (deleted entity passed to persist: [...TagPhoto#]) I think I understand the meaning of this exception, like a synchronization problem caused by my Remove, but how can I get rid of it?

    Read the article

  • SQLite3 Integer Max Value

    - by peterwkc
    Hello to all, what is the maximum value of data type INTEGER in sqlite3 ? How do you store ip address in database ? What is attached ? How to create table which belongs to a specific database using sql ddl? What is this error about ? error while the list of system catalogue : no such table: temp.sqlite_master Unable to execute statement Does sqlite3 text data type supoports unicode? Thanks.

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • Incoming Mails in Sharepoint

    - by frbry
    Hello all, I have a Document Library that receives a mail every week. I want to show the list of mails with their summaries. Is it possible to get that mail's content in Sharepoint, without deploying a custom code? Thanks.

    Read the article

  • Good looking programs that are built using wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • send email to single ExactTarget subscriber without TriggeredSend

    - by Max Gontar
    There is an email service ExactTarget with web service API. There are samples (in php though) for sending email to whole list instantly, or to single subscriber by triggered action. It's pretty hard to get in it's documentation, and I couldn't find explanation how to send email to a single subscriber instantly without having some triggering actions. Any help or advice will be great.

    Read the article

  • Accessing a namespace containing .base in its name from F#

    - by emaster70
    As the title says, I'm trying to use a class declared in a namespace which contains "base" in its name. Think of a situation like the following: open Foo.base.Bar In C# I'd just use @ before base but F# seems to ignore that and to think that @ is the infix operator used for list concatenation. Since the namespace belongs to a third-party library which I cannot modify, is there a way I can still access it from F#?

    Read the article

  • POS for .NET Known Service Objects

    - by Oliver S
    Hi, I was wondering if anyone knew where I could find a list of LineDisplays, CashDrawers, Printers, that work well with POS for .NET. I want to get around creating my own service objects for potential devices that I might by which are not supported. Thanks.

    Read the article

  • Changing the path a property is bound to at runtime

    - by Dave Colwell
    Hi, I have a ComboBox with a list of objects bound to it. Currently i have the items templated so they show only the property Class.Name. so the ComboBox is full of Class.Name However i am required to give the user the option to display the property Class.Description instead. If it were just that easy i would be fine, but they want the option to switch back and forth between them at runtime. Any ideas?

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • cleanup all UIComponents inside mx:Application

    - by user267530
    Hi I create some elements( UIComponents, mainly Panels) inside the “mx:Application name=”tst” “. I need to cleanup all those UIComponent’s on MouseClick event , using Actionscript. Is there any way I access the children elements of mx:Application ( I used var totalChildren:Number = this[‘tst’].numChildren ; but looks like it fails to access the children list). Thanks Palash

    Read the article

< Previous Page | 744 745 746 747 748 749 750 751 752 753 754 755  | Next Page >