Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • 404 with spring 3

    - by markjason72
    hi I am going through my first lessons with spring 3.I created a dynamic web app in eclipse with the following structure. spring3mvc \src\my.spring.HelloWorldController.java \WebContent | |-----WEB-INF\jsp\hello.jsp |-----index.jsp |-----web.xml |-----WEB-INF\spring-servlet.xml |-----WEB-INF\lib\...*.jar files I created the spring-servlet.xml as below <context:component-scan base-package="my.spring" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView" /> <property name="prefix" value="/WEB-INF/jsp/" /> <property name="suffix" value=".jsp" /> </bean> and coded the controller package my.spring; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class HelloWorldController { @RequestMapping("/hello") public ModelAndView helloWorld() { String message = "Hello World, Spring 3.0!"; return new ModelAndView("hello", "message", message); } } index.jsp has a link to hello view <html> <body> <a href="hello.html">Say Hello</a> </body> </html> finally in hello.jsp I have put <html> <body> ${message} </body> </html> My web.xml has <display-name>Spring3MVC</display-name> <welcome-file-list> <welcome-file>index.jsp</welcome-file> </welcome-file-list> <servlet> <servlet-name>spring</servlet-name> <servlet-class> org.springframework.web.servlet.DispatcherServlet </servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>spring</servlet-name> <url-pattern>*.html</url-pattern> </servlet-mapping> When I run the app on Tomcat6 server( thru eclipse),I can see the index page at http://localhost:8080/Spring3MVC/ .It displays the link to hello page.When I click on it(http://localhost:8080/Spring3MVC/hello.html),I get a 404 error. message /Spring3MVC/hello.html description The requested resource (/Spring3MVC/hello.html) is not available. Any idea how I can solve this? thanks mark.

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • how to remove empty tags in input xml

    - by SGB
    My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • Testing an application for Android.

    - by Tarmon
    Hey Everyone, I was wondering if any one had compiled a list of the most commonly used Android devices so I can get an idea of what I should test for. Even better would be suggested configurations for emulating each device. Thanks, Rob

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • How to use an IN clause in iBATIS?

    - by furtelwart
    I'm using iBATIS to create select statements. Now I would like to implement the following SQL statement with iBATIS: SELECT * FROM table WHERE col1 IN ('value1', 'value2'); With the following approach, the statement is not prepared correctly and no result returns: SELECT * FROM table WHERE col1 IN #listOfValues#; iBATIS seems to restructure this list and tries to interpret it as a string. How can I use the IN clause correctly?

    Read the article

  • Spring transaction management breaks hibernate cascade

    - by TimmyJ
    I'm having a problem where the addition of spring's transaction management to an application causes Hibernate to throw the following error: org.hibernate.HibernateException: A collection with cascade="all-delete-orphan" was no longer referenced by the owning entity instance: org.fstrf.masterpk.domain.ReportCriteriaBean.treatmentArms org.hibernate.engine.Collections.processDereferencedCollection(Collections.java:96) org.hibernate.engine.Collections.processUnreachableCollection(Collections.java:39) org.hibernate.event.def.AbstractFlushingEventListener.flushCollections(AbstractFlushingEventListener.java:218) org.hibernate.event.def.AbstractFlushingEventListener.flushEverythingToExecutions(AbstractFlushingEventListener.java:77) org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:26) org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1000) org.springframework.orm.hibernate3.SpringSessionSynchronization.beforeCommit(SpringSessionSynchronization.java:135) org.springframework.transaction.support.TransactionSynchronizationUtils.triggerBeforeCommit(TransactionSynchronizationUtils.java:72) org.springframework.transaction.support.AbstractPlatformTransactionManager.triggerBeforeCommit(AbstractPlatformTransactionManager.java:905) org.springframework.transaction.support.AbstractPlatformTransactionManager.processCommit(AbstractPlatformTransactionManager.java:715) org.springframework.transaction.support.AbstractPlatformTransactionManager.commit(AbstractPlatformTransactionManager.java:701) org.springframework.transaction.interceptor.TransactionAspectSupport.commitTransactionAfterReturning(TransactionAspectSupport.java:321) org.springframework.transaction.interceptor.TransactionInterceptor.invoke(TransactionInterceptor.java:116) org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:171) org.springframework.aop.framework.JdkDynamicAopProxy.invoke(JdkDynamicAopProxy.java:204) $Proxy92.saveNewReportCriteria(Unknown Source) org.fstrf.masterpk.domain.logic.MasterPkFacade.saveNewReportCriteria(MasterPkFacade.java:134) org.fstrf.masterpk.controllers.ReportCriteriaController.setupReportType(ReportCriteriaController.java:302) sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) java.lang.reflect.Method.invoke(Method.java:585) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.doInvokeMethod(HandlerMethodInvoker.java:413) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.invokeHandlerMethod(HandlerMethodInvoker.java:134) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.invokeHandlerMethod(AnnotationMethodHandlerAdapter.java:310) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.handle(AnnotationMethodHandlerAdapter.java:297) org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:875) org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:809) org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:571) org.springframework.web.servlet.FrameworkServlet.doPost(FrameworkServlet.java:511) javax.servlet.http.HttpServlet.service(HttpServlet.java:710) javax.servlet.http.HttpServlet.service(HttpServlet.java:803) org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96) I'm using Spring 2.5 and annotations to implement this management. Here is the class containing the saveNewReportCriteria method (which, as can be seen by the stack trace, is causing the error) @Transactional( propagation = Propagation.REQUIRED, isolation = Isolation.DEFAULT, readOnly = false) public class HibernateReportCriteriaDao implements ReportCriteriaDao{ private HibernateTemplate hibernateTemplate; public Integer saveNewReportCriteria(ReportCriteriaBean reportCriteria) { hibernateTemplate.save(reportCriteria); List<Integer> maxIdList = hibernateTemplate.find("SELECT max(id) from ReportCriteriaBean"); logger.info("ID of newly saved list is: " + maxIdList.get(0)); return maxIdList.get(0); } public void setHibernateTemplate(HibernateTemplate hibernateTemplate) { this.hibernateTemplate = hibernateTemplate; } } Then I added the following sections to my configuration files to tell spring that I am using annotation driven transaction management: <bean id="actgDataSource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/actg" /> <property name="resourceRef" value="true" /> </bean> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="actgDataSource" /> </bean> <tx:annotation-driven/> I'm pretty sure that the de-referencing error is being caused due to the proxy class that Spring AOP creates and uses in order to handle transaction management, but I have no idea how I'd go about fixing it.

    Read the article

  • Remove then Query fails in JPA/Hibernate (deleted entity passed to persist)

    - by Kevin
    I've got a problem with the removal of entities in my JPA application: basically, I do in this EJB Business method: load photo list ; for each photo { //UPDATE remove TagPhoto element from @OneToMany relation //DISPLAY create query involving TagPhoto ... } and this last query always throws an EntityNotFoundException (deleted entity passed to persist: [...TagPhoto#]) I think I understand the meaning of this exception, like a synchronization problem caused by my Remove, but how can I get rid of it?

    Read the article

  • How to configure aria2 as a starup service in archlinux?

    - by user1179442
    I tried to edit a service file in /etc/systemd/system/aria2.service [Unit] Description=start aria2 Wants=network.target Before=network.target [Service] Type=oneshot ExecStart=/usr/bin/aria2c --enable-rpc --rpc-listen-all=true --rpc-allow-origin-all -c -D [Install] WantedBy=multi-user.target Then run "systemctl enable aria2" & "systemctl start" and there is no error. But I can't grep 'aria2c' in process list after reboot. Who can give me a sample service file for it? Thanks

    Read the article

  • Ruby - Read file in batches

    - by Algorist
    Hi, I am reading a file that is 10mb in size and which contains some id's. I read them into a list in ruby. I am concerned that it might cause memory issues in the future, when the number of id's in file might increase. Is there a effective way of reading a large file in batches? Thank you

    Read the article

  • How do I create a Thread Manager for an Android App ?

    - by MrBuBBLs
    Hi, I would like to know how to start and code a thread manager for my Android App. My app is going to fill a list with a network I/O and I have to manage threads for that. I never done this before and I don't know where to start. I heard about Thread Pool and other stuff, but I'm quite confused. Could someone please help me make my way through ? Thanks

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • Good looking programs that use wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Variable number of arguments in ParamArray ArgList()

    - by Excel VBA guy
    If I want to pass a number of values for the ParamArray arglist via an array, how do I do it? From what I've read so far, on VBA, it appears that I need to explicitly list the values that I want to pass. But what if there are potentially different numbers of values to pass, so I do not know in advance how many I'll want to pass to the function? Is there not some way of using an array (a one-dimensional array) with a variable dimension?

    Read the article

  • Attack from anonymous proxy

    - by mmgn
    We got attacked by some very-bored teenagers registering in our forums and posting very explicit material using anonymous proxy websites, like http://proxify.com/ Is there a way to check the registration IP against a black list database? Has anyone experienced this and had success?

    Read the article

  • Calculation error in Datasheet view in SharePoint

    - by Marius
    I have a custom list, with calculation, in SharePoint. Everything worked fine until recently when the DataSheet will show strange or wrong % calculation in a % column. But the Standard View will show correct values. IT checked the server side and everything looked ok, I checked the formulas and even re-did them in the column and the issue persist. Anyone, any suggestion? Thanks,

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • cleanup all UIComponents inside mx:Application

    - by user267530
    Hi I create some elements( UIComponents, mainly Panels) inside the “mx:Application name=”tst” “. I need to cleanup all those UIComponent’s on MouseClick event , using Actionscript. Is there any way I access the children elements of mx:Application ( I used var totalChildren:Number = this[‘tst’].numChildren ; but looks like it fails to access the children list). Thanks Palash

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >