Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 752/1326 | < Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >

  • [C] glist.c: No such file or directory

    - by sterh
    Hello, I have c/gtk+ application and GList which filled three elements, when i try to run following code with gdb: if (g_list_length(mw->img_list) > 0) printf(">0"); else printf("<0"); i see: Program received signal SIGSEGV, Segmentation fault. [Switching to Thread 0xb73c4700 (LWP 7936)] IA__g_list_length (list=0x6e6920) at glist.c:767 767 glist.c: No such file or directory. in glist.c What is it? Thank you.

    Read the article

  • How to correctly populate records from SQLlite in ListActivity?

    - by Pavel
    Hi. Can someone please tell me how can I easily display every record from sqllite in ListActivity tab? I'm kinda confused with this. Do I have to create db from my helper class in TabActivity or ListActivity or both? My db helper class is as follow: package tabs.app; import android.content.ContentValues; import android.content.Context; import android.database.Cursor; import android.database.SQLException; import android.database.sqlite.SQLiteDatabase; import android.database.sqlite.SQLiteOpenHelper; import android.util.Log; public class DBAdapter { private static String DB_PATH = "/data/data/tabs.app/databases/"; public static final String KEY_ROWID = "_id"; public static final String KEY_LATITUDE = "latitude"; public static final String KEY_LONGITUDE = "longitude"; private static final String TAG = "DBAdapter"; private static final String DATABASE_NAME = "coords"; private static final String DATABASE_TABLE = "coordsStorages"; private static final int DATABASE_VERSION = 2; /* private static final String DATABASE_CREATE = "create table coordsStorage (_id integer primary key autoincrement, latitude integer not null, longitude integer not null)"; */ public Context context; private DatabaseHelper DBHelper; private SQLiteDatabase db; public DBAdapter(Context ctx) { this.context = ctx; DBHelper = new DatabaseHelper(context); } private static class DatabaseHelper extends SQLiteOpenHelper { DatabaseHelper(Context context) { super(context, DATABASE_NAME, null, DATABASE_VERSION); } @Override public void onCreate(SQLiteDatabase db) { db.execSQL("create table coordsStorages (_id integer primary key autoincrement, latitude integer not null, longitude integer not null)"); } @Override public void onUpgrade(SQLiteDatabase db, int oldVersion, int newVersion) { Log.w(TAG, "Upgrading database from version " + oldVersion + " to " + newVersion + ", which will destroy all old data"); db.execSQL("DROP TABLE IF EXISTS titles"); onCreate(db); } } //---opens the database--- public DBAdapter open() throws SQLException { db = DBHelper.getWritableDatabase(); return this; } //---closes the database--- public void close() { DBHelper.close(); } //---insert a title into the database--- public long insertCoords(int latitude, int longitude) { ContentValues initialValues = new ContentValues(); initialValues.put(KEY_LATITUDE, latitude); initialValues.put(KEY_LONGITUDE, longitude); return db.insert(DATABASE_TABLE, null, initialValues); } public void openDataBase() throws SQLException{ //Open the database String myPath = DB_PATH + DATABASE_NAME; db = SQLiteDatabase.openDatabase(myPath, null, SQLiteDatabase.OPEN_READONLY); } //---deletes a particular title--- public boolean deleteTitle(long rowId) { return db.delete(DATABASE_TABLE, KEY_ROWID + "=" + rowId, null) > 0; } //---retrieves all the titles--- public Cursor getAllTitles() { return db.query(DATABASE_TABLE, new String[] { KEY_ROWID, KEY_LATITUDE, KEY_LONGITUDE}, null, null, null, null, null); } //---retrieves a particular title--- public Cursor getTitle(long rowId) throws SQLException { Cursor mCursor = db.query(true, DATABASE_TABLE, new String[] { KEY_ROWID, KEY_LATITUDE, KEY_LONGITUDE}, KEY_ROWID + "=" + rowId, null, null, null, null, null); if (mCursor != null) { mCursor.moveToFirst(); } return mCursor; } //---updates a title--- /*public boolean updateTitle(long rowId, int latitude, int longitude) { ContentValues args = new ContentValues(); args.put(KEY_LATITUDE, latitude); args.put(KEY_LONGITUDE, longitude); return db.update(DATABASE_TABLE, args, KEY_ROWID + "=" + rowId, null) > 0; }*/ } And Im trying to retrieve the records in TabActivity like this: public class Areas extends ListActivity { DBAdapter db; SimpleCursorAdapter mAdapter; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.areas_layout); db = new DBAdapter(this); db.open(); Cursor c = db.getAllTitles(); startManagingCursor(c); String[] display = new String[] { db.KEY_LATITUDE }; int[] to = new int[] { R.id.row_latitude}; /* String[] display2 = new String[] { db.KEY_LONGITUDE }; int[] to2 = new int[] { R.id.row_longitude};*/ mAdapter = new SimpleCursorAdapter(this, R.layout.areas_layout, c, display, to); setListAdapter(mAdapter); /* mAdapter2 = new SimpleCursorAdapter(this, R.layout.areas_layout, c, display2, to2); setListAdapter(mAdapter2);*/ db.close(); } /* private void fillData() { // Get all of the rows from the database and create the item list Cursor c = db.getAllTitles(); startManagingCursor(c); }*/ } Whenever I'm trying to do that the error log outputs this: 06-07 09:51:56.529: ERROR/AndroidRuntime(2034): Uncaught handler: thread main exiting due to uncaught exception 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): java.lang.RuntimeException: Unable to start activity ComponentInfo{tabs.app/tabs.app.Areas}: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2401) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.ActivityThread.startActivityNow(ActivityThread.java:2242) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.LocalActivityManager.moveToState(LocalActivityManager.java:127) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.LocalActivityManager.startActivity(LocalActivityManager.java:339) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.widget.TabHost$IntentContentStrategy.getContentView(TabHost.java:631) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.widget.TabHost.setCurrentTab(TabHost.java:317) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.widget.TabHost$2.onTabSelectionChanged(TabHost.java:127) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.widget.TabWidget$TabClickListener.onClick(TabWidget.java:346) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.View.performClick(View.java:2344) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.View.onTouchEvent(View.java:4133) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.View.dispatchTouchEvent(View.java:3672) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:850) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:882) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.policy.impl.PhoneWindow$DecorView.superDispatchTouchEvent(PhoneWindow.java:1712) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.policy.impl.PhoneWindow.superDispatchTouchEvent(PhoneWindow.java:1202) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.Activity.dispatchTouchEvent(Activity.java:1987) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.policy.impl.PhoneWindow$DecorView.dispatchTouchEvent(PhoneWindow.java:1696) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.view.ViewRoot.handleMessage(ViewRoot.java:1658) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.os.Handler.dispatchMessage(Handler.java:99) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.os.Looper.loop(Looper.java:123) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.ActivityThread.main(ActivityThread.java:4203) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at java.lang.reflect.Method.invokeNative(Native Method) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at java.lang.reflect.Method.invoke(Method.java:521) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:791) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:549) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at dalvik.system.NativeStart.main(Native Method) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): Caused by: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.ListActivity.onContentChanged(ListActivity.java:236) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at com.android.internal.policy.impl.PhoneWindow.setContentView(PhoneWindow.java:316) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.Activity.setContentView(Activity.java:1620) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at tabs.app.Areas.onCreate(Areas.java:18) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1123) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2364) 06-07 09:51:56.559: ERROR/AndroidRuntime(2034): ... 30 more 06-07 09:51:56.619: INFO/Process(51): Sending signal. PID: 2034 SIG: 3 06-07 09:51:56.619: INFO/dalvikvm(2034): threadid=7: reacting to signal 3 06-07 09:51:56.619: ERROR/dalvikvm(2034): Unable to open stack trace file '/data/anr/traces.txt': Permission denied Can someone please tell me what I'm doing wrong? Help greatly appreciated!

    Read the article

  • Is there a value in using map() vs for?

    - by roder
    Does map() iterate through the list like "for" would? Is there a value in using map vs for? If so, right now my code looks like this: for item in items: item.my_func() If it makes sense, I would like to make it map(). Is that possible? What is an example like?

    Read the article

  • how to remove empty tags in input xml

    - by SGB
    My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

  • select redirection

    - by Lormitto
    Hi, While considering another problem one question appeared. I do not know how to write html when I want to redirect page when select option changes. In other words user chooses option from select list and page is redirected after that. Have you met anything like this? Regards,

    Read the article

  • Put Java Threading Class into a separate class

    - by erlord
    Consider following SWT code example: http://dev.eclipse.org/viewcvs/index.cgi/org.eclipse.swt.snippets/src/org/eclipse/swt/snippets/Snippet151.java?view=co How can I separate the inline defined class? Thread thread = new Thread() { public void run() { ... } }; I want to define a separate class which updates the table just like it does here. How do I pass the list back to the table? Example code?

    Read the article

  • how to select posts by particular author? (wordpress)

    - by Radek
    I have a page with template No Sidebars I want to list 5 posts' titles on that page by author where the author's name = page's title any idea how to do so without using any plugin? I thought that query_posts function would do the trick but this important note kind of tells me that I cannot use query_posts

    Read the article

  • Linq qurery with multiple where's

    - by Dan
    I am trying the to query my Status Update repository using the following var result = (from s in _dataContext.StatusUpdates where s.Username == "friend1" && s.Username == "friend2" etc... select s).ToList(); Insead of using s.Username == "friendN" continously is there anyway I can pass a list or array or something like that rather that specifying each one, or can i use a foreach loop in the middle of the query. Thanks

    Read the article

  • how to show video or movie file into UIImagePickerController?

    - by rakesh-bhatt99
    I am using UIImagePickerController that gives user to be able select an existing photo or use the camera to take an image at that time. And i can show that image in my application with UIImageView. Now i want to use this ability for movies also. But i couldn't find any way to show the selected movie as an image in my app, just like the Photos app. as you know you can see photos and movies in the same list.

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • c# midiInGetDevCaps Midi Device Names

    - by user330403
    HI, Iv used the following code from this link. http://stackoverflow.com/questions/1991159/getting-signals-from-a-midi-port-in-c/2024835%232024835 Im wondering what i need to add to able to get a list of device names. Iv looked the MSDN website and found i need to implement midiInGetDevCaps and its a associated Struct. But iv never really done anything with dll imports and structs before so im a bit lost

    Read the article

  • question with its query

    - by user329820
    Hi this is my homework and the question is this: List the average balance of customers by city and short zip code (the first five digits of thezip code). Only include customers residing in Washington State (‘WA’). also the Customer table has 5 columns(Name,Family,CustZip,CustCity,CustAVGBal) I wrote the query like below is this correct? SELECT CustCity,LEFT(CustZip,5) AS NewCustZip,CustAVGBal FROM Customer WHERE CustCity = 'WA' THANKS!!

    Read the article

  • How do I restrict foreign keys choices to related objects only in django

    - by Jeff Mc
    I have a two way foreign relation similar to the following class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True) class Child(models.Model): name = models.CharField(max_length=255) myparent = models.ForeignKey(Parent) How do I restrict the choices for Parent.favoritechild to only children whose parent is itself? I tried class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True, limit_choices_to = {"myparent": "self"}) but that causes the admin interface to not list any children.

    Read the article

  • Deceptive MySQL Query

    - by jerebear
    So I don't consider myself a novice at MySQL but this one has me stumped: I have a message board and I want to pull a list of all the most recent posts grouped by the Thread ID. Here's the table: MB_Posts -ID -Thread_ID -Created_On (timestamp) -Creator_User (user_id) -Subject -Contents -Edited (timestamp) -Reported I've tried many different things to keep it simple but I would like help from the community on this one. Just to kick this out there...this one does not work as expected: SELECT * FROM MB_Posts GROUP BY Thread_ID ORDER BY ID DESC

    Read the article

  • What kind of data belongs in a view model?

    - by Byron Sommardahl
    The name "view model" suggests that it models the data for the view. That much is obvious. What else can or should go in the view model? As an example, a view might display a list of items in a shopping cart, fields for customer's credit card info, and fields for customer's billing information. The view model might contain properties for all that OR it might only contain properties for the shopping cart items.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >