Search Results

Search found 19949 results on 798 pages for 'print css'.

Page 761/798 | < Previous Page | 757 758 759 760 761 762 763 764 765 766 767 768  | Next Page >

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • How to efficently build an interpreter (lexer+parser) in C?

    - by Rizo
    I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

    Read the article

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • Why does my Perl regular expression only find the last occurrence?

    - by scharan
    I have the following input to a Perl script and I wish to get the first occurrence of NAME="..." strings in each of the <table>...</table> structures. The entire file is read into a single string and the regex acts on that input. However, the regex always returns the last occurrence of NAME="..." strings. Can anyone explain what is going on and how this can be fixed? Input file: ADSDF <TABLE> NAME="ORDERSAA" line1 line2 NAME="ORDERSA" line3 NAME="ORDERSAB" </TABLE> <TABLE> line1 line2 NAME="ORDERSB" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSC" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSD" line3 line3 line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES2" line3 NAME="QUOTES3" NAME="QUOTES4" line3 NAME="QUOTES5" line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES6" NAME="QUOTES7" NAME="QUOTES8" NAME="QUOTES9" line3 line3 </TABLE> <TABLE> NAME="MyName IsKhan" </TABLE> Perl Code starts here: use warnings; use strict; my $nameRegExp = '(<table>((NAME="(.+)")|(.*|\n))*</table>)'; sub extractNames($$){ my ($ifh, $ofh) = @_; my $fullFile; read ($ifh, $fullFile, 1024);#Hardcoded to read just 1024 bytes. while( $fullFile =~ m#$nameRegExp#gi){ print "found: ".$4."\n"; } } sub main(){ if( ($#ARGV + 1 )!= 1){ die("Usage: extractNames infile\n"); } my $infileName = $ARGV[0]; my $outfileName = $ARGV[1]; open my $inFile, "<$infileName" or die("Could not open log file $infileName"); my $outFile; #open my $outFile, ">$outfileName" or die("Could not open log file $outfileName"); extractNames( $inFile, $outFile ); close( $inFile ); #close( $outFile ); } #call main();

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • Having issues with JQuery progress bar

    - by Roland
    I'm busy creating a poll but am experiencing issues creating a progress bar for a poll using jquery, thus I have a couple of options and then when the page loads the div tags should increase in width, but it's not doing anything only if I have on option in the poll code <?php foreach($votes as $v): ?> <div><?php echo $v['name'].':'; ?></div> <div> <?php echo 'Votes: '.$v['num'].' | '.$v['percent'].'%'; ?> </div> <script type="text/javascript"> load(<?=$v['name']?>,<?=$v['percent']?>); </script> <div style="width:100%; height:10px; background-color:#effdff;"><div id="<?=$v['name']?>" style=" height:10px; background-color:#ff0000;"></div></div> <br /> <?php endforeach; ?> <?php if(!empty($loginMsg)): ?> <?php echo $loginMsg; ?><br /> <?php endif; ?> Votes: <?php echo $totalVotes+$totalComments; ?> | Comments: <?php echo $totalComments ?> <script type="text/javascript"> var interval=''; var progress = 0; function load(id,val){ alert(id); if (interval=="") { interval=window.setInterval("display('"+id+"','"+val+"')",200); } } function display(id,val) { progress += 1; if(progress == val){ window.clearInterval(interval) interval = ''; progress = 0; } $("#"+id).css("width",progress+'%'); } </script>

    Read the article

  • How do I get the current time in a Windows 7 gadget?

    - by norlando02
    For my first windows gadget I'm trying to make one that displays the current time and date. The code below is what I have, but I can't figure out why the javascript is not running. Any ideas? <html> <head> http-equiv="Content-Type" content="text/html; charset=Unicode" /> <title>Clock</title> <style type="text/css"> body { width: 130px; height: 60px; margin: 1 1 1 2; } body { font-family: Segoe UI, Arial; font-size: 11px; font-weight: bold; white-space: nowrap; } </style> <script type="text/javascript"> var background; var interval; var connection_id; var timeZone; var now; function load() { try { interval = 1000; connection_id = 0; timeZone = System.Time.currentTimeZone; update(); } catch(e){} } function update() { try { now = new Date(Date.parse(System.Time.getLocalTime(timeZone))); curDate.innerHTML = now.format('M jS, Y'); curTime.innerHTML = now.format('h:i:s A'); clearTimeout(connection_id); connection_id = setTimeout("update()", interval); } catch(e) {} </script> </head> <body onload="load()"> <div id="curDate"> </div> <div id="curTime"> </div> </body> </html>

    Read the article

  • Why i get everytime the error-message that i've already sent the headers

    - by mikep
    Hey, i've another question about web-programming. I programmed a login script, but everytime when i try to login it says that i've send the header informations already. Here are the 2 files: <?php if($_GET['logout'] == 1) { setcookie('authorized', 1, time()-3600); } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Login - photoAdminSite</title> </head> <style type="text/css"> body { text-align: center; font-family: helvetica; } #loginForm { padding: 1em; background: #e3e3e3; width: 260px; margin: 3em auto 0; text-align: left; } </style> <body> <div id="loginForm"> <form method="post" action="confirm_login_credentials.php"> <h2>LOGIN</h2> <p>Username: <input type="text" name="username" /></p> <p>Password: <input type="password" name="password" /></p> <p><input type="submit" value="Login" name="submit" /></p> </form> </div> </body> </html> <?php $username = $_POST['username']; $password = $_POST['password']; require 'database.php'; $q = "SELECT id FROM users_photoadminsite WHERE user_name = '$username' AND password = '$password'"; $result = $mysqli->query($q) or die(mysqli_error()); if (mysqli_num_rows($result) == 1) { setcookie('authorized', 1, 0); header("Location: index.php"); } else { header("Location: login.php"); } ?> i would be really happy about some helpful answers.

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • c++ i need help with this program. everytime i try to run it, i got a problem

    - by FOXMULDERIZE
    1-the program must read numeric data from a file. 2-only one line per number 3-half way between those numbers is a negative number. 4-the program must sum those who are above the negative number in a acumulator an those below the negative number in another acumulator. 5-the black screen shall print both results and determined who is grater or equal. include include using namespace std; void showvalues(int,int,int[]); void showvalues2(int,int); void sumtotal(int,int); int main() { int total1=0; int total2=0; const int SIZE_A= 9; int arreglo[SIZE_A]; int suma,total,a,b,c,d,e,f; ifstream archivo_de_entrada; archivo_de_entrada.open("numeros.txt"); //lee/// for(int count =0 ;count < SIZE_A;count++) archivo_de_entrada>>arreglo[count] ; archivo_de_entrada.close(); showvalues(0,3,arreglo); showvalues2(5,8); sumtotal(total1,total2); system("pause"); return 0; } void showvalues(int a,int b,int arreglos) { int total1=0; //muestra//////////////////////// cout<< "los num son "; for(int count = a ;count <= b;count++) total1 += arreglos[count]; cout < } void showvalues2(int c,int d) { ////////////////////////////// int total2=0; cout<< "los num 2 son "; for(count =5 ;count <=8;count++) total2 = total2 + arreglo[count]; cout < void sumtotal(int e,int f) { ///////////////////////////////// cout<<"la suma de t1 y t2 es "; total= total1 + total2; cout< }

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Format form fields for bootstrap using rails+nokogiri

    - by user1116573
    I have the following in an initializer in a rails app that uses Twitter bootstrap so that it removes the div.field_with_errors that rails applies when validation fails on a field but also the initializer adds the help/validation text after the erroneous input field: require 'nokogiri' ActionView::Base.field_error_proc = Proc.new do |html_tag, instance| html = %(<div class="field_with_errors">#{html_tag}</div>).html_safe form_fields = [ 'textarea', 'input', 'select' ] elements = Nokogiri::HTML::DocumentFragment.parse(html_tag).css("label, " + form_fields.join(', ')) elements.each do |e| if e.node_name.eql? 'label' html = %(#{e}).html_safe elsif form_fields.include? e.node_name if instance.error_message.kind_of?(Array) html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message.join(',')}</span>).html_safe else html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message}</span>).html_safe end end end html end This works fine but I also need to apply the .error class to the surrounding div.control-group for each error. My initializer currently gives the following output: <div class="control-group"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> but I need something adding to my initializer so that it adds the .error class to the div.control-group like so: <div class="control-group error"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> The solution will probably need to allow for the fact that each validation error could have more than one label and input that are all within the same div.control-group (eg radio buttons / checkboxes / 2 text fields side by side). I assume it needs some sort of e.at_xpath() to find the div.control-group parent and add the .error class to it but I'm not sure how to do this. Can anyone help? PS This may all be possible using the formtastic or simple_form gems but I'd rather just use my own html if possible. EDIT If I put e['class'] = 'foo' in the if e.node_name.eql? 'label' section then it applies the class to the label so I think I just need to find the parent tag of e and then apply an .error class to it but I can't figure out what the xpath would be to get from label to its div.control-group parent; no combination of dots, slashes or whatever seems to work but xpath isn't my strong point.

    Read the article

< Previous Page | 757 758 759 760 761 762 763 764 765 766 767 768  | Next Page >