Search Results

Search found 21028 results on 842 pages for 'single player'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 795/842 | < Previous Page | 791 792 793 794 795 796 797 798 799 800 801 802  | Next Page >

  • Web SITE publishing, dynamic compilation, smoke & mirrors

    - by tbehunin
    When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • Why is FLD1 loading NaN instead?

    - by Bernd Jendrissek
    I have a one-liner C function that is just return value * pow(1.+rate, -delay); - it discounts a future value to a present value. The interesting part of the disassembly is 0x080555b9 : neg %eax 0x080555bb : push %eax 0x080555bc : fildl (%esp) 0x080555bf : lea 0x4(%esp),%esp 0x080555c3 : fldl 0xfffffff0(%ebp) 0x080555c6 : fld1 0x080555c8 : faddp %st,%st(1) 0x080555ca : fxch %st(1) 0x080555cc : fstpl 0x8(%esp) 0x080555d0 : fstpl (%esp) 0x080555d3 : call 0x8051ce0 0x080555d8 : fmull 0xfffffff8(%ebp) While single-stepping through this function, gdb says (rate is 0.02, delay is 2; you can see them on the stack): (gdb) si 0x080555c6 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 =R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 R2: Valid 0x4004ff147ae147ae1800 +63.77000000000000313 R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1861 IE PE SF TOP: 3 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0000 Instruction Pointer: 0x73:0x080555c3 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xdd45 And after the fld1: (gdb) si 0x080555c8 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 =R2: Special 0xffffc000000000000000 Real Indefinite (QNaN) R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1261 IE PE SF C1 TOP: 2 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0020 Instruction Pointer: 0x73:0x080555c6 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xd9e8 After this, everything goes to hell. Things get grossly over or undervalued, so even if there were no other bugs in my freeciv AI attempt, it would choose all the wrong strategies. Like sending the whole army to the arctic. (Sigh, if only I were getting that far.) I must be missing something obvious, or getting blinded by something, because I can't believe that fld1 should ever possibly fail. Even less that it should fail only after a handful of passes through this function. On earlier passes the FPU correctly loads 1 into ST(0). The bytes at 0x080555c6 definitely encode fld1 - checked with x/... on the running process. What gives?

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • User Defined Exceptions with JMX

    - by Daniel
    I have exposed methods for remote management in my application server using JMX by creating an MXBean interface, and a class to implement it. Included in this interface are operations for setting attributes on my server, and for getting the current value of attributes. For example, take the following methods: public interface WordManagerMXBean { public void addWord(String word); public WordsObject getWords(); public void removeWord(String word); } The WordsObject is a custom, serializable class used to retrieve data about the state of the server. Then I also have a WordManager class that implements the above interface. I then create a JMX agent to manage my resource: MBeanServer mbs = ManagementFactory.getPlatformMBeanServer(); ObjectName wordManagerName = new ObjectName("com.example:type=WordManager"); mbs.registerMBean(wordManager, wordManagerName); I have created a client that invokes these methods, and this works as expected. However, I would like to extend this current configuration by adding user defined exceptions that can be sent back to my client. So I would like to change my interface to something like this: public interface WordManagerMXBean { public void addWord(String word) throws WordAlreadyExistsException; public WordsObject getWords(); public void removeWord(String word); } My WordAlreadyExistsException looks like this: public class WordAlreadyExistsException extends Exception implements Serializable { private static final long serialVersionUID = -9095552123119275304L; public WordAlreadyExistsException() { super(); } } When I call the addWord() method in my client, I would like to get back a WordAlreadyExistsException if the word already exists. However, when I do this, I get an error like this: java.rmi.UnmarshalException: Error unmarshaling return; nested exception is: java.lang.ClassNotFoundException: com.example.WordAlreadyExistsException The WordAlreadyExistsException, the WordsObject and the WordManagerMXBean interface are all in a single jar file that is available to both the client and the server. If I call the getWords() method, the client has no difficulty handling the WordsObject. However, if a user defined exception, like the one above, is thrown, then the client gives the error shown above. Is it possible to configure JMX to handle this exception correctly in the client? Following some searching, I noticed that there is an MBeanException class that is used to wrap exceptions. I'm not sure if this wrapping is performed by the agent automatically, or if I'm supposed to do the wrapping myself. I tried both, but in either case I get the same error on the client. I have also tried this with both checked and unchecked exceptions, again the same error occurs. One solution to this is to simply pass back the error string inside a generic error, as all of the standard java exceptions work. But I'd prefer to get back the actual exception for processing by the client. Is it possible to handle user defined exceptions in JMX? If so, any ideas how?

    Read the article

  • Delphi Unit local variables - how to make each instance unique?

    - by Justin
    Ok, this, I'm sure is something simple that is easy to do. The problem : I've inherited scary spaghetti code and am slowly trying to better it when new features need adding - generally when a refactor makes adding the new feature neater. I've got a bunch of code I'm packing into a single unit which, in different places in the application, controls the same physical thing in the outside world. The control appears in several places in the application and operates slightly differently in each instance. What I've done is to create a unit with all of the features I need which I can simply drop, as a frame, into each form that requires it. Each form then uses the unit's interface methods to customise the behaviour for each instance. The problem within the problem : In the unit in question (the frame) I have a variable declared in the IMPLEMENTATION section - local to the unit. I also have a procedure, declared in the TYPE section which takes an argument and assigns that argument to the local variable in question - each form passes a unique variable to each instance of the frame/unit. What I want it to do is for each instance of the frame to keep its own version of that variable, different from the others, and use that to define how it operates. What seems to be happening, however, is that all instances are using the same value, even if I explicitly pass each instance a different variable. ie: Unit FlexibleUnit; interface uses //the uses stuff type TFlexibleUnit=class(TFrame) //declarations including procedure makeThisInstanceX(passMeTheVar:integer); private // public // end; implementation uses //the uses var myLocalVar; procedure makeThisInstanceX(passMeTheVar:integer); begin myLocalVar:=passMeTheVar; end; //other procedures using myLocalVar //etc to the end; Now somewhere in another Form I've dropped this Frame onto the Design pane, sometimes two of these frames on one Form, and have it declared in the proper places, etc. Each is unique in that : ThisFlexibleUnit : TFlexibleUnit; ThatFlexibleUnit : TFlexibleUnit; and when I do a: ThisFlexibleUnit.makeThisInstanceX(var1); //want to behave in way "var1" ThatFlexibleUnit.makeThisInstanceX(var2); //want to behave in way "var2" it seems that they both share the same variable "myLocalVar". Am I doing this wrong, in principle? If this is the correct method then it's a matter of debugging what I have (which is too huge to post) but if this is not correct in principle then is there a way to do what I am suggesting? Thanks in advance, Stack Overflow - you guys (and gals!) are legendary.

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • How would you implement this "WorkerChain" functionality in .NET?

    - by Dan Tao
    Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • objective C convert NSString to unsigned

    - by user1501354
    I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

    Read the article

  • To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

    - by Globalkeith
    Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • (mySQL) Unable to query 2 tables properly for data

    - by Devner
    I have 2 tables. One is 'page_links' and the other is 'rpp'. Table page_links is the superset of table rpp. The following is the schema of my tables: -- Table structure for table `page_links` -- CREATE TABLE IF NOT EXISTS `page_links` ( `page` varchar(255) NOT NULL, `page_link` varchar(100) NOT NULL, `heading_id` tinyint(3) unsigned NOT NULL, PRIMARY KEY (`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `page_links` -- INSERT INTO `page_links` (`page`, `page_link`, `heading_id`) VALUES ('a1.php', 'A1', 8), ('b1.php', 'B1', 8), ('c1.php', 'C1', 5), ('d1.php', 'D1', 5), ('e1.php', 'E1', 8), ('f1.php', 'F1', 8), ('g1.php', 'G1', 8), ('h1.php', 'H1', 1), ('i1.php', 'I1', 1), ('j1.php', 'J1', 8), ('k1.php', 'K1', 8), ('l1.php', 'L1', 8), ('m1.php', 'M1', 8), ('n1.php', 'N1', 8), ('o1.php', 'O1', 8), ('p1.php', 'P1', 4), ('q1.php', 'Q1', 5), ('r1.php', 'R1', 4); -- Table structure for table `rpp` -- CREATE TABLE IF NOT EXISTS `rpp` ( `role_id` tinyint(3) unsigned NOT NULL, `page` varchar(255) NOT NULL, `is_allowed` tinyint(1) NOT NULL, PRIMARY KEY (`role_id`,`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `rpp` -- INSERT INTO `rpp` (`role_id`, `page`, `is_allowed`) VALUES (3, 'a1.php', 1), (3, 'b1.php', 1), (3, 'c1.php', 1), (3, 'd1.php', 1), (3, 'e1.php', 1), (3, 'f1.php', 1), (3, 'h1.php', 1), (3, 'i1.php', 1), (3, 'l1.php', 1), (3, 'm1.php', 1), (3, 'n1.php', 1), (4, 'a1.php', 1), (4, 'b1.php', 1), (4, 'q1.php', 1), (5, 'r1.php', 1); WHAT I AM TRYING TO DO: I am trying to query both the above tables (in a single query) in such a way that all the pages from page_links are displayed along with the is_allowed value from rpp for a particular role. For example, I want to get the is_allowed value of all the pages from rpp for role_id = 3 and at the same time, list all the available pages from page_links. A clear example of my expected result would be: page is_allowed role_id ---------------------------------------- a1.php 1 3 b1.php 1 3 c1.php 1 3 d1.php 1 3 e1.php 1 3 f1.php 1 3 g1.php NULL NULL h1.php 1 3 i1.php 1 3 j1.php NULL NULL k1.php NULL NULL l1.php 1 3 m1.php 1 3 n1.php 1 3 o1.php NULL NULL p1.php NULL NULL q1.php NULL NULL r1.php NULL NULL One more example of my desired result could be achieved by doing a LEFT JOIN rpp ON page_links.page = rpp.page but we need to omit using role_id = 3 (or any value) to be able to get that. But I do want to specify the role_id as well and get the results. I need the query to be able to get this result. I would appreciate any replies that could help me with this. If you can suggest me any changes as well to the table(s) design to be able to achieve the desired result, that's good as well. Thanks in advance.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • match "//" comments with regex but not inside a quote

    - by Wireless102
    I need to match and replace some comments. for example: $test = "the url is http://www.google.com";// comment "<-- that quote needs to be matched I want to match the comments outside of the quotes, and replace any "'s in the comments with &quot;'s. I have tried a number of patterns and different ways of running them but with no luck. The regex will be run with javascript to match php "//" comments UPDATE: I took the regex from borkweb below and modified it. used a function from http://ejohn.org/blog/search-and-dont-replace/ and came up with this: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript"> function t_replace(data){ var q = {}, ret = ""; data.replace(/(?:((["'\/]*(("[^"]*")|('[^']*'))?[\s]*)?[\/\/|#][^"|^']*))/g, function(value){ q[key] = value; }); for ( var key in q ){ ret = q[key]; } var text = data.split(ret); var out = ret + text[1]; out = out.replace(/"/g,"&quot;"); out = out.replace(/'/g,"&apos;"); return text[0] + out; } </script> </head> <body> <script type="text/javascript"> document.write(t_replace("$test = \"the url is http://www.google.com\";// c'o\"mment \"\"\"<-- that quote needs to be matched")+"<br>"); document.write(t_replace("$test = 'the url is http://www.google.com';# c'o\"mment \"\"\"<-- that quote needs to be matched")); </script> </body> </html> it handles all the line comments outside of single or double quotes. Is there anyway I could optimize this function?

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 791 792 793 794 795 796 797 798 799 800 801 802  | Next Page >