Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 835/998 | < Previous Page | 831 832 833 834 835 836 837 838 839 840 841 842  | Next Page >

• What are the common compliance standards for software products?

  - by Jay

  This is a very generic question about software products. I would like to know what compliance standards are applicable to any software product. I know that question gives away nothing. So, here is an example to what I am referring to. CiSecurity Security Certification/Compliance lists out products ceritified by them to be compliant to the standards published at their website, i.e, cisecurity.org. Compliance could be as simple as answering a questionnaire for your product and approved by a thirdparty like cisecurity or it could apply to your whole organization, for instance, PCI-DSS compliance. I would be very interested in knowing the standards that products you know/designed/created, comply to. To give you the context behind this question: I am the developer of a data-masking tool. The said tool helps mask onscreen html text in a banking web application using filters. So, for instance, if the bank application lists out user information with ssn, my product when integrated with the banking product, automatically identifies ssn pattern and masks it into a pre-defined format.So, I have my product marketing team wanting more buzz words like compliance to be able to sell it to more banking clients. Hence, understanding "compliances that apply to products" is a key research item for me at this point. By which I meant, security compliances. Appreciate all your help and suggestions.

  Read the article

• javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

  - by Bill Dawes

  Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

  Read the article

• How to write a flexible modular program with good interaction possibilities between modules?

  - by PeterK

  I went through answers on similar topics here on SO but could't find a satisfying answer. Since i know this is a rather large topic, i will try to be more specific. I want to write a program which processes files. The processing is nontrivial, so the best way is to split different phases into standalone modules which then would be used as necessary (since sometimes i will be only interested in the output of module A, sometimes i would need output of five other modules, etc). The thing is, that i need the modules to cooperate, because the output of one might be the input of another. And i need it to be FAST. Moreover i want to avoid doing certain processing more than once (if module A creates some data which then need to be processed by module B and C, i don't want to run module A twice to create the input for modules B,C ). The information the modules need to share would mostly be blocks of binary data and/or offsets into the processed files. The task of the main program would be quite simple - just parse arguments, run required modules (and perhaps give some output, or should this be the task of the modules?). I don't need the modules to be loaded at runtime. It's perfectly fine to have libs with a .h file and recompile the program every time there is a new module or some module is updated. The idea of modules is here mainly because of code readability, maintaining and to be able to have more people working on different modules without the need to have some predefined interface or whatever (on the other hand, some "guidelines" on how to write the modules would be probably required, i know that). We can assume that the file processing is a read-only operation, the original file is not changed. Could someone point me in a good direction on how to do this in C++ ? Any advice is wellcome (links, tutorials, pdf books...).

  Read the article

• How to format the node_redis info function output?

  - by hh54188

  I want check the Redis info on my pc with node, so I use node_redis and run the info function: var redis = require("redis"), client = redis.createClient(); client.on("connect", function () { client.info(function (err, replay) { console.log(replay); }) }) but the response is un-format: `#Server\r\nredis_version:2.6.16\r\nredis_git_sha1:00000000\r\nredis_git_dirty:0\r\nredis_mode:standalone\r\nos:Linux 3.8.0-29-generic x86_64\r\narch_bits:64\r\nmultiplexing_api:epoll\r\ngcc_version:4.6.3\r\nprocess_id:2941\r\nrun_id:e60f261a6f4f6f081563a47961315eff6b1c005d\r\ntcp_port:6379\r\nuptime_in_seconds:1777\r\nuptime_in_days:0\r\nhz:10\r\nlru_clock:2040689\r\n\r\n# Clients\r\nconnected_clients:2\r\nclient_longest_output_list:0\r\nclient_biggest_input_buf:0\r\nblocked_clients:0\r\n\r\n# Memory\r\nused_memory:562584\r\nused_memory_human:549.40K\r\nused_memory_rss:2031616\r\nused_memory_peak:561784\r\nused_memory_peak_human:548.62K\r\nused_memory_lua:31744\r\nmem_fragmentation_ratio:3.61\r\nmem_allocator:jemalloc-3.2.0\r\n\r\n# Persistence\r\nloading:0\r\nrdb_changes_since_last_save:0\r\nrdb_bgsave_in_progress:0\r\nrdb_last_save_time:1383553917\r\nrdb_last_bgsave_status:ok\r\nrdb_last_bgsave_time_sec:-1\r\nrdb_current_bgsave_time_sec:-1\r\naof_enabled:0\r\naof_rewrite_in_progress:0\r\naof_rewrite_scheduled:0\r\naof_last_rewrite_time_sec:-1\r\naof_current_rewrite_time_sec:-1\r\naof_last_bgrewrite_status:ok\r\n\r\n# Stats\r\ntotal_connections_received:3\r\ntotal_commands_processed:5\r\ninstantaneous_ops_per_sec:0\r\nrejected_connections:0\r\nexpired_keys:0\r\nevicted_keys:0\r\nkeyspace_hits:0\r\nkeyspace_misses:0\r\npubsub_channels:0\r\npubsub_patterns:0\r\nlatest_fork_usec:0\r\n\r\n# Replication\r\nrole:master\r\nconnected_slaves:0\r\n\r\n# CPU\r\nused_cpu_sys:0.13\r\nused_cpu_user:0.19\r\nused_cpu_sys_children:0.00\r\nused_cpu_user_children:0.00\r\n\r\n# Keyspace\r\n' How can I turn it to an object? like: { redis_version:2.6.16, redis_git_sha1:00000000, redis_git_dirty:0, ...... } so that I can read each property's value, get information I need

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Ember Data Sycn - LocalStorage+REST+RealTime+Online/Offline

  - by Miguel Madero

  We have a combination of requirements in terms o data access. Pre-load some reference data. We need reference data to survive browser restarts instead of just living in memory to avoid loading it all the time. I'm currently using the LocalStorageAdapter for that. Once we have it, we would like to sync changes (polling or using Socket.IO in the background and updating the LocalStorage could do the trick) There're other models that are more transactional, where we would need to directly go to the Server and get/save them. It would be nice to use something like the RESTAdapter for that. Lastly, there're some operations that should work off-line and changes should be synced later. To make it more concrete: * We pre-load vendor and "favorite products" into Local Storage. We work offline with those. * We need to sync server changes to vendor and product information. * If they search the full catalog, that requires them to be online. * When offline, we need to allow users to add something to their cart or even submit and order. We would like to queue this action and submit it when they have an Internet Connection. So a few questions are derived from this: * Is there a way to user RESTAdapter in combination with LocalStorage? * Is there some Socket.IO support? (Happy to do this part manually) * Is there Queueing support? Ideally at the Ember-Data level. I know we will have to do a lot of this manually and pull together the different lego pieces, but I wanted to ask for some perspective from experience Ember devs.

  Read the article

• Is there a tool for managing redundant pages across a website?

  - by dmanexe

  I am in charge of constructing a website with a '2-dimensional' site map, as explained later. I am looking for (preferably a Wordpress plugin, as the site is built in Wordpress already) that would make managing thousands of pages a lot easier. To explain further, let me iterate my situation. I am building a website for a construction company, and they have several key cities and several key services. Now, they want a parent page for each service, and another unique page for the child sub-service, and finaly, a grandchild page for the city they are performing the service in. For example, if they were doing Concrete Construction in Los Angeles, the URL would look like: /concrete/construction/los-angeles The content on /los-angeles would be the same as on /malibu, or /burbank. However, there would be a different set of content for /concrete/design/los-angeles, but the entire page content (sans a few variables with city names) would be the same. Is there a way to manage or automate 'matrixing' this information on the site? I am looking for a tool that would allow me to easily add a 'city' with the same content across all grandchildren, per the child's content requirements. All of the grandchildren pages will have redundant content across them. Should something like this not exist, how difficult would it be to create, as a freelance side project? I need a tool like this, because I am approaching about ~500 cities and 50 services (Concrete Construction, Concrete Design, Concrete Engineering, etc)

  Read the article

• Encrypt a file base upon a pregenerated "key" C#

  - by Anubis

  Hello everyone. I'm trying to determine the best course of action to implement a simple "licensing" system with a partner of mine. The concept is: Generate an encrypted value based upon several internal hardware components. Have the customer send this value to us which we will implement into our key generator. Once we have that, we add any other restrictions on the license (user, expires, etc.). From there we generate a file which we send to the customer they can add to their installation and voila, happy people about. I have the first part all done. My next part is trying to figure out which encryption methodology I would need to use. I already know Symmetric Encryption is pretty much the only route I can take. Most of the information I have found involves .NET already creating a key from its own internal methods. That's a bit of background, my question is: "Which encryption method could I use which would allow me to encrypt the restrictions based upon the "id" I was given from the customer's computer?" I'm writing this in C# by the way. Any ideas would be greatly appreciated! Take Care!

  Read the article

• Reference - What does this error mean in PHP?

  - by hakre

  On Stackoverflow you can see a lot of questions popping up about errors. Some users do not even know that error messages exists, others are asking about code that gives an error message but they do not understand the error message. If the error message is common, many questions about the same kind of error appears, but it is hard to find existing Q&A about the topic. Please add "your favorite" error message, one per answer, a short description what it means (even if it is only highlighting terms to their manual page) and a listing of existing Q&A that are of value. This will create a list. The question is a community wiki, so you are not answering for reputation but for creating a reference list for new users. It's based on error messages. Compare with the existing Reference - What does this symbol mean in PHP? question, which works pretty well. What are common errors in PHP and what are their Solutions. Index of Errors Just starting, but there are already some: Warning: Cannot modify header information - headers already sent Warning: mysql_fetch_array() expects parameter 1 to be resource, boolean given in ... on line Parse error: syntax error, unexpected T_XXX in YYY on line ZZZ Fatal Error: Call to a member function ... on a non-object

  Read the article

• Jboss 6 Cluster Singleton Clustered

  - by DanC

  I am trying to set up a Jboss 6 in a clustered environment, and use it to host clustered stateful singleton EJBs. So far we succesfully installed a Singleton EJB within the cluster, where different entrypoints to our application (through a website deployed on each node) point to a single environment on which the EJB is hosted (thus mantaining the state of static variables). We achieved this using the following configuration: Bean interface: @Remote public interface IUniverse { ... } Bean implementation: @Clustered @Stateful public class Universe implements IUniverse { private static Vector<String> messages = new Vector<String>(); ... } jboss-beans.xml configuration: <deployment xmlns="urn:jboss:bean-deployer:2.0"> <!-- This bean is an example of a clustered singleton --> <bean name="Universe" class="Universe"> </bean> <bean name="UniverseController" class="org.jboss.ha.singleton.HASingletonController"> <property name="HAPartition"><inject bean="HAPartition"/></property> <property name="target"><inject bean="Universe"/></property> <property name="targetStartMethod">startSingleton</property> <property name="targetStopMethod">stopSingleton</property> </bean> </deployment> The main problem for this implementation is that, after the master node (the one that contains the state of the singleton EJB) shuts down gracefuly, the Singleton's state is lost and reset to default. Please note that everything was constructed following the JBoss 5 Clustering documents, as no JBoss 6 documents were found on this subject. Any information on how to solve this problem or where to find JBoss 6 documention on clustering is appreciated.

  Read the article

• Drupal WebForm with CCK content types. For anonymous users.

  - by thepearson

  I am probably asking a noob question... however: I have a Drupal site that the customer has a web form where anonymous users can fill in to order some posters (there is 3 to choose from). These are free and at the moment they user just states in the body of a textarea what posters they want. The site owner wants to now add more posters and now wants the ability to have each poster listed in the web form with a field for quantity next to them. When the web for is submitted it will post the node title and quantity to the web form along with the required information. I have researched using UC but it's too much of a eCom solution for such a simple requirement. I also looked at SimpleCart, Flag and Session favorites, all of which aren't really what I need. So I am looking for a simple way to itterate over all the "Poster" content types, and display them on the webform page with a quantity numerical field to be submitted with the web form for each poster. Currently I have: CCK Poster Title Image WebForm OrderPoster Name Email Address Details What I am looking for is a page that does the following: WebForm OrderPosters: Poster 1 [form qty text input for poster 1] Poster 2 [form qty text input for poster 2] Poster 3 [form qty text input for poster 3] ... Poster n [form qty text input for posters n] Name Email Address Details I'd imagine there is a simple way to do this, but I can't seem to find articles of customizing "WebForm" forms. Any help would be much appreciated.

  Read the article

• PHP form processing - how to capture text from field that has variable Name/ID

  - by user80151

  I have a form that has a field pulled from the database as a dropdown. I need to get the text selected in the dropdown but I don't know in advance what the field ID will be. This is basically just a form that has already been generated. I don't need to pull anything from the database, it's already on this page. All I need to do is get the form information and email it, no writing to the database. I know how to do the _Request for the other fields based on the ID but I'm not sure how to do this one. The ID changes. It can be ID=1, ID-2, etc. I need to do something like: _REQUEST form element where ID is LIKE "ID[*]" or something similar. Any suggestions or links to tutorials? Here are a couple samples of what the dropdown renders on the page: <div class="wrapperAttribsOptions"> <h4 class="optionName back"><label class="attribsSelect" for="attrib- 1">Model</label></h4> <div class="back"> <select name="id[1]" id="attrib-1"> <option value="45">VC3-4C</option> <option value="1">VC3-4PG</option> <option value="3">VC3-4SG</option> <div class="wrapperAttribsOptions"> <h4 class="optionName back"><label class="attribsSelect" for="attrib-14">SPK Model</label></h4> <div class="back"> <select name="id[14]" id="attrib-14"> <option value="43">SPK-4</option> <option value="44">SPK-8</option> </select> TIA

  Read the article

• C++: parsing with simple regular expression or shoud I use sscanf?

  - by Helltone

  I need to parse a string like func1(arg1, arg2); func2(arg3, arg4);. It's not a very complex parsing problem, so I would prefer to avoid resorting to flex/bison or similar utilities. My first approch was to try to use POSIX C regcomp/regexec or Boost implementation of C++ std::regex. I wrote the following regular expression, which does not work (I'll explain why further on). "^" "[ ;\t\n]*" "(" // (1) identifier "[a-zA-Z_][a-zA-Z0-9_]*" ")" "[ \t\n]*" "(" // (2) non-marking "\[" "(" // (3) non-marking "[ \t]*" "(" // (4..n-1) argument "[a-zA-Z0-9_]+" ")" "[ \t\n]*" "," ")*" "[ \t\n]*" "(" // (n) last argument "[a-zA-Z0-9_]+" ")" "]" ")?" "[ \t\n]*" ";" Note that the group 1 captures the identifier and groups 4..n-1 are intended to capture arguments except the last, which is captured by group n. When I apply this regex to, say func(arg1, arg2, arg3) the result I get is an array {func, arg2, arg3}. This is wrong because arg1 is not in it! The problem is that in the standard regex libraries, submarkings only capture the last match. In other words, if you have for instance the regex "((a*|b*))*" applied on "babb", the results of the inner match will be bb and all previous captures will have been forgotten. Another thing that annoys me here is that in case of error there is no way to know which character was not recognized as these functions provide very little information about the state of the parser when the input is rejected. So I don't know if I'm missing something here... In this case should I use sscanf or similar instead? Note that I prefer to use C/C++ standard libraries (and maybe boost).

  Read the article

• Python CGI Premature end of script error depending on script parameters.

  - by nickengland

  I have a python script which should parse a file and produce some output to disk, as well as returning a webpage linking to the outputted files. When run with a file posted from the HTML form I get no HTML output back, just a 500 error page and the error_log contains the line: [Mon Apr 19 15:03:23 2010] [error] [client xxx.xxx.121.79] Premature end of script headers: uploadcml.py, referer: http://xxx.ch.cam.ac.uk:9000/ However, the files which the script should be saving are indeed saved to disk. If I run it without any arguments, the script returns the correct HTML indicating no file was parsed. All the information I have found on the web about Premature end of script headers implies it is due to either a missing header, or lack of permissions on the python script but neither can apply to me. The first lines of the script are: #!/home/nwe23/bin/bin/python import cgitb; cgitb.enable() import cgi import pybel,openbabel import random print "Content-Type: text/html" print so when run, I can see no way for it to fail to output the header, and it DOES output the header when run without a file to parse, but when given a file produces the error(but still parsed the file and saves the output to disk!). Does anyone know how this is happening and what can be done to fix it? I have tried adding wrongly-indented gibberish (such as foobar) at various points in the file, and this results in adding an indent error to the error_log wherever it is, even if its the very last line in the script. The Premature script headers error remains though. Does this mean the script is executing all the way through?

  Read the article

• How to debug a Gruntfile with breakpoints using node-inspector?

  - by Kris Hollenbeck

  So I have spent the past couple days trying to get this to work with no luck. Most of the solutions I have found seem to work "okay" for debugging node applications. But I haven't had much luck debugging grunt stand alone. I would like to be able to set breakpoints in my gruntfile and either step through the code with either the browser or an IDE. I have tried the following: Debugging using intelliJ IDE Using Grunt Console (Process finished with exit code 6) Debugging with Nodeeclipse (This sort of works okay but doesn't hit the breakpoints set in eclipse, not very intuitive) Debugging using node-inspector (This one also sort of works. I can step through a little ways using F11 and F10 in chrome. But eventually it just crashes. Using F8 to skip to break point never works.) ERROR MESSAGE USING NODE-INSPECTOR So currently node-inspector feels like it has gotten me the closest to what I want. To get here I did the following: From my grunt directory I ran the following commands: grunt node-inspector node --debug-brk Gruntfile.js And then from there I went to localhost:8080/debug?port=5858 to debug my Gruntfile.js. But like I mentioned above, as soon as I hit F8 to skip to breakpoint it crashes with the above error. Has anybody had any success using this method to try to debug a Gruntfile? So far from my search efforts I have not found a very well documented way of doing this. So hopefully this will be useful or beneficial information for future users. Also I am using Windows 7 by the way. Thanks in advance.

  Read the article

• JDBC transaction dead-lock solution required?

  - by user49767

  It's a scenario described my friend and challenged to find solution. He is using Oracle database and JDBC connection with read committed as transaction isolation level. In one of the transaction, he updates a record and executes selects statement and commits the transaction. when everything happening within single thread, things are fine. But when multiple requests are handled, dead-lock happens. Thread-A updates a record. Thread B updates another record. Thread-A issues select statement and waits for Thread-B's transaction to complete the commit operation. Thread-B issues select statement and waits for Thread-A's transaction to complete the commit operation. Now above causes dead-lock. Since they use command pattern, the base framework allows to issue commit only once (at the end of all the db operation), so they are unable to issue commit immediately after select statement. My argument was Thread-A supposed to select all the records which are committed and hence should not be issue. But he said that Thread-A will surely wait till Thread-B commits the record. is that true? What are all the ways, to avoid the above issue? is it possible to change isolation-level? (without changing underlying java framework) Little information about base framework, it is something similar to Struts action, their each and every request handled by one action, transaction begins before execution and commits after execution.

  Read the article

• C++ Switch won't compile with externally defined variable used as case

  - by C Nielsen

  I'm writing C++ using the MinGW GNU compiler and the problem occurs when I try to use an externally defined integer variable as a case in a switch statement. I get the following compiler error: "case label does not reduce to an integer constant". Because I've defined the integer variable as extern I believe that it should compile, does anyone know what the problem may be? Below is an example: test.cpp #include <iostream> #include "x_def.h" int main() { std::cout << "Main Entered" << std::endl; switch(0) { case test_int: std::cout << "Case X" << std::endl; break; default: std::cout << "Case Default" << std::endl; break; } return 0; } x_def.h extern const int test_int; x_def.cpp const int test_int = 0; This code will compile correctly on Visual C++ 2008. Furthermore a Montanan friend of mine checked the ISO C++ standard and it appears that any const-integer expression should work. Is this possibly a compiler bug or have I missed something obvious? Here's my compiler version information: Reading specs from C:/MinGW/bin/../lib/gcc/mingw32/3.4.5/specs Configured with: ../gcc-3.4.5-20060117-3/configure --with-gcc --with-gnu-ld --with-gnu-as --host=mingw32 --target=mingw32 --prefix=/mingw --enable-threads --disable-nls --enable-languages=c,c++,f77,ada,objc,java --disable-win32-registry --disable-shared --enable-sjlj-exceptions --enable-libgcj --disable-java-awt --without-x --enable-java-gc=boehm --disable-libgcj-debug --enable-interpreter --enable-hash-synchronization --enable-libstdcxx-debug Thread model: win32 gcc version 3.4.5 (mingw-vista special r3)

  Read the article

• Looping through a file in VB.NET

  - by Ousman

  I am writing a VB.NET program and I'm trying to accomplish the following: Read and loop through a text file line by line Show the event of the loop on a textbox or label until a button is pressed The loop will then stop on any number that happened to be at the loop event and When a button is pressed again the loop will continue. Code Imports System.IO Public Class Form1 'Dim nFileNum As Integer = FreeFile() ' Get a free file number Dim strFileName As String = "C:\scb.txt" Dim objFilename As FileStream = New FileStream(strFileName, _ FileMode.Open, FileAccess.Read, FileShare.Read) Dim objFileRead As StreamReader = New StreamReader(objFilename) 'Dim lLineCount As Long 'Dim sNextLine As String Private Sub btStart_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles btStart.Click Try If objFileRead.ReadLine = Nothing Then MsgBox("No Accounts Available to show!", _ MsgBoxStyle.Information, _ MsgBoxStyle.DefaultButton2 = MsgBoxStyle.OkOnly) Return Else Do While (objFileRead.Peek() > -1) Loop lblAccounts.Text = objFileRead.ReadLine() 'objFileRead.Close() 'objFilename.Close() End If Catch ex As Exception MessageBox.Show(ex.Message) Finally 'objFileRead.Close() 'objFilename.Close() End Try End Sub Private Sub Form1_Load(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles MyBase.Load End Sub End Class Problem I'm able to read the text file but my label will only loop if I hit the start button. It goes to the next line, but I want it to continue to loop through the entire file until I hit a button telling it to stop.

  Read the article

• Detecting an online poker cheat

  - by Tom Gullen

  It recently emerged on a large poker site that some players were possibly able to see all opponents cards as they played through exploiting a security vulnerability that was discovered. A naïve cheater would win at an incredibly fast rate, and these cheats are caught very quickly usually, and if not caught quickly they are easy to detect through a quick scan through their hand histories. The more difficult problem occurs when the cheater exhibits intelligence, bluffing in spots they are bound to be called in, calling river bets with the worst hands, the basic premise is that they lose pots on purpose to disguise their ability to see other players cards, and they win at a reasonably realistic rate. Given: A data set of millions of verified and complete information hand histories Theoretical unlimited computer power Assume the game No Limit Hold'em, although suggestions on Omaha or limit poker may be beneficial How could we reasonably accurately classify these cheaters? The original 2+2 thread appeals for ideas, and I thought that the SO community might have some useful suggestions. It's an interesting problem also because it is current, and has real application in bettering the world if someone finds a creative solution, as there is a good chance genuine players will have funds refunded to them when identified cheaters are discovered.

  Read the article

• SQL Server service broker reporting as off when I have written a query to turn it on

  - by dotnetdev

  I have made a small ASP.NET website. It uses sqlcachedependency The SQL Server Service Broker for the current database is not enabled, and as a result query notifications are not supported. Please enable the Service Broker for this database if you wish to use notifications. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.InvalidOperationException: The SQL Server Service Broker for the current database is not enabled, and as a result query notifications are not supported. Please enable the Service Broker for this database if you wish to use notifications. Source Error: Line 12: System.Data.SqlClient.SqlDependency.Start(connString); This is the erroneous line in my global.asax. However, in sql server (2005), I enabled service broker like so (I connect and run the SQL Server service when I debug my site): ALTER DATABASE mynewdatabase SET ENABLE_BROKER with rollback immediate And this was successful. What am I missing? I am trying to use sql caching dependency and have followed all procedures. Thanks

  Read the article

• Silverlight WinDg Memory Release Issue

  - by Chris Newton

  Hi, I have used WinDbg succesfully on a number of occasions to track down and fix memory leaks (or more accurately the CLRs inability to garbage collect a released object), but am stuck with one particular control. The control is displayed within a child window and when the window is closed a reference to the control remains and cannot be garbage collected. I have resolved what I believe to be the majority of the issues that could have caused the leak, but the !gcroot of the affected object is not clear (to me at least) as to what is still holding on to this object. The ouput is always the same regardless of the content being presented in the child window: DOMAIN(03FB7238):HANDLE(Pinned):79b12f8:Root: 06704260(System.Object[])- 05719f00(System.Collections.Generic.Dictionary2[[System.IntPtr, mscorlib],[System.Object, mscorlib]])-> 067c1310(System.Collections.Generic.Dictionary2+Entry[[System.IntPtr, mscorlib],[System.Object, mscorlib]][])- 064d42b0(System.Windows.Controls.Grid)- 064d4314(System.Collections.Generic.Dictionary2[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]])-> 064d4360(System.Collections.Generic.Dictionary2+Entry[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]][])- 064d3860(System.Windows.Controls.Border)- 064d4218(System.Collections.Generic.Dictionary2[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]])-> 064d4264(System.Collections.Generic.Dictionary2+Entry[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]][])- 064d3bfc(System.Windows.Controls.ContentPresenter)- 064d3d64(System.Collections.Generic.Dictionary2[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]])-> 064d3db0(System.Collections.Generic.Dictionary2+Entry[[MS.Internal.IManagedPeerBase, System.Windows],[System.Object, mscorlib]][])- 064d3dec(System.Collections.Generic.Dictionary2[[System.UInt32, mscorlib],[System.Windows.DependencyObject, System.Windows]])-> 064d3e38(System.Collections.Generic.Dictionary2+Entry[[System.UInt32, mscorlib],[System.Windows.DependencyObject, System.Windows]][])- 06490b04(Insurer.Analytics.SharedResources.Controls.HistoricalKPIViewerControl) If anyone has any ideas about what could potentially be the problem, or if you require more information, please let me know. Kind Regards, Chris

  Read the article

• Programming time schedule for porting a program.

  - by Lothar

  I'm working on a large program which has an abstracted GUI API. It is very GUI based, many dialogs and a few nasty features which rely heavily on the message flow of the GUI (correct sequences of focus/mouse/active handling etc.) - not easy to port I now want to port it from the currently used FOX Toolkit to native Cocoa/MFC. I give myself a timeframe until the end of the year but my main work will be to continue development work with the existing toolkit, but there is no planned release for end customers before both tasks are done. My question is how should i spend my time? Stop working on the main program and do a 90% port (about 3 month) of the GUI first Splitting everything into smaller sessions of one month each. Assigning Monday/Tuesday to the GUI project and the rest of the week for the app. Finishing the App first, then port. I think there are three arguments which i need to balance. Motivation, i want to see something going on on both projects Brain Input Overflow, both tasks require a lot of detail information in my brain and sometimes enough is just enough. I guess the porting is intervowen so porting would also require a lot of code changes in the existing code and the new code that will be written in the meantime.

  Read the article

• getPackage() returning null when my JUnit test is run from Ant

  - by philharvey

  I'm having problems running a JUnit test. It runs fine in Eclipse, but now I'm trying to run it from the command-line using Ant. The problem is that the following code is returning null: getClass().getPackage(). I'm running my JUnit test like so: <junit fork="no" printsummary="yes" haltonfailure="no"> <classpath refid="junit.classpath" /> <batchtest fork="yes" todir="${reports.junit}"> <fileset dir="${junit.classdir}"> <include name="**/FileHttpServerTest.class" /> <exclude name="**/*$*" /> </fileset> </batchtest> <formatter type="xml" /> ... I Googled for this sort of error, and found a number of references to classloader misbehaviour. But I've found nothing gave me enough information to solve my problem. I really need getClass().getPackage() to not return null. Can anyone help me? Thanks, Phil

  Read the article

• Building a ctypes-"based" C library with distutils

  - by Robie Basak

  Following this recommendation, I have written a native C extension library to optimise part of a Python module via ctypes. I chose ctypes over writing a CPython-native library because it was quicker and easier (just a few functions with all tight loops inside). I've now hit a snag. If I want my work to be easily installable using distutils using python setup.py install, then distutils needs to be able to build my shared library and install it (presumably into /usr/lib/myproject). However, this not a Python extension module, and so as far as I can tell, distutils cannot do this. I've found a few references to people other people with this problem: Someone on numpy-discussion with a hack back in 2006. Somebody asking on distutils-sig and not getting an answer. Somebody asking on the main python list and being pointed to the innards of an existing project. I am aware that I can do something native and not use distutils for the shared library, or indeed use my distribution's packaging system. My concern is that this will limit usability as not everyone will be able to install it easily. So my question is: what is the current best way of distributing a shared library with distutils that will be used by ctypes but otherwise is OS-native and not a Python extension module? Feel free to answer with one of the hacks linked to above if you can expand on it and justify why that is the best way. If there is nothing better, at least all the information will be in one place.

  Read the article

• In App Purchase Unique Identifying Data

  - by dageshi

  O.K so I'm writing a iPhone travel guide, you purchase a subscription to a travel guide for 3 months, it downloads a fairly hefty database and for 3 months that database gets updated weekly with new stuff. Now what I'd like to do is make the user enter their email address as a one off action before they purchase their first guide, for China say. The purpose for doing this is 1) To allow me to contact the user by email when they add a note/tip for a particular place (the app will allow them to send notes & information to me) 2) To Uniquely identify who has purchased the subscription so that if they wipe their device and reinstall the app they can plug the email address in and pickup their subscriptions again. Or so they can use the same subscription on another device they own. My concerns are 1) Will Apple allow the email method of restoring functionality to a second or restored device? 2) As long as I tell the user what I'm using their email address for (aka I won't sell it to anyone else and use it for X purposes) will it be o.k to ask for said email address? And as a side note, can I tack the devices unique id onto my server comms to track devices or is apple going to through a hissy fit about that as well?

  Read the article

< Previous Page | 831 832 833 834 835 836 837 838 839 840 841 842  | Next Page >