Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 838/998 | < Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >

  • Python: Created nested dictionary from list of paths

    - by sberry2A
    I have a list of tuples the looks similar to this (simplified here, there are over 14,000 of these tuples with more complicated paths than Obj.part) [ (Obj1.part1, {<SPEC>}), (Obj1.partN, {<SPEC>}), (ObjK.partN, {<SPEC>}) ] Where Obj goes from 1 - 1000, part from 0 - 2000. These "keys" all have a dictionary of specs associated with them which act as a lookup reference for inspecting another binary file. The specs dict contains information such as the bit offset, bit size, and C type of the data pointed to by the path ObjK.partN. For example: Obj4.part500 might have this spec, {'size':32, 'offset':128, 'type':'int'} which would let me know that to access Obj4.part500 in the binary file I must unpack 32 bits from offset 128. So, now I want to take my list of strings and create a nested dictionary which in the simplified case will look like this data = { 'Obj1' : {'part1':{spec}, 'partN':{spec} }, 'ObjK' : {'part1':{spec}, 'partN':{spec} } } To do this I am currently doing two things, 1. I am using a dotdict class to be able to use dot notation for dictionary get / set. That class looks like this: class dotdict(dict): def __getattr__(self, attr): return self.get(attr, None) __setattr__ = dict.__setitem__ __delattr__ = dict.__delitem__ The method for creating the nested "dotdict"s looks like this: def addPath(self, spec, parts, base): if len(parts) > 1: item = base.setdefault(parts[0], dotdict()) self.addPath(spec, parts[1:], item) else: item = base.setdefault(parts[0], spec) return base Then I just do something like: for path, spec in paths: self.lookup = dotdict() self.addPath(spec, path.split("."), self.lookup) So, in the end self.lookup.Obj4.part500 points to the spec. Is there a better (more pythonic) way to do this?

    Read the article

  • Http authentication with apache httpcomponents

    - by matdan
    Hi, I am trying to develop a java http client with apache httpcomponents 4.0.1. This client calls the page "https://myHost/myPage". This page is protected on the server by a JNDIRealm with a login form authentication, so when I try to get https://myHost/myPage I get a login page. I tried to bypass it unsuccessfully with the following code : //I set my proxy HttpHost proxy = new HttpHost("myProxyHost", myProxyPort); //I add supported schemes SchemeRegistry supportedSchemes = new SchemeRegistry(); supportedSchemes.register(new Scheme("http", PlainSocketFactory .getSocketFactory(), 80)); supportedSchemes.register(new Scheme("https", SSLSocketFactory .getSocketFactory(), 443)); // prepare parameters HttpParams params = new BasicHttpParams(); HttpProtocolParams.setVersion(params, HttpVersion.HTTP_1_1); HttpProtocolParams.setContentCharset(params, "UTF-8"); HttpProtocolParams.setUseExpectContinue(params, true); ClientConnectionManager ccm = new ThreadSafeClientConnManager(params, supportedSchemes); DefaultHttpClient httpclient = new DefaultHttpClient(ccm, params); httpclient.getParams().setParameter(ConnRoutePNames.DEFAULT_PROXY, proxy); //I add my authentication information httpclient.getCredentialsProvider().setCredentials( new AuthScope("myHost/myPage", 443), new UsernamePasswordCredentials("username", "password")); HttpHost host = new HttpHost("myHost", 443, "https"); HttpGet req = new HttpGet("/myPage"); //show the page ResponseHandler<String> responseHandler = new BasicResponseHandler(); String rsp = httpClient.execute(host, req, responseHandler); System.out.println(rsp); When I run this code, I always get the login page, not myPage. How can I apply my credential parameters to avoid this login form? Any help would be fantastic

    Read the article

  • mootools get data of child element of li?

    - by sea_1987
    Hi there, I am trying to get some information of a child element of an li using mootools, essentially my html looks like this, <li><a href="/home" id="home" class="nav-link">Home</a></li> I am wanting to be able get the id, class and href of the a tag using mootools, so far my javascript looks similar to this, $$('.rate').each(function(element,i){ element.addEvent('click', function(){ var myStyles = ['nostar', 'onestar', 'twostar', 'threestar', 'fourstar', 'fivestar', 'sixstar', 'sevenstar', 'eightstar', 'ninestar', 'tenstar']; myStyles.each(function(myStyle){ if(element.getParent().hasClass(myStyle)){ element.getParent().removeClass(myStyle) } }); myStyles.each(function(myStyle, index){ if(index == element.id){ element.getParent().toggleClass(myStyle); var req = new Request({ method:'post', url: '/recipes/save', data: {'rating' : element.id}, onRequest: function(){ alert('Request made. Please wait...');}, onComplete:function(response){ alert('Response:' + response);} }).send(); alert('Clicked '+element.id); alert(element.getChildren().get('href'); } }); }); }); The final alert in the script is my attempt to the child of the li(element) and its href.

    Read the article

  • .htaccess redirect or rewrite to default language url

    - by Saif Bechan
    I have a website that is currently in Dutch. Now I want to make the website multi-language starting with English. I am not that good at .htaccess files and the information on the web is quite confusing. The website I have now uses pretty urls, so all my urls look like this: http://mydomain.com/about/info http://mydomain.com/about/contact The code that I use for that is the following: <IfModule mod_rewrite.c> RewriteEngine on RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteCond %{REQUEST_FILENAME} !-l RewriteRule ^(.*)$ index.php?rt=$1 [L,QSA] </IfModule> I really do not know what this means, esp the [L,QSA]. But it's ok, it works for now. But now I want to add a default redirect to the code. So it becomes as follow http://mydomain.com becomes http://mydomain.com/nl I assume all my old links http://mydomain.com/about/info will not work anymore, but that is a step I am willing to take. Can someone please help me with this code. I have seen a lot of peaces of code, but I can not find the right one.

    Read the article

  • Which frameworks (and associated languages) support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this with the JVM thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of frameworks (and associated languages) that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular framework supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • What caused the rails application crash?

    - by so1o
    I'm sure someone can explain this. we have an application that has been in production for an year. recently we saw an increase in number of support requests for people having difficulty signing into the system. after scratching our head because we couldn't recreate the problem in development, we decided we'll switch on debug logger in production for a month. that was june 5th. application worked fine with the above change and we were waiting. then yesterday we noticed that the log files were getting huge so we made another change in production config.logger = Logger.new("#{RAILS_ROOT}/log/production.log", 50, 1048576) after this change, the application started crashing while processing a particular file. this particular line of code was RAILS_DEFAULT_LOGGER.info "Payment Information Request: ", request.inspect as you can see there was a comma instead of a plus sign. this piece of code was introduced in Mar. the question is this: why did the application fail now? if changing the debug level caused the application to process this line of code it should have started failing on june 5th! why today. please someone help us. Are we missing the obvious here? if you dont have an answer, at least let us know we aren't the only one that are bonkers.

    Read the article

  • VB.NET trying simple captcha

    - by Pride Grimm
    I'm trying to write a simple captcha program in vb.net. I'm just wanting to make an image from random numbers and display it, check the answer, and then proceed. I'm pretty new to vb.net, so I found some code to generate the information. I will cite the owner when I find it again (http://www.knowlegezone.com/80/article/Technology/Software/Asp-Net/Simple-ASP-NET-CAPTCHA-Tutorial) This is in the onload() of default2.aspx Public Sub returnNumer() Dim num1 As New Random Dim num2 As New Random Dim numQ1 As Integer Dim numQ2 As Integer Dim QString As String numQ1 = num1.Next(10, 15) numQ2 = num2.Next(17, 31) QString = numQ1.ToString + " + " + numQ2.ToString + " = " Session("answer") = numQ1 + numQ2 Dim bitmap As New Bitmap(85, 35) Dim Grfx As Graphics = Graphics.FromImage(bitmap) Dim font As New Font("Arial", 18, FontStyle.Bold, GraphicsUnit.Pixel) Dim Rect As New Rectangle(0, 0, 100, 50) Grfx.FillRectangle(Brushes.Brown, Rect) Grfx.DrawRectangle(Pens.PeachPuff, Rect) ' Border Grfx.DrawString(QString, font, Brushes.Azure, 0, 0) Response.ContentType = "Image/jpeg" bitmap.Save(Response.OutputStream, System.Drawing.Imaging.ImageFormat.Jpeg) bitmap.Dispose() Grfx.Dispose() End Sub So I put this in a separate page, like this This all works find and dandy, but when I get the answer from the session like this Dim literal As String = Convert.ToString(Session("answer")) It's always one behind. So if The images adds to 32, the answer in session isn't 32. But after a refresh (and a new image) the session("answer") will be 32. Is there a way to refresh the session on page 1, after the default2.aspx loads? Is there a better way to do this? I though about trying to run the code all on one page, and trying to set the src of and image to returnNumber(), but I need a bit of help on that one.

    Read the article

  • Programatically rebuild .exd-files when loading VBA

    - by aspartame
    Hi, After updating Microsoft Office 2007 to Office 2010 some custom VBA scripts embedded in our software failed to compile with the following error message: Object library invalid or contains references to object definitions that could not be found. As far as I know, this error is a result of a security update from Microsoft (Microsoft Security Advisory 960715). When adding ActiveX-controls to VBA scripts, information about the controls are stored in cache files on the local hard drive (.exd-files). The security update modified some of these controls, but the .exd-files were not automatically updated. When the VBA scripts try to load the old versions of the controls stored in the cached files, the error occurs. These cache-files must be removed from the hard drive in order for the controls to load successfully (which will create new, updated .exd-files automatically). What I would like to do is to programatically (using Visual C++) remove the outdated .exd-files when our software loads. When opening a VBA project using CApcProject::ApcProject.Open I set the following flag:axProjectThrowAwayCompiledState. TestHR(ApcProject.Open(pHost, (MSAPC::AxProjectFlag) (MSAPC::axProjectNormal | MSAPC::axProjectThrowAwayCompiledState))); According to the documentation, this flag should cause the VBA project to be recompiled and the temporary files to be deleted and rebuilt. I've also tried to update the checksum of the host application type library which should have the same effect. However none of these fixes seem to do the job and I'm running out of ideas. Help is very much appreciated!

    Read the article

  • CakePHP adding columns to a table

    - by vette982
    I have a Profile model/controller in my cake app as well as an index.ctp view in /views/profiles. Now, when I go to add a column to my table that is already filled with data, and then add the corresponding code to the view to pick up this column's data, it just gives me an empty result. My model: <?php class Profile extends AppModel { var $name = 'Profile'; } ?> My controller: <?php class ProfilesController extends AppController { var $name = 'Profiles'; function index() { $this->set('profiles', $this->Profile->find('all')); } } ?> My views printing (stripped down): <?php foreach ($profiles as $profile): ?> <?php echo $profile['Profile']['id']; ?> <?php echo $profile['Profile']['username']; ?> <?php echo $profile['Profile']['created']; ?> <?php echo $profile['Profile']['thumbnail'];?> <?php echo $profile['Profile']['account'];?> <?php endforeach; ?> Basically, the columns id, username, column, thumbnail always have been printing fine, but when I add a column called accountit returns no information (nothing prints, but no errors). Any suggestions?

    Read the article

  • Blackberry Asynchronous HTTP Requests - How?

    - by Kai
    The app I'm working on has a self contained database. The only time I need HTTP request is when the user first loads the app. I do this by calling a class that verifies whether or not a local DB exists and, if not, create one with the following request: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); This xml returns a list of content, all of which have images that I want to fetch AFTER the original request is complete and stored. So something like this won't work: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); HttpRequest images = new HttpRequest("http://www.somedomain.com/xmlImages", "GET", this); images.start(); Since it will not treat this like an asynchronous request. I have not found much information on adding callbacks to httpRequest, or any other method I could use to ensure operation 2 does not execute until operation 1 is complete. Any help would be appreciated. Thanks

    Read the article

  • Is DB logging more secure than file logging for my PHP web app?

    - by iama
    I would like to log errors/informational and warning messages from within my web application to a log. I was initially thinking of logging all of these onto a text file. However, my PHP web app will need write access to the log files and the folder housing this log file may also need write access if log file rotation is desired which my web app currently does not have. The alternative is for me to log the messages to the MySQL database since my web app is already using the MySQL database for all its data storage needs. However, this got me thinking that going with the MySQL option is much better than the file option since I already have a configuration file with the database access information protected using file system permissions. If I now go with the log file option I need to tinker the file and folder access permissions and this will only make my application less secure and defeats the whole purpose of logging. Is this correct? I am using XAMPP for development and am a newbie to LAMP. Please let me know your recommendations for logging. Thanks.

    Read the article

  • In this example, would Customer or AccountInfo properly be the entity group parent?

    - by Badhu Seral
    In this example, the Google App Engine documentation makes the Customer the entity group parent of the AccountInfo entity. Wouldn't AccountInfo encapsulate Customer rather than the other way around? Normally I would think of an AccountInfo class as including all of the information about the Customer. import javax.jdo.annotations.IdGeneratorStrategy; import javax.jdo.annotations.PersistenceCapable; import javax.jdo.annotations.Persistent; import javax.jdo.annotations.PrimaryKey; import com.google.appengine.api.datastore.Key; import com.google.appengine.api.datastore.KeyFactory; @PersistenceCapable public class AccountInfo { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private Key key; public void setKey(Key key) { this.key = key; } } // ... KeyFactory.Builder keyBuilder = new KeyFactory.Builder(Customer.class.getSimpleName(), "custid985135"); keyBuilder.addChild(AccountInfo.class.getSimpleName(), "acctidX142516"); Key key = keyBuilder.getKey(); AccountInfo acct = new AccountInfo(); acct.setKey(key); pm.makePersistent(acct);

    Read the article

  • Forces to prompt download box IE

    - by Bruno Costa
    Hello, I'm having a problem with some reports in the application I'm doing manutention I've a button that does a postback to the server and do some information and then get back to the cliente and open a popup to download the report. private void grid_ItemCommand(object source, System.Web.UI.WebControls.DataGridCommandEventArgs e) { ... ClientScript.RegisterClientScriptBlock(this.GetType(), "xxx", "<script>javascript:window.location('xx.aspx?m=x','xxx','width=750,height=350,directories=no,location=no,menubar=no,scrollbars,status=no,toolbar=no,resizable=yes,left=50,top=50');</script>"); } Then in xxx.aspx I've the code: Response.ClearContent(); Response.ClearHeaders(); Response.TransmitFile(tempFileName); Response.Flush(); Response.Close(); File.Delete(tempFileName); Response.End(); This works fine if IE option Automatic prompting for file downloads is enabled. But by default this is disabled and I need to force the download box to be prompting. Can I do anything without change a lot of code? Thanks.

    Read the article

  • Find and replace certain part of value (jquery)

    - by Hakan
    This might be a little complicated. See code below. When image is clicked I want to change "MY-ID-NUMBER" in "value" and "src" of object. But I want the other information to remain. When link is clicked I want to restore "value" and "src" so I can use the same function for next image that is clicked. Is it possible? Please help! My HTML: <img height="186" width="134" alt="4988" src="i123.jpg"> <img height="186" width="134" alt="4567" src="i124.jpg"> <a class="restore-to-default" href="#">DVD</a> <div class="tdt"> <object width="960" height="540"><param name="movie" value="http://www.domain.com/v3.4/player.swf?file=http://se.player-feed.domain.com/cinema/MY-ID-NUMBER/123-1/><param name="wmode" value="transparent" /><param name="allowFullScreen" value="true" /><param name="allowScriptAccess" value="always" /><embed id="player" name="player" type="application/x-shockwave-flash" src="http://www.player.domain.com/v3.4/player.swf?file=http://se.player-feed.domain.com/cinema/MY-ID-NUMBER/123-1/&display_title=over&menu=true&enable_link=true&default_quality=xxlarge&controlbar=over&autostart=true&backcolor=000000&frontcolor=ffffff&share=0&repeat=always&displayclick=play&volume=80&linktarget=_blank" width="960" height="540"allowFullScreen="true" allowScriptAccess="always"></embed></object> My jquery: $('img').click(function(){ var alt = $(this).attr("alt"); $('.tdt object').val("alt", alt); // Some how change "MY-ID-NUMBER" into the "alt-value" of image }); $('a').click(function(){ //restore to "MY-ID-NUMBER" }); Thanks!

    Read the article

  • Open a dialog box in same window on selectOneMenu change

    - by Pravingate
    I have a jsf page where I have a selectOneMenu and , I want to open a dialog box on selectOneMenu changes. As a example if user selects a value ="passive" from jsf selectOneMenu it should open a dialog box or a light box on same page where I want to display a small jsf form like as here done. http://www.primefaces.org/showcase-labs/ui/dialogLogin.jsf and I also want save that submitted data in my backing bean somewhere so I can store it in to database later. I dont know how to open a dialog box or light box from backing bean in same window,as we will identify value change using valueChangeListener event or by using ajax event. I am able to identify which value is selected from selectOneMenu(DropdownMenu), but dont know how to open a dialog box on selecting particular value. <h:outputLabel value="* Country: "/> <h:selectOneMenu id="someSelect" value="#{testController.countryName}" required="true"> <f:selectItem itemLabel="Select Country" itemValue=""/> <f:selectItems value="#{testController.countryNamesSelectItems}"/> </h:selectOneMenu> Supoose we have 2 options in selectItems as India and Austrlia, then If a user choose India a dialog box should open on same page where a user need to fill some information and need to submit if he is from india (like here in example http://www.primefaces.org/showcase-labs/ui/dialogLogin.jsf user will put his username and password and submits data) Hope this helps How can I achieve that by using jsf or javascript or ajax or by any else way?

    Read the article

  • Storing date/times as UTC in database

    - by James
    I am storing date/times in the database as UTC and computing them inside my application back to local time based on the specific timezone. Say for example I have the following date/time: 01/04/2010 00:00 Say it is for a country e.g. UK which observes DST (Daylight Savings Time) and at this particular time we are in daylight savings. When I convert this date to UTC and store it in the database it is actually stored as: 31/03/2010 23:00 As the date would be adjusted -1 hours for DST. This works fine when your observing DST at time of submission. However, what happens when the clock is adjusted back? When I pull that date from the database and convert it to local time that particular datetime would be seen as 31/03/2009 23:00 when in reality it was processed as 01/04/2010 00:00. Correct me if I am wrong but isn't this a bit of a flaw when storing times as UTC? Example of Timezone conversion Basically what I am doing is storing the date/times of when information is being submitted to my system in order to allow users to do a range report. Here is how I am storing the date/times: public DateTime LocalDateTime(string timeZoneId) { var tzi = TimeZoneInfo.FindSystemTimeZoneById(timeZoneId); return TimeZoneInfo.ConvertTimeFromUtc(DateTime.UtcNow, tzi).ToLocalTime(); } Storing as UTC: var localDateTime = LocalDateTime("AUS Eastern Standard Time"); WriteToDB(localDateTime.ToUniversalTime());

    Read the article

  • getting jpeg error

    - by bhaskaragr29
    <?php function LoadPNG() { /* Attempt to open */ //require_once 'resizex.php'; $imgname="/home2/puneetbh/public_html/prideofhome/wp-content/uploads/268995481image_11.png"; //$im = @imagecreatefrompng($imgname); $img= imagecreatefromstring(file_get_contents($imgname)); //$im=imagecreatefrompng('images/frame.png'); $im= imagecreatefromjpeg('images/frame.jpeg'); //imagealphablending($img, false); //imagesavealpha($img, true); //$img=resizex("$url",60,65,1); imagecopymerge($im,$img,105,93,0, 0,275,258,100); /* See if it failed */ if(!$im) { /* Create a blank image */ $im = imagecreatetruecolor(150, 30); $bgc = imagecolorallocate($im, 255, 255, 255); $tc = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, 150, 30, $bgc); /* Output an error message */ imagestring($im, 1, 5, 5, 'Error loading ' . $imgname, $tc); } return $im; } $img = LoadPNG(); header('Content-type: image/jpeg'); imagejpeg($im); imagedestroy($im); imagedestroy($img); ?> i am getting error arning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: gd-jpeg: JPEG library reports unrecoverable error: in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: 'images/frame.jpeg' is not a valid JPEG file in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecopymerge(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 16 Warning: Cannot modify header information - headers already sent by (output started at /home2/puneetbh/public_html/prideapp/frame.php:11) in /home2/puneetbh/public_html/prideapp/frame.php on line 34 Warning: imagejpeg(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 35 Warning: imagedestroy(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 36

    Read the article

  • structDelete doesn't affect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • Synchronizing one or more databases with a master database - Foreign keys

    - by Ikke
    I'm using Google Gears to be able to use an application offline (I know Gears is deprecated). The problem I am facing is the synchronization with the database on the server. The specific problem is the primary keys or more exactly, the foreign keys. When sending the information to the server, I could easily ignore the primary keys, and generate new ones. But then how would I know what the relations are. I had one sollution in mind, bet the I would need to save all the pk for every client. What is the best way to synchronize multiple client with one server db. Edit: I've been thinking about it, and I guess seqential primary keys are not the best solution, but what other possibilities are there? Time based doesn't seem right because of collisions which could happen. A GUID comes to mind, is that an option? It looks like generating a GUID in javascript is not that easy. I can do something with natural keys or composite keys. As I'm thinking about it, that looks like the best solution. Can I expect any problems with that?

    Read the article

  • Reversible numerical calculations in Prolog

    - by user8472
    While reading SICP I came across logic programming chapter 4.4. Then I started looking into the Prolog programming language and tried to understand some simple assignments in Prolog. I found that Prolog seems to have troubles with numerical calculations. Here is the computation of a factorial in standard Prolog: f(0, 1). f(A, B) :- A > 0, C is A-1, f(C, D), B is A*D. The issues I find is that I need to introduce two auxiliary variables (C and D), a new syntax (is) and that the problem is non-reversible (i.e., f(5,X) works as expected, but f(X,120) does not). Naively, I expect that at the very least C is A-1, f(C, D) above may be replaced by f(A-1,D), but even that does not work. My question is: Why do I need to do this extra "stuff" in numerical calculations but not in other queries? I do understand (and SICP is quite clear about it) that in general information on "what to do" is insufficient to answer the question of "how to do it". So the declarative knowledge in (at least some) math problems is insufficient to actually solve these problems. But that begs the next question: How does this extra "stuff" in Prolog help me to restrict the formulation to just those problems where "what to do" is sufficient to answer "how to do it"?

    Read the article

  • Can I commit changes to actual database while debugging C# in Visual Studio?

    - by nathant23
    I am creating a C# application using Visual Studio that uses an SQLExpress database. When I hit f5 to debug the application and make changes to the database I believe what is happening is there is a copy of the database in the bin/debug folder that changes are being made to. However, when I stop the debugging and then hit f5 the next time a new copy of the database is being put in the bin/debug folder so that all the changes made the last time are gone. My question is: Is there a way that when I am debugging the application I can have it make changes to the actual database and those changes are actually saved or will it only make changes to the copy in the bin/debug folder (if that is what is actually happening)? I've seen similar questions, but I couldn't find an answer that said if it's possible to make those changes persistent in the actual .mdf file. The reason I ask is because as I build this application I am continuously adding pieces and testing to make sure they all work together. When I put in test data I am using actual data that I would like to stay in the database. This would just help me not have to reenter the data later. Thanks in advance for any help or information that could help me better understand the process.

    Read the article

  • How to find which file is open in eclipse editor without using IEditorPart?

    - by Destructor
    I want to know which file (or even project is enough) is opened in eclipse editor? I know we can do this once we get IEditorPart from doSetInput method, IFile file = ((IFileEditorInput) iEditorPart).getFile(); But I want the name of file without using IEditorPart, how can I do the same? Checking which is the selected file in project explorer is not of much help because, user can select multiple files at once and open all simultaneously and I did not way to distinguish which file opened at what time. Adding more info: I have an editor specified for a particular type of file, now every time it opens, during intializing editor I have some operation to do based on project properties. While initializing editor, I need the file handle (of the one which user opened/double clicked) or the corresponding project handle. I have my editor something this way: public class MyEditor extends TextEditor{ @Override protected void initializeEditor() { setSourceViewerConfiguration(new MySourceViewerConfiguration( CDTUITools.getColorManager(), store, "MyPartitions", this)); } //other required methods @Override protected void doSetInput(IEditorInput input) throws CoreException { if(input instanceof IFileEditorInput) { IFile file = ((IFileEditorInput) input).getFile(); } } } as I have done in the doSetInput() method , I want the file handle(even project handle is sufficient). But the problem is in initializeEditor() function there is no reference to editorInput, hence I am unable to get the file handle. In the source viewer configuration file, I set the code scanners and this needs some project specific information that will set the corresponding rules.

    Read the article

  • How can I create an Image in GDI+ from a Base64-Encoded string in C++?

    - by Schnapple
    I have an application, currently written in C#, which can take a Base64-encoded string and turn it into an Image (a TIFF image in this case), and vice versa. In C# this is actually pretty simple. private byte[] ImageToByteArray(Image img) { MemoryStream ms = new MemoryStream(); img.Save(ms, System.Drawing.Imaging.ImageFormat.Tiff); return ms.ToArray(); } private Image byteArrayToImage(byte[] byteArrayIn) { MemoryStream ms = new MemoryStream(byteArrayIn); BinaryWriter bw = new BinaryWriter(ms); bw.Write(byteArrayIn); Image returnImage = Image.FromStream(ms, true, false); return returnImage; } // Convert Image into string byte[] imagebytes = ImageToByteArray(anImage); string Base64EncodedStringImage = Convert.ToBase64String(imagebytes); // Convert string into Image byte[] imagebytes = Convert.FromBase64String(Base64EncodedStringImage); Image anImage = byteArrayToImage(imagebytes); (and, now that I'm looking at it, could be simplified even further) I now have a business need to do this in C++. I'm using GDI+ to draw the graphics (Windows only so far) and I already have code to decode the string in C++ (to another string). What I'm stumbling on, however, is getting the information into an Image object in GDI+. At this point I figure I need either a) A way of converting that Base64-decoded string into an IStream to feed to the Image object's FromStream function b) A way to convert the Base64-encoded string into an IStream to feed to the Image object's FromStream function (so, different code than I'm currently using) c) Some completely different way I'm not thinking of here. My C++ skills are very rusty and I'm also spoiled by the managed .NET platform, so if I'm attacking this all wrong I'm open to suggestions.

    Read the article

  • MVC 3, View Model for user registration process. Password validation not working properly

    - by sec_goat
    I am trying to create a user registration page using MVC 3, so that I can better understand the process of how it works, what's going on behind the scenes etc. I am running into some issues when trying to use [Compare] to check to see that the user entered the same password twice. I tried adding the ComparePassword field to my user model first, and found that would not work the way I wanted as I did not have the field in the database, so the obvious answer was to create a View Model using the same information including the ComparePassword field. So I now have created a User model and a RegistrationViewModel, however it appears that the [Compare] on the password is not returning anything, for instance no matter what I put in the two boxes, when I click create it gives no error, which seems to me to mean it was successfully validated. I am not sure what I am doing or not doing to make this work properly. I have tried updating the jQuery.Validate to the newest version as there were some bugs reported in older version, this has not helped my efforts. Below is a wall of code, that is what I am working with. } public class RegistrationViewModel { [Required] [StringLength(15, MinimumLength = 3)] [Display(Name = "User Name")] [RegularExpression(@"(\S)+", ErrorMessage = " White Space is not allowed in User Names")] [ScaffoldColumn(false)] public String Username { get; set; } [Required] [StringLength(15, MinimumLength = 3)] [Display(Name = "First Name")] public String firstName { get; set; } [Required] [StringLength(15, MinimumLength = 3)] [Display(Name = "Last Name")] public String lastName { get; set; } [Required] [Display(Name = "Email")] public String email { get; set; } [Required] [Display(Name = "Password")] [DataType(DataType.Password)] public String password { get; set; } [Required] [DataType(DataType.Password)] [Display(Name = "Re-enter Password")] [Compare("Password", ErrorMessage = "Passwords do not match.")] public String comparePassword { get; set; } }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >