Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 838/998 | < Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >

  • CakePHP adding columns to a table

    - by vette982
    I have a Profile model/controller in my cake app as well as an index.ctp view in /views/profiles. Now, when I go to add a column to my table that is already filled with data, and then add the corresponding code to the view to pick up this column's data, it just gives me an empty result. My model: <?php class Profile extends AppModel { var $name = 'Profile'; } ?> My controller: <?php class ProfilesController extends AppController { var $name = 'Profiles'; function index() { $this->set('profiles', $this->Profile->find('all')); } } ?> My views printing (stripped down): <?php foreach ($profiles as $profile): ?> <?php echo $profile['Profile']['id']; ?> <?php echo $profile['Profile']['username']; ?> <?php echo $profile['Profile']['created']; ?> <?php echo $profile['Profile']['thumbnail'];?> <?php echo $profile['Profile']['account'];?> <?php endforeach; ?> Basically, the columns id, username, column, thumbnail always have been printing fine, but when I add a column called accountit returns no information (nothing prints, but no errors). Any suggestions?

    Read the article

  • Can't get KnownType to work with WCF

    - by Kelly Cline
    I have an interface and a class defined in separate assemblies, like this: namespace DataInterfaces { public interface IPerson { string Name { get; set; } } } namespace DataObjects { [DataContract] [KnownType( typeof( IPerson ) ) ] public class Person : IPerson { [DataMember] public string Name { get; set; } } } This is my Service Interface: public interface ICalculator { [OperationContract] IPerson GetPerson ( ); } When I update my Service Reference for my Client, I get this in the Reference.cs: public object GetPerson() { return base.Channel.GetPerson(); I was hoping that KnownType would give me IPerson instead of "object" here. I have also tried [KnownType( typeof( Person ) ) ] with the same result. I have control of both client and server, so I have my DataObjects (where Person is defined) and DataInterfaces (where IPerson is defined) assemblies in both places. Is there something obvious I am missing? I thought KnownType was the answer to being able to use interfaces with WCF. ----- FURTHER INFORMATION ----- I removed the KnownType from the Person class and added [ServiceKnownType( typeof( Person ) ) ] to my service interface, as suggested by Richard. The client-side proxy still looks the same, public object GetPerson() { return base.Channel.GetPerson(); , but now it doesn't blow up. The client just has an "object", though, so it has to cast it to IPerson before it is useful. var person = client.GetPerson ( ); Console.WriteLine ( ( ( IPerson ) person ).Name );

    Read the article

  • How do I attach a link (to a View) to an image in ASP.NET MVC?

    - by Ryan Pitts
    Ok, so here is my situation. I am creating a web application using ASP.NET MVC 2 using the C# language. I have programmed in HTML, CSS, and PHP for several years and I am very new to ASP.NET. The part that I am having trouble with is the image gallery. The setup: I have a link on the navigation bar that goes to a "Galleries" page. This page will show a list of galleries. Each gallery has a title, an image, and a description. All of this information is pulled from an XML file. I'm using the XML file like a database. I wanted to use this method so that i could easily update the list of galleries and have the updated XML file automatically be reflected by the website. Now, the galleries should link to an "Images" page. This page will display a list of images within the gallery based on what gallery was selected. This page will also pull from an XML file. The problem: I cannot seem to attach a dynamic link to the image? I am also stuck and not sure how to get the correct View to display. I know I need to do something with the controllers and models, right? I have some code if needed? I would greatly appreciate any help or direction for this! Thanks!

    Read the article

  • SQL Server INSERT, Scope_Identity() and physical writing to disc

    - by TheBlueSky
    Hello everyone, I have a stored procedure that does, among other stuff, some inserts in different table inside a loop. See the example below for clearer understanding: INSERT INTO T1 VALUES ('something') SET @MyID = Scope_Identity() ... some stuff go here INSERT INTO T2 VALUES (@MyID, 'something else') ... The rest of the procedure These two tables (T1 and T2) have an IDENTITY(1, 1) column in each one of them, let's call them ID1 and ID2; however, after running the procedure in our production database (very busy database) and having more than 6250 records in each table, I have noticed one incident where ID1 does not match ID2! Although normally for each record inserted in T1, there is record inserted in T2 and the identity column in both is incremented consistently. The "wrong" records were something like that: ID1 Col1 ---- --------- 4709 data-4709 4710 data-4710 ID2 ID1 Col1 ---- ---- --------- 4709 4710 data-4709 4710 4709 data-4710 Note the "inverted", ID1 in the second table. Knowing not that much about SQL Server underneath operations, I have put the following "theory", maybe someone can correct me on this. What I think is that because the loop is faster than physically writing to the table, and/or maybe some other thing delayed the writing process, the records were buffered. When it comes the time to write them, they were wrote in no particular order. Is that even possible if no, how to explain the above mentioned scenario? If yes, then I have another question to rise. What if the first insert (from the code above) got delayed? Doesn't that mean I won't get the correct IDENTITY to insert into the second table? If the answer of this is also yes, what can I do to insure the insertion in the two tables will happen in sequence with the correct IDENTITY? I appreciate any comment and information that help me understand this. Thanks in advance.

    Read the article

  • PHP Cookie Warning...

    - by Nano HE
    Hi,I am new to PHP, I practised PHP setcookie() just now and failed. http://localhost/test/index.php <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <title></title> </head> <body> <?php $value = 'something from somewhere'; setcookie("TestCookie", $value); ?> </body> </html> http://localhost/test/view.php <?php // I plan to view the cookie value via view.php echo $_COOKIE["TestCookie"]; ?> But I failed to run index.php, IE warning like this. Warning: Cannot modify header information - headers already sent by (output started at C:\xampp\htdocs\test\index.php:9) in C:\xampp\htdocs\test\index.php on line 12 I enabled my IE 6 cookie no doubt. Is there anything wrong on my procedure above? Thank you. WinXP OS and XAMPP 1.7.3 used.

    Read the article

  • Place JComponent On The Top Of JXLayer

    - by Yan Cheng CHEOK
    Hello, currently, I had successful applying JXLayer on my charting component, to draw a yellow information box on the top of it. final org.jdesktop.jxlayer.JXLayer<ChartPanel> layer = new org.jdesktop.jxlayer.JXLayer<ChartPanel>(this.chartPanel); this.chartLayerUI = new ChartLayerUI<ChartPanel>(this); layer.setUI(this.chartLayerUI); At the same time, I wish to add the following JComponent (DefaultDrawingView) on the top of JXLayer. This JComponent has the ability 1) To receive mouse event to draw figures on itself. Within ChartLayerUI, I add the following code @Override @SuppressWarnings("unchecked") public void installUI(JComponent c) { super.installUI(c); JXLayer<JComponent> l = (JXLayer<JComponent>) c; l.getGlassPane().setLayout(new java.awt.BorderLayout()); // this.view is DefaultDrawingView drawing object. l.getGlassPane().add(this.view, java.awt.BorderLayout.CENTER); } However, after having the above code, I get the following outcome 1) My charting component ChartPanel are being blocked by DefaultDrawingView 2) My charting component no longer able to receive mouse event. What I wish is that A) ChartPanel and DefaultDrawingView able to show up B) ChartPanel and DefaultDrawingView able to receive mouse event Is there other steps I had missed out, or did wrong? Thanks.

    Read the article

  • Web Hosting: Any web host that supports files more than 50,000 in number?

    - by Devner
    Hi all, For my PHP & mySQL based application, I am trying to buy website hosting from a host who does not have a limit on the number of files I carry in my hosting account. Almost all the websites have a common limit of 50,000 files (some websites call it 50,000 nodes). The rest(to the extent of my search) are not even close. I have gone through the various websites, Googled lot of information, have spoken with the customer service of the hosting companies and they said that they have a limit of 50,000 files and that's why they call it the LIMIT. Now I have my application, which is a kind of social networking website, where people can upload various files of varying file size. So say if 50,000 users were to join the website and upload 1 file each, the limit of 50,000 will be reached very easily and my 50,001 customer will start facing file upload problems (& so will my account). So I would like to know if there's any website hosting services that do NOT levy such restrictions. In summary, I need the following options: No maximum file limit (more than 50,000 files in account). No maximum file upload limit in server setting (10MB, 12MB, 15MB, 20MB, etc.). Ability to upload files of various types (zip, flv, jg, png, etc.). Ability to stream Audio and Video (live audio & video not necessary). Access to .htaccess Access to php.ini, my.cnf or my.ini (this would be a plus) Supports SSL. Provides dedicated hosting(& IP) as well. Monthly payments without contracts are a plus. If you know of any such website hosting services, please post a reply ( a link to the same will be appreciated ). Thank you.

    Read the article

  • Synchronizing one or more databases with a master database - Foreign keys

    - by Ikke
    I'm using Google Gears to be able to use an application offline (I know Gears is deprecated). The problem I am facing is the synchronization with the database on the server. The specific problem is the primary keys or more exactly, the foreign keys. When sending the information to the server, I could easily ignore the primary keys, and generate new ones. But then how would I know what the relations are. I had one sollution in mind, bet the I would need to save all the pk for every client. What is the best way to synchronize multiple client with one server db. Edit: I've been thinking about it, and I guess seqential primary keys are not the best solution, but what other possibilities are there? Time based doesn't seem right because of collisions which could happen. A GUID comes to mind, is that an option? It looks like generating a GUID in javascript is not that easy. I can do something with natural keys or composite keys. As I'm thinking about it, that looks like the best solution. Can I expect any problems with that?

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • mootools get data of child element of li?

    - by sea_1987
    Hi there, I am trying to get some information of a child element of an li using mootools, essentially my html looks like this, <li><a href="/home" id="home" class="nav-link">Home</a></li> I am wanting to be able get the id, class and href of the a tag using mootools, so far my javascript looks similar to this, $$('.rate').each(function(element,i){ element.addEvent('click', function(){ var myStyles = ['nostar', 'onestar', 'twostar', 'threestar', 'fourstar', 'fivestar', 'sixstar', 'sevenstar', 'eightstar', 'ninestar', 'tenstar']; myStyles.each(function(myStyle){ if(element.getParent().hasClass(myStyle)){ element.getParent().removeClass(myStyle) } }); myStyles.each(function(myStyle, index){ if(index == element.id){ element.getParent().toggleClass(myStyle); var req = new Request({ method:'post', url: '/recipes/save', data: {'rating' : element.id}, onRequest: function(){ alert('Request made. Please wait...');}, onComplete:function(response){ alert('Response:' + response);} }).send(); alert('Clicked '+element.id); alert(element.getChildren().get('href'); } }); }); }); The final alert in the script is my attempt to the child of the li(element) and its href.

    Read the article

  • "variable tracking" is eating my compile time!

    - by wowus
    I have an auto-generated file which looks something like this... static void do_SomeFunc1(void* parameter) { // Do stuff. } // Continues on for another 4000 functions... void dispatch(int id, void* parameter) { switch(id) { case ::SomeClass1::id: return do_SomeFunc1(parameter); case ::SomeClass2::id: return do_SomeFunc2(parameter); // This continues for the next 4000 cases... } } When I build it like this, the build time is enormous. If I inline all the functions automagically into their respective cases using my script, the build time is cut in half. GCC 4.5.0 says ~50% of the build time is being taken up by "variable tracking" when I use -ftime-report. What does this mean and how can I speed compilation while still maintaining the superior cache locality of pulling out the functions from the switch? EDIT: Interestingly enough, the build time has exploded only on debug builds, as per the following profiling information of the whole project (which isn't just the file in question, but still a good metric; the file in question takes the most time to build): Debug: 8 minutes 50 seconds Release: 4 minutes, 25 seconds

    Read the article

  • Http authentication with apache httpcomponents

    - by matdan
    Hi, I am trying to develop a java http client with apache httpcomponents 4.0.1. This client calls the page "https://myHost/myPage". This page is protected on the server by a JNDIRealm with a login form authentication, so when I try to get https://myHost/myPage I get a login page. I tried to bypass it unsuccessfully with the following code : //I set my proxy HttpHost proxy = new HttpHost("myProxyHost", myProxyPort); //I add supported schemes SchemeRegistry supportedSchemes = new SchemeRegistry(); supportedSchemes.register(new Scheme("http", PlainSocketFactory .getSocketFactory(), 80)); supportedSchemes.register(new Scheme("https", SSLSocketFactory .getSocketFactory(), 443)); // prepare parameters HttpParams params = new BasicHttpParams(); HttpProtocolParams.setVersion(params, HttpVersion.HTTP_1_1); HttpProtocolParams.setContentCharset(params, "UTF-8"); HttpProtocolParams.setUseExpectContinue(params, true); ClientConnectionManager ccm = new ThreadSafeClientConnManager(params, supportedSchemes); DefaultHttpClient httpclient = new DefaultHttpClient(ccm, params); httpclient.getParams().setParameter(ConnRoutePNames.DEFAULT_PROXY, proxy); //I add my authentication information httpclient.getCredentialsProvider().setCredentials( new AuthScope("myHost/myPage", 443), new UsernamePasswordCredentials("username", "password")); HttpHost host = new HttpHost("myHost", 443, "https"); HttpGet req = new HttpGet("/myPage"); //show the page ResponseHandler<String> responseHandler = new BasicResponseHandler(); String rsp = httpClient.execute(host, req, responseHandler); System.out.println(rsp); When I run this code, I always get the login page, not myPage. How can I apply my credential parameters to avoid this login form? Any help would be fantastic

    Read the article

  • Macports and virtualenv site-packages Fallback

    - by Streeter
    I've installed django and python as this link suggested with macports. However, I'd like to use virtualenv to install more packages. My understanding is that if I do not pass in the --no-site-packages to virtualenv, I should get the currently installed packages in addition to whatever packages I install into the virtual environment. Is this correct? As an example, I've installed django through macports and then create a virtual environment, but I cannot import django from within that virtual environment: [streeter@mordecai]:~$ mkvirtualenv django-test New python executable in django-test/bin/python Installing setuptools............done. ... (django-test)[streeter@mordecai]:~$ pip install django-debug-toolbar Downloading/unpacking django-debug-toolbar Downloading django-debug-toolbar-0.8.4.tar.gz (80Kb): 80Kb downloaded Running setup.py egg_info for package django-debug-toolbar Installing collected packages: django-debug-toolbar Running setup.py install for django-debug-toolbar Successfully installed django-debug-toolbar Cleaning up... (django-test)[streeter@mordecai]:~$ python Python 2.6.1 (r261:67515, Jun 24 2010, 21:47:49) [GCC 4.2.1 (Apple Inc. build 5646)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> import django Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named django >>> So I can install packages into the virtual environment, but it isn't picking up the global site-packages. Or am I not doing something correctly / missing something / misunderstanding how virtualenv works? I've got Mac OS 10.6 (Snow Leopard), have updated my macports packages and am using macports' python26 (via python_select python26).

    Read the article

  • Can I commit changes to actual database while debugging C# in Visual Studio?

    - by nathant23
    I am creating a C# application using Visual Studio that uses an SQLExpress database. When I hit f5 to debug the application and make changes to the database I believe what is happening is there is a copy of the database in the bin/debug folder that changes are being made to. However, when I stop the debugging and then hit f5 the next time a new copy of the database is being put in the bin/debug folder so that all the changes made the last time are gone. My question is: Is there a way that when I am debugging the application I can have it make changes to the actual database and those changes are actually saved or will it only make changes to the copy in the bin/debug folder (if that is what is actually happening)? I've seen similar questions, but I couldn't find an answer that said if it's possible to make those changes persistent in the actual .mdf file. The reason I ask is because as I build this application I am continuously adding pieces and testing to make sure they all work together. When I put in test data I am using actual data that I would like to stay in the database. This would just help me not have to reenter the data later. Thanks in advance for any help or information that could help me better understand the process.

    Read the article

  • Is there an easier way to do Classic ASP "relative path"?

    - by Alex.Piechowski
    Right now, I'm having trouble. First of all I have a page, let's call it "http://blah.com/login". That obviously goes strait to "index.asp" A line of Main.asp: <!--#include file="resource/menu.asp"--> Page top includes all of what I need for my menu... so: Part of resource/menu.htm: <div id="colortab" class="ddcolortabs"> <ul> <li><a href="main.asp" title="Main" rel="dropmain"><span>Main</span></a></li> ... </ul> </div> <!--Main drop down menu --> <div id="dropmain" class="dropmenudiv_a"> <a href="main/announcements.asp">Announcements</a> <a href="main/contacts.asp">Contact Information</a> <a href="main/MeetingPlans.asp">Meeting Plan</a> <a href="main/photos.asp">Photo Gallery</a> <a href="main/events.asp">Upcoming Events</a> </div> Let's say I click on the "announcements" (http://blah.com/login/main/announcements.asp) link... Now I'm at the announcements page! But wait, I include the same menu file. Guess what happens: I get sent to "http://blah.com/login/main/main/announcements.asp Which doesn't exist... My solution: Make a menu_sub.asp include for any subpages. But wait a second... this WORKS, but it gets REALLY REALLY messy... What can I do to use just one main "menu.asp" instead of "menu_sub.asp"? using "/main/announcements.asp" WON'T be an option because this is a web application that will be on different directories per server. Any ideas? PLEASE

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Reservation Solution for RealEstate integrating with Joomla

    - by Pennf0lio
    Hi, My client needs a Property (Just Land NO Houses) Reservation solution for their existing website (It runs in Joomla). I need some advice/Tips on what approach should I use. I'm looking for an Opensource solution that I can customize to my need. The Scenario: A buyer reserves a lot, A form appears gathers his details after that he/she pays for the reservation. FrontEnd: I need a form builder extension in Joomla that I could build custom form in gathering information (name, email, contact info, address...) from the buyer or the person who is reserving it. After I gather the info I need another extension that will handle the payment for reserving it. This is kinda shopping cart type approach, you see a product and the buy it. But would just need extra details. Backend: I can see all the details of the buyer from their name to the time they paid for a reservation. Thanks! P.S. I'm open to all Ideas. I'm not sure of this approach. Please let me know If you have some good Ideas or example.

    Read the article

  • How to change XmlSchemaElement.SchemaType (or: difference between SchemaType and ElementSchemaType)

    - by Gregor
    Hey, I'm working on a XML Editor which gets all his information from the corresponding XSD file. To work with the XSD files I use the System.Xml.Schema Namespace (XmlSchema*). Because of an 'xsi:type' attribute in the XML I've to change the XmlSchemaType of an XmlSchemaElement. Until now I use in my code the 'ElementSchemaType' property of 'XmlSchemaElement'. The nice thing about it: it's read only. There is also in 'XmlSchemaElement' an 'SchemaType' property which is not read only, but always null (yes, XmlSchema and XmlSchemaSet are compiled). So how can I change the type of the 'XmlSchemaElement'? Or, also the same question: What is the diffrence between this two porperties? Some technical data: C#, .NET 3.5 The MSDN documentation is nearly the same for both: SchemaType Documentation: Gets or sets the type of the element. This can either be a complex type or a simple type. ElementSchemaType Documentation: Gets an XmlSchemaType object representing the type of the element based on the SchemaType or SchemaTypeName values of the element.

    Read the article

  • Distinct or group by on some columns but not others

    - by Nazadus
    I have a view that I'm trying to filter with something similar to DISTINCT on some columns but not others. I have a view like this: Name LastName Zip Street1 HouseholdID (may not be unique because it may have multiple addresses -- think of it in the logical sense as grouping persons but not physical locations; If you lookup HouseholdID 4130, you may get two rows.. or more, because the person may have mutiple mailing locations) City State I need to pull all those columns but filter on LastName,Zip, and Street1. Here's the fun part: The filter is arbitrary -- meaning I don't care which one of the duplicates goes away. This is for a mail out type thing and the other information is not used for any other reason than than to look up a specific person if needed (I have no idea why). So.. given one of the records, you can easily figure out the removed ones. As it stands now, my Sql-Fu fails me and I'm filtering in C# which is incredibly slow and is pretty much a foreach that starts with an empty list and adds the row in if the combined last name, zip, and street aren't are not in the list. I feel like I'm missing a simple / basic part of SQL that I should be understanding.

    Read the article

  • How to find which file is open in eclipse editor without using IEditorPart?

    - by Destructor
    I want to know which file (or even project is enough) is opened in eclipse editor? I know we can do this once we get IEditorPart from doSetInput method, IFile file = ((IFileEditorInput) iEditorPart).getFile(); But I want the name of file without using IEditorPart, how can I do the same? Checking which is the selected file in project explorer is not of much help because, user can select multiple files at once and open all simultaneously and I did not way to distinguish which file opened at what time. Adding more info: I have an editor specified for a particular type of file, now every time it opens, during intializing editor I have some operation to do based on project properties. While initializing editor, I need the file handle (of the one which user opened/double clicked) or the corresponding project handle. I have my editor something this way: public class MyEditor extends TextEditor{ @Override protected void initializeEditor() { setSourceViewerConfiguration(new MySourceViewerConfiguration( CDTUITools.getColorManager(), store, "MyPartitions", this)); } //other required methods @Override protected void doSetInput(IEditorInput input) throws CoreException { if(input instanceof IFileEditorInput) { IFile file = ((IFileEditorInput) input).getFile(); } } } as I have done in the doSetInput() method , I want the file handle(even project handle is sufficient). But the problem is in initializeEditor() function there is no reference to editorInput, hence I am unable to get the file handle. In the source viewer configuration file, I set the code scanners and this needs some project specific information that will set the corresponding rules.

    Read the article

  • How to debug a Gruntfile with breakpoints using node-inspector?

    - by Kris Hollenbeck
    So I have spent the past couple days trying to get this to work with no luck. Most of the solutions I have found seem to work "okay" for debugging node applications. But I haven't had much luck debugging grunt stand alone. I would like to be able to set breakpoints in my gruntfile and either step through the code with either the browser or an IDE. I have tried the following: Debugging using intelliJ IDE Using Grunt Console (Process finished with exit code 6) Debugging with Nodeeclipse (This sort of works okay but doesn't hit the breakpoints set in eclipse, not very intuitive) Debugging using node-inspector (This one also sort of works. I can step through a little ways using F11 and F10 in chrome. But eventually it just crashes. Using F8 to skip to break point never works.) ERROR MESSAGE USING NODE-INSPECTOR So currently node-inspector feels like it has gotten me the closest to what I want. To get here I did the following: From my grunt directory I ran the following commands: grunt node-inspector node --debug-brk Gruntfile.js And then from there I went to localhost:8080/debug?port=5858 to debug my Gruntfile.js. But like I mentioned above, as soon as I hit F8 to skip to breakpoint it crashes with the above error. Has anybody had any success using this method to try to debug a Gruntfile? So far from my search efforts I have not found a very well documented way of doing this. So hopefully this will be useful or beneficial information for future users. Also I am using Windows 7 by the way. Thanks in advance.

    Read the article

  • Is DB logging more secure than file logging for my PHP web app?

    - by iama
    I would like to log errors/informational and warning messages from within my web application to a log. I was initially thinking of logging all of these onto a text file. However, my PHP web app will need write access to the log files and the folder housing this log file may also need write access if log file rotation is desired which my web app currently does not have. The alternative is for me to log the messages to the MySQL database since my web app is already using the MySQL database for all its data storage needs. However, this got me thinking that going with the MySQL option is much better than the file option since I already have a configuration file with the database access information protected using file system permissions. If I now go with the log file option I need to tinker the file and folder access permissions and this will only make my application less secure and defeats the whole purpose of logging. Is this correct? I am using XAMPP for development and am a newbie to LAMP. Please let me know your recommendations for logging. Thanks.

    Read the article

  • Android ArrayList<Location> passing between activities

    - by squixy
    I have simple class Track, which stores information about route: import java.io.Serializable; import java.util.ArrayList; import java.util.Date; import android.location.Location; public class Track implements Serializable { private static final long serialVersionUID = -5317697499269650204L; private Date date; private String name; private int time; private double distance, speed; private ArrayList<Location> route; public Track(String name, int time, double distance, ArrayList<Location> route) { this.date = new Date(); this.name = name; this.time = time; this.distance = distance; this.speed = distance / (time / 3600.); this.route = route; } public String getDate() { return String.format("Date: %1$td-%1$tb-%1$tY%nTime: %1$tH:%1$tM:%1$tS", date); } public String getName() { return name; } public int getTime() { return time; } public double getDistance() { return distance; } public float getSpeed() { return (float) speed; } public ArrayList<Location> getRoute() { return route; } @Override public String toString() { return String.format("Name: %s%nDate: %2$td-%2$tb-%2$tY%nTime: %2$tH:%2$tM:%2$tS", name, date); } } And I'm passing it from one activity to another: Intent showTrackIntent = new Intent(TabSavedActivity.this, ShowTrackActivity.class); showTrackIntent.putExtra("track", adapter.getItem(position)); startActivity(showTrackIntent); Where (Track object is element on ListView). I get error during passing Track object: java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = classes.Track) What is happening?

    Read the article

  • How to get a template tag to auto-check a checkbox in Django

    - by Daniel Quinn
    I'm using a ModelForm class to generate a bunch of checkboxes for a ManyToManyField but I've run into one problem: while the default behaviour automatically checks the appropriate boxes (when I'm editing an object), I can't figure out how to get that information in my own custom templatetag. Here's what I've got in my model: ... from django.forms import CheckboxSelectMultiple, ModelMultipleChoiceField interests = ModelMultipleChoiceField(widget=CheckboxSelectMultiple(), queryset=Interest.objects.all(), required=False) ... And here's my templatetag: @register.filter def alignboxes(boxes, cls): """ Details on how this works can be found here: http://docs.djangoproject.com/en/1.1/howto/custom-template-tags/ """ r = "" i = 0 for box in boxes.field.choices.queryset: r += "<label for=\"id_%s_%d\" class=\"%s\"><input type=\"checkbox\" name=\"%s\" value=\"%s\" id=\"id_%s_%d\" /> %s</label>\n" % ( boxes.name, i, cls, boxes.name, box.id, boxes.name, i, box.name ) i = i + 1 return mark_safe(r) The thing is, I'm only doing this so I can wrap some simpler markup around these boxes, so if someone knows how to make that happen in an easier way, I'm all ears. I'd be happy with knowing a way to access whether or not a box should be checked though.

    Read the article

  • Inline function and global variable issue in Javascript

    - by Natim
    I have some code here : http://bitbucket.org/natim/lo53_tp1/src/tip/part3/camions/medias/js/tracking.js That I use to draw some information about trucks direction. The problem come from a function defined in a for loop like this one : ... for(i = 0; i < nb_trucks; i++) { ... contentString = '<div id="content">'+ trucks[i]['name'] + '</div>'; current_window = new google.maps.InfoWindow({ content: contentString }); infosWindow.push(current_window); current_marker = new google.maps.Marker({ map: map, position: new google.maps.LatLng(trucks[i]['end']['lat'], trucks[i]['end']['lon']), draggable: false, title: trucks[i]['name'] }); markers.push(current_marker); google.maps.event.addListener(current_marker, 'click', function() { current_window.open(map, current_marker); }); } In this code, you can see the last block google.maps.event.addListener(current_marker, 'click', function() { current_window.open(map, current_marker); }); And my problem is that current_marker in the addListener parameters is different from the one inside the function. The current_window and the current_marker inside the function is overide at each loop turn. How can I get it right ? Thanks

    Read the article

< Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >