Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 837/998 | < Previous Page | 833 834 835 836 837 838 839 840 841 842 843 844  | Next Page >

  • Hashing the state of a complex object in .NET

    - by Jan
    Some background information: I am working on a C#/WPF application, which basically is about creating, editing, saving and loading some data model. The data model contains of a hierarchy of various objects. There is a "root" object of class A, which has a list of objects of class B, which each has a list of objects of class C, etc. Around 30 classes involved in total. Now my problem is that I want to prompt the user with the usual "you have unsaved changes, save?" dialog, if he tries to exit the program. But how do I know if the data in current loaded model is actually changed? There is of course ways to solve this, like e.g. reloading the model from file and compare against the one in memory value by value or make every UI control set a flag indicating the model has been changed. Now instead, I want to create a hash value based on the model state on load and generate a new value when the user tries to exit, and compare those two. Now the question: So inspired of that, I was wondering if there exist some way to generate a hash value from the (value)state of some arbitrary complex object? Preferably in a generic way, e.g. no need to apply attributes to each involved class/field. One idea could be to use some of .NET's serialization functionality (assuming it will work out-of-the-box in this case) and apply a hash function to the content of the resulting file. However, I guess there exist some more suitable approach. Thanks in advance.

    Read the article

  • Web Hosting: Any web host that supports files more than 50,000 in number?

    - by Devner
    Hi all, For my PHP & mySQL based application, I am trying to buy website hosting from a host who does not have a limit on the number of files I carry in my hosting account. Almost all the websites have a common limit of 50,000 files (some websites call it 50,000 nodes). The rest(to the extent of my search) are not even close. I have gone through the various websites, Googled lot of information, have spoken with the customer service of the hosting companies and they said that they have a limit of 50,000 files and that's why they call it the LIMIT. Now I have my application, which is a kind of social networking website, where people can upload various files of varying file size. So say if 50,000 users were to join the website and upload 1 file each, the limit of 50,000 will be reached very easily and my 50,001 customer will start facing file upload problems (& so will my account). So I would like to know if there's any website hosting services that do NOT levy such restrictions. In summary, I need the following options: No maximum file limit (more than 50,000 files in account). No maximum file upload limit in server setting (10MB, 12MB, 15MB, 20MB, etc.). Ability to upload files of various types (zip, flv, jg, png, etc.). Ability to stream Audio and Video (live audio & video not necessary). Access to .htaccess Access to php.ini, my.cnf or my.ini (this would be a plus) Supports SSL. Provides dedicated hosting(& IP) as well. Monthly payments without contracts are a plus. If you know of any such website hosting services, please post a reply ( a link to the same will be appreciated ). Thank you.

    Read the article

  • Android ArrayList<Location> passing between activities

    - by squixy
    I have simple class Track, which stores information about route: import java.io.Serializable; import java.util.ArrayList; import java.util.Date; import android.location.Location; public class Track implements Serializable { private static final long serialVersionUID = -5317697499269650204L; private Date date; private String name; private int time; private double distance, speed; private ArrayList<Location> route; public Track(String name, int time, double distance, ArrayList<Location> route) { this.date = new Date(); this.name = name; this.time = time; this.distance = distance; this.speed = distance / (time / 3600.); this.route = route; } public String getDate() { return String.format("Date: %1$td-%1$tb-%1$tY%nTime: %1$tH:%1$tM:%1$tS", date); } public String getName() { return name; } public int getTime() { return time; } public double getDistance() { return distance; } public float getSpeed() { return (float) speed; } public ArrayList<Location> getRoute() { return route; } @Override public String toString() { return String.format("Name: %s%nDate: %2$td-%2$tb-%2$tY%nTime: %2$tH:%2$tM:%2$tS", name, date); } } And I'm passing it from one activity to another: Intent showTrackIntent = new Intent(TabSavedActivity.this, ShowTrackActivity.class); showTrackIntent.putExtra("track", adapter.getItem(position)); startActivity(showTrackIntent); Where (Track object is element on ListView). I get error during passing Track object: java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = classes.Track) What is happening?

    Read the article

  • How to get a list of all Subversion commit author usernames?

    - by Quinn Taylor
    I'm looking for an efficient way to get the list of unique commit authors for an SVN repository as a whole, or for a given resource path. I haven't been able to find an SVN command specifically for this (and don't expect one) but I'm hoping there may be a better way that what I've tried so far in Terminal (on OS X): svn log --quiet | grep "^r" | awk '{print $3}' svn log --quiet --xml | grep author | sed -E "s:</?author>::g" Either of these will give me one author name per line, but they both require filtering out a fair amount of extra information. They also don't handle duplicates of the same author name, so for lots of commits by few authors, there's tons of redundancy flowing over the wire. More often than not I just want to see the unique author usernames. (It actually might be handy to infer the commit count for each author on occasion, but even in these cases it would be better if the aggregated data were sent across instead.) I'm generally working with client-only access, so svnadmin commands are less useful, but if necessary, I might be able to ask a special favor of the repository admin if strictly necessary or much more efficient. The repositories I'm working with have tens of thousands of commits and many active users, and I don't want to inconvenience anyone.

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • How to .NET package JavaScript/bookmarklet as Interner Explorer 8/9 Plugin?

    - by Don
    How to .NET package JavaScript/bookmarklet as Interner Explorer 8/9 Plugin? I have recently finished writing JavaScript code for a browser addon, which basically (once the JS is included) runs on page-load, for given domains it then checks for certain elements in the DOM and adds new relevant elements(/information) to the page. Since the JavaScript only reads/affects the HTML DOM independently (and does not need any toolbar buttons or anything else) the JS purely needs adding to the browser's webpages. I have packaged the code to work with Firefox and Chrome and those are both working well, and I can run the code for IE in 'bookmarklet' form without problems, but I would like to learn how to package JavaScript as an actual .NET .MSI addon/plugin that will install for the current Internet Explorer 8/9. Does anyone know of a suitable guide or method I might refer to please? I have tried searching online for tutorials but most walkthroughs refer to writing the plugin body itself (which might involve unnecessary stages/includes) and are thus not regarding packing existing JS. I hope someone might have the solution please? Note: Someone packaged an old version for me as a MSI installer for Internet Explorer 7 a year ago, which installed into Program Files with a plugin.dll plugin.tlb and plugin.InstallState plus BandObjectLib.dll Interop.SHDocVw.dll and Microsoft.mshtml.dll if that is useful.

    Read the article

  • Strange(?) Opera Floating

    - by SkaveRat
    I have some strange floating behaviour on opera (IE f's up completely different, but that's for later). I'm floating the i-icons to the right. It works nicely on Fx and WebKit, but opera shifts the icons down a bit. Anyone got an idea how this happenes? CSS: .dataRow { margin: 5px 0; clear:right; } .dataRow label{ display: block; float:left; width: 160px; vertical-align: middle; font-size: 80%; } .dataGroup a img { border:0;float:right; position:relative; right:0; } .dataGroup a:hover { background:#EBEDC7; text-decoration:none; } .dataGroup a.tooltip span { display:none; padding:2px 3px; margin-top:20px; width:100px; font-size: 80%; } .dataGroup a.tooltip:hover span { display:inline; position:absolute; border:1px solid #632D11; background:#C2BD6C; color:#fff; } HTML: <fieldset class="dataGroup"> <div class="dataRow"><label>Foobar:</label> <input name="foobar" size="10" value="somedata" /> <a href="#" class="tooltip"><img src="/img/admin/information.png"/><span>Tooltip Info</span></a></div> </fieldset>

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • How to organize and manage multiple database credentials in application?

    - by Polaris878
    Okay, so I'm designing a stand-alone web service (using RestLET as my framework). My application is divided in to 3 layers: Data Layer (just above the database, provides APIs for connecting to/querying database, and a database object) Object layer (responsible for serialization from the data layer... provides objects which the client layer can use without worrying about database) Client layer (This layer is the RestLET web service... basically just creates objects from the object layer and fulfills webservice request) Now, for each object I create in the object layer, I want to use different credentials (so I can sandbox each object...). The object layer should not know the exact credentials (IE the login/pw/DB URL etc). What would be the best way to manage this? I'm thinking that I should have a super class Database object in my data layer... and each subclass will contain the required log-in information... this way my object layer can just go Database db = new SubDatabase(); and then continue using that database. On the client level, they would just be able to go ItemCollection items = new ItemCollection(); and have no idea/control over the database that gets connected. I'm asking this because I am trying to make my platform extensible, so that others can easily create services off of my platform. If anyone has any experience with these architectural problems or how to manage this sort of thing I'd appreciate any insight or advice... Feel free to ask questions if this is confusing. Thanks! My platform is Java, the REST framework I'm using is RestLET, my database is MySQL.

    Read the article

  • Paperclip failing to upload on specific scaffold, yet works on others

    - by Saifis
    I know there are tons of questions about paperclip, but I failed to find the answer to my problem. I know its prob just something simple, but I I'm running out of hair to pull out. I have paperclip working on other parts of my project, they work with no problem, however, a certain scaffold fails to upload, all the attributes to the uploaded file are nil. Here are the relevant information. Model: has_attached_file :foo, :styles => { :thumb => "140x140>" }, :url => "/data/:id/:style/:basename.:extension", :path => ":rails_root/public/data/:id/:style/:basename.:extension" View: <% form_for(@bar, :html => { :multipart => true }) do |f| %> <%= f.error_messages %> ---------- <li><%= f.label :top %> <%= f.file_field :foo %></li> ---------- <ul><%= f.submit "Save" %></ul> <% end %> Also, comparing the logs to the parts that work, the :foo attribute seems to be passing different values than in the ones that work. In the logs, when the paperclip function works, it looks like this "image"=>#<File:/var/folders/M5/M5HEb+WhFxmqNDGH5s-pNE+++TI/-Tmp-/RackMultipart20100512-1302-5e2e6e-0> when it does not, it seems to pass the file name directly "foo"=>"foo_image.png" I am developing locally on MacOSX using local rails and ruby libs.

    Read the article

  • Components don't show in custom JPanel/JComponent

    - by Bart van Heukelom
    I've created a custom swing component. I can see it (the grid from the paint method is drawn), but the buttons that are added (verified by println) aren't shown. What am I doing wrong? Background information: I'm trying to build a tree of visible objects like the Flash/AS3 display list. public class MapPanel extends JComponent { // or extends JPanel, same effect private static final long serialVersionUID = 4844990579260312742L; public MapPanel(ShapeMap map) { setBackground(Color.LIGHT_GRAY); setPreferredSize(new Dimension(1000,1000)); setLayout(null); for (Layer l : map.getLayers()) { // LayerView layerView = new LayerView(l); // add(layerView); System.out.println(l); JButton test = new JButton(l.getName()); add(test); validate(); } } @Override protected void paintComponent(Graphics g) { // necessary? super.paintComponent(g); // background g.setColor(getBackground()); g.fillRect(0, 0, getWidth(), getHeight()); // grid g.setColor(Color.GRAY); for (double x = 0; x < getWidth(); x += 10) { g.drawLine((int)x, 0, (int)x, getHeight()); } for (double y = 0; y < getHeight(); y += 10) { g.drawLine(0, (int)y, getWidth(), (int)y); } } }

    Read the article

  • Rotating UIWebView with transform, content partially off screen, how to get it to stick on screen?

    - by jarmod
    I have a 320x416 portrait-shaped UIWebView filling a UIViewController's view. I also have a 90 degree rotate button that will transform the UIWebView through 90 degrees each time the button is touched. The code is basically: webView.transform = CGAffineTransformMakeRotation(touches%4 * M_PI/2.0); After rotation through 90 degrees, the now-landscape transformed UIWebView extends beyond both the left and right edges of the screen. In the process of applying the transformation, iPhone OS has changed the UIWebView's frame from {{0,0}, {320,416}} to {{-48,48}, {416,320}}. Don't have a problem with that. I then tweak the UIWebView's frame origin to (0,0) so that it starts top-left, but extends a little further beyond the right edge of the screen. Now, I can touch the UIWebView and pull it left to view the hidden information on the right but I cannot get the right-hand end to to stay on the screen -- the moment I untouch it, the right side bounces back off the screen. What is it that causes the view to bounce back off-screen? In other words, what is it that I need to tweak to allow either the left edge or the right edge to stick on the screen and remain visible (only one at a time, obviously)? Thanks.

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Is this WPF error handling a good idea ?

    - by Adiel
    I have a multi threaded wpf application with various HW interfaces. I want to react to several HW failures that can happen. For example : one of the interfaces is a temperature sensor and i want that from a certain temp. a meesage would appear and notify the user that it happened. i came up with the follwing design : /// <summary> /// This logic reacts to errors that occur during the system run. /// The reaction is set by the component that raised the error. /// </summary> public class ErrorHandlingLogic : Logic { } the above class would consume ErrorEventData that holds all the information about the error that occurred. public class ErrorEventData : IEventData { #region public enum public enum ErrorReaction { } #endregion public enum #region Private Data Memebers and props private ErrorReaction m_ErrorReaction; public ErrorReaction ErrorReactionValue { get { return m_ErrorReaction; } set { m_ErrorReaction = value; } } private string m_Msg; public string Msg { get { return m_Msg; } set { m_Msg = value; } } private string m_ComponentName; public string ComponentName { get { return m_ComponentName; } set { m_ComponentName = value; } } #endregion Private Data Memebers and props public ErrorEventData(ErrorReaction reaction, string msg, string componenetName) { m_ErrorReaction = reaction; m_Msg = msg; m_ComponentName = componenetName; } } the above ErrorHandlingLogic would decide what to do with the ErrorEventData sent to him from various components of the application. if needed it would be forwarded to the GUI to display a message to the user. so what do you think is it a good design ? thanks, Adiel.

    Read the article

  • Reference - What does this error mean in PHP?

    - by hakre
    On Stackoverflow you can see a lot of questions popping up about errors. Some users do not even know that error messages exists, others are asking about code that gives an error message but they do not understand the error message. If the error message is common, many questions about the same kind of error appears, but it is hard to find existing Q&A about the topic. Please add "your favorite" error message, one per answer, a short description what it means (even if it is only highlighting terms to their manual page) and a listing of existing Q&A that are of value. This will create a list. The question is a community wiki, so you are not answering for reputation but for creating a reference list for new users. It's based on error messages. Compare with the existing Reference - What does this symbol mean in PHP? question, which works pretty well. What are common errors in PHP and what are their Solutions. Index of Errors Just starting, but there are already some: Warning: Cannot modify header information - headers already sent Warning: mysql_fetch_array() expects parameter 1 to be resource, boolean given in ... on line Parse error: syntax error, unexpected T_XXX in YYY on line ZZZ Fatal Error: Call to a member function ... on a non-object

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to have an iCalendar (RFC 2445) repeat YEARLY with duration

    - by Todd Brooks
    I have been unsuccessful in formulating a RRULE that would allow an event as shown below: Repeats YEARLY, from first Sunday of April to last day of May, occuring on Monday, Wednesday and Friday, until forever. FREQ=YEARLY;BYMONTH=4;BYDAY=SU (gives me the first Sunday of April repeating yearly) and FREQ=YEARLY;BYMONTH=5;BYMONTHDAY=-1 (gives me the last day of May repeating yearly) But I can't figure out how to have the event repeat yearly between those dates for Monday, Wednesday and Friday. Suggestions? Update: Comments don't have enough space to respond to Chris' answer, so I am editing the question with further information. Unfortunately, no. I don't know if it is the DDay.iCal library I'm using, or what, but that doesn't work either. I've found that the date start can't be an ordinal date (first Sunday, etc.)..it has to be a specific date, which makes it difficult for my requirements. Even using multiple RRULE's it doesn't seem to work: BEGIN:VCALENDAR VERSION:2.0 PRODID:-//DDay.iCal//NONSGML ddaysoftware.com//EN BEGIN:VEVENT CREATED:20090717T033307Z DTSTAMP:20090717T033307Z DTSTART:20090101T000000 RRULE:FREQ=YEARLY;WKST=SU;BYDAY=MO,WE,FR;BYMONTH=4,5 RRULE:FREQ=YEARLY;WKST=SU;BYDAY=1SU;BYMONTH=4 RRULE:FREQ=YEARLY;WKST=SU;BYMONTH=5;BYMONTHDAY=-1 SEQUENCE:0 UID:352ed9d4-04d0-4f06-a094-fab7165e5c74 END:VEVENT END:VCALENDAR That looks right on the face (I'm even starting the event on 1/1/2009), but when I start testing whether certain days are valid, I get incorrect results. For example, 4/1/2009 12:00:00 AM = True // Should be False 4/6/2009 12:00:00 AM = True 4/7/2009 12:00:00 AM = False 4/8/2009 12:00:00 AM = True 5/1/2009 12:00:00 AM = True 5/2/2009 12:00:00 AM = False 5/29/2009 12:00:00 AM = True 5/31/2009 12:00:00 AM = True // Should be False 6/1/2009 12:00:00 AM = False I'm using Douglas Day's DDay.iCal software, but I don't think it is a bug in that library. I think this might be a limitation in iCalendar (RFC 2445). Thoughts?

    Read the article

  • table design for storing large number of rows

    - by hyperboreean
    I am trying to store in a postgresql database some unique identifiers along with the site they have been seen on. I can't really decide which of the following 3 option to choose in order to be faster and easy maintainable. The table would have to provide the following information: the unique identifier which unfortunately it's text the sites on which that unique identifier has been seen The amount of data that would have to hold is rather large: there are around 22 millions unique identifiers that I know of. So I thought about the following designs of the table: id - integer identifier - text seen_on_site - an integer, foreign key to a sites table This approach would require around 22 mil multiplied by the number of sites. id - integer identifier - text seen_on_site_1 - boolean seen_on_site_2 - boolean ............ seen_on_site_n - boolean Hopefully the number of sites won't go past 10. This would require only the number of unique identifiers that I know of, that is around 20 millions, but it would make it hard to work with it from an ORM perspective. one table that would store only unique identifiers, like in: id - integer unique_identifier - text, one table that would store only sites, like in: id - integer site - text and one many to many relation, like: id - integer, unique_id - integer (fk to the table storing identifiers) site_id - integer (fk to sites table) another approach would be to have a table that stores unique identifiers for each site So, which one seems like a better approach to take on the long run?

    Read the article

  • "variable tracking" is eating my compile time!

    - by wowus
    I have an auto-generated file which looks something like this... static void do_SomeFunc1(void* parameter) { // Do stuff. } // Continues on for another 4000 functions... void dispatch(int id, void* parameter) { switch(id) { case ::SomeClass1::id: return do_SomeFunc1(parameter); case ::SomeClass2::id: return do_SomeFunc2(parameter); // This continues for the next 4000 cases... } } When I build it like this, the build time is enormous. If I inline all the functions automagically into their respective cases using my script, the build time is cut in half. GCC 4.5.0 says ~50% of the build time is being taken up by "variable tracking" when I use -ftime-report. What does this mean and how can I speed compilation while still maintaining the superior cache locality of pulling out the functions from the switch? EDIT: Interestingly enough, the build time has exploded only on debug builds, as per the following profiling information of the whole project (which isn't just the file in question, but still a good metric; the file in question takes the most time to build): Debug: 8 minutes 50 seconds Release: 4 minutes, 25 seconds

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • Low Level Console Input

    - by Soulseekah
    I'm trying to send commands to to the input of a cmd.exe application using the low level read/write console functions. I have no trouble reading the text (scraping) using the ReadConsole...() and WriteConsole() functions after having attached to the process console, but I've not figured out how to write for example "dir" and have the console interpret it as a sent command. Here's a bit of my code: CreateProcess(NULL, "cmd.exe", NULL, NULL, FALSE, CREATE_NEW_CONSOLE, NULL, NULL, &si, &pi); AttachConsole(pi.dwProcessId); strcpy(buffer, "dir"); WriteConsole(GetStdHandle(STD_INPUT_HANDLE), buffer, strlen(buffer), &charRead, NULL); STARTUPINFO attributes of the process are all set to zero, except, of course, the .cb attribute. Nothing changes on the screen, however I'm getting an Error 6: Invalid Handle returned from WriteConsole to STD_INPUT_HANDLE. If I write to (STD_OUTPUT_HANDLE) I do get my dir written on the screen, but nothing of course happens. I'm guessing SetConsoleMode() might be of help, but I've tried many mode combinations, nothing helped. I've also created a quick console application that waits for input (scanf()) and echoes back whatever goes in, didn't work. I've also tried typing into the scanf() promp and then peek into the input buffer using PeekConsoleInput(), returns 0, but the INPUT_RECORD array is empty. I'm aware that there is another way around this using WriteConsoleInput() to directly inject INPUT_RECORD structured events into the console, but this would be way too long, I'll have to send each keypress into it. I hope the question is clear. Please let me know if you need any further information. Thanks for your help.

    Read the article

  • Sql Server Compact Edition version error.

    - by Tim
    I am working on .NET ClickOnce project that uses Sql Server 2005 Compact Edition to synchronize remote data through the use of a Merge replication. This application has been live for nearly a year now, and while we encounter occasional synchronization errors, things run quite smoothly for the most part. Yesterday a user reported an error that I have never seen before and have yet to find any information for online. Many users synchronize every night, and I haven't received error reports from anyone else, so this issue must be isolated to this particular user / client machine. Here are the full details of the error: -Error Code : 80004005 -Message : The message contains an unexpected replication operation code. The version of SQL Server Compact Edition Client Agent and SQL Server Compact Edition Server Agent should match. [ replication operation code = 31 ] -Minor Error : 28526 -Source : Microsoft SQL Server Compact Edition -Numeric Parameters : 31 One interesting thing that I've found is that his data does get synchronized to the server, so this error must occur after the upload completes. I have yet to determine whether or not changes at the server are still being downloaded to his subscription. Thinking that maybe there was some kind of version conflict going on, I had a remote desktop session with this user last night and uninstalled both the application and the SQL Server Compact Edition prerequisite, then reinstalled both from our ClickOnce publication site. I also removed his existing local database file so that upon synchronization, an entirely new subscription would be issued to him. Still his errors continue. I suppose the error may be somewhat general, and the text in the error message stating that the versions should match may not necessarily reflect the problem at hand. This site contains the only official reference to this error that I've been able to find, and it offers no more detail than the error message itself. Has anyone else encountered this error? Or at least know more about SQL Compact to have a better guess as to what is going on here? Any help / suggestions will be greatly appreciated!

    Read the article

  • Approaches for cross server content sharing?

    - by Anonymity
    I've currently been tasked with finding a best solution to serving up content on our new site from another one of our other sites. Several approaches suggested to me, that I've looked into include using SharePoint's Lists Web Service to grab the list through javascript - which results in XSS and is not an option. Another suggestion was to build a server side custom web service and use SharePoint Request Forms to get the information - this is something I've only very briefly looked at. It's been suggested that I try permitting the requesting site in the HTTP headers of the serving site since I have access to both. This ultimately resulted in a semi-working solution that had major security holes. (I had to include username/password in the request to appease AD Authentication). This was done by allowing Access-Control-Allow-Origin: * The most direct approach I could think of was to simply build in the webpart in our new environment to have the authors manually update this content the same as they would on the other site. Are any one of the suggestions here more valid than another? Which would be the best approach? Are there other suggestions I may be overlooking? I'm also not sure if WebCrawling or Content Scrapping really holds water here...

    Read the article

  • Blackberry Asynchronous HTTP Requests - How?

    - by Kai
    The app I'm working on has a self contained database. The only time I need HTTP request is when the user first loads the app. I do this by calling a class that verifies whether or not a local DB exists and, if not, create one with the following request: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); This xml returns a list of content, all of which have images that I want to fetch AFTER the original request is complete and stored. So something like this won't work: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); HttpRequest images = new HttpRequest("http://www.somedomain.com/xmlImages", "GET", this); images.start(); Since it will not treat this like an asynchronous request. I have not found much information on adding callbacks to httpRequest, or any other method I could use to ensure operation 2 does not execute until operation 1 is complete. Any help would be appreciated. Thanks

    Read the article

  • C++: parsing with simple regular expression or shoud I use sscanf?

    - by Helltone
    I need to parse a string like func1(arg1, arg2); func2(arg3, arg4);. It's not a very complex parsing problem, so I would prefer to avoid resorting to flex/bison or similar utilities. My first approch was to try to use POSIX C regcomp/regexec or Boost implementation of C++ std::regex. I wrote the following regular expression, which does not work (I'll explain why further on). "^" "[ ;\t\n]*" "(" // (1) identifier "[a-zA-Z_][a-zA-Z0-9_]*" ")" "[ \t\n]*" "(" // (2) non-marking "\[" "(" // (3) non-marking "[ \t]*" "(" // (4..n-1) argument "[a-zA-Z0-9_]+" ")" "[ \t\n]*" "," ")*" "[ \t\n]*" "(" // (n) last argument "[a-zA-Z0-9_]+" ")" "]" ")?" "[ \t\n]*" ";" Note that the group 1 captures the identifier and groups 4..n-1 are intended to capture arguments except the last, which is captured by group n. When I apply this regex to, say func(arg1, arg2, arg3) the result I get is an array {func, arg2, arg3}. This is wrong because arg1 is not in it! The problem is that in the standard regex libraries, submarkings only capture the last match. In other words, if you have for instance the regex "((a*|b*))*" applied on "babb", the results of the inner match will be bb and all previous captures will have been forgotten. Another thing that annoys me here is that in case of error there is no way to know which character was not recognized as these functions provide very little information about the state of the parser when the input is rejected. So I don't know if I'm missing something here... In this case should I use sscanf or similar instead? Note that I prefer to use C/C++ standard libraries (and maybe boost).

    Read the article

< Previous Page | 833 834 835 836 837 838 839 840 841 842 843 844  | Next Page >