Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 839/998 | < Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >

  • Distinct or group by on some columns but not others

    - by Nazadus
    I have a view that I'm trying to filter with something similar to DISTINCT on some columns but not others. I have a view like this: Name LastName Zip Street1 HouseholdID (may not be unique because it may have multiple addresses -- think of it in the logical sense as grouping persons but not physical locations; If you lookup HouseholdID 4130, you may get two rows.. or more, because the person may have mutiple mailing locations) City State I need to pull all those columns but filter on LastName,Zip, and Street1. Here's the fun part: The filter is arbitrary -- meaning I don't care which one of the duplicates goes away. This is for a mail out type thing and the other information is not used for any other reason than than to look up a specific person if needed (I have no idea why). So.. given one of the records, you can easily figure out the removed ones. As it stands now, my Sql-Fu fails me and I'm filtering in C# which is incredibly slow and is pretty much a foreach that starts with an empty list and adds the row in if the combined last name, zip, and street aren't are not in the list. I feel like I'm missing a simple / basic part of SQL that I should be understanding.

    Read the article

  • Where do I attach the StoreKit delegate and observer in a Cocos2d App?

    - by Jeff B
    I have figured out how all of the StoreKit stuff works and have actually tested working code... however, I have a problem. I made my "store" layer/scene the SKProductsRequestDelegate. Is this the correct thing to do? I get the initial product info like so: SKProductsRequest *productRequest = [[SKProductsRequest alloc] initWithProductIdentifiers: productIDs]; [productRequest setDelegate: self]; [productRequest start]; The problem is that if I transition to a new scene when a request is in progress, the current layer is retained by the productRequest. This means that touches on my new scene/layer are handled by both the new layer and the old layer. I could cancel the productRequest when leaving the scene, but: I do not know if it is in progress at that point. I cannot release it because it may or may not have been released by the request delegates. There has got to be a better way to do this. I could make the delegate a class external to the current layer, but then I do not know how to easily update the layer with the product information when the handler is called.

    Read the article

  • Inline function and global variable issue in Javascript

    - by Natim
    I have some code here : http://bitbucket.org/natim/lo53_tp1/src/tip/part3/camions/medias/js/tracking.js That I use to draw some information about trucks direction. The problem come from a function defined in a for loop like this one : ... for(i = 0; i < nb_trucks; i++) { ... contentString = '<div id="content">'+ trucks[i]['name'] + '</div>'; current_window = new google.maps.InfoWindow({ content: contentString }); infosWindow.push(current_window); current_marker = new google.maps.Marker({ map: map, position: new google.maps.LatLng(trucks[i]['end']['lat'], trucks[i]['end']['lon']), draggable: false, title: trucks[i]['name'] }); markers.push(current_marker); google.maps.event.addListener(current_marker, 'click', function() { current_window.open(map, current_marker); }); } In this code, you can see the last block google.maps.event.addListener(current_marker, 'click', function() { current_window.open(map, current_marker); }); And my problem is that current_marker in the addListener parameters is different from the one inside the function. The current_window and the current_marker inside the function is overide at each loop turn. How can I get it right ? Thanks

    Read the article

  • How to find which file is open in eclipse editor without using IEditorPart?

    - by Destructor
    I want to know which file (or even project is enough) is opened in eclipse editor? I know we can do this once we get IEditorPart from doSetInput method, IFile file = ((IFileEditorInput) iEditorPart).getFile(); But I want the name of file without using IEditorPart, how can I do the same? Checking which is the selected file in project explorer is not of much help because, user can select multiple files at once and open all simultaneously and I did not way to distinguish which file opened at what time. Adding more info: I have an editor specified for a particular type of file, now every time it opens, during intializing editor I have some operation to do based on project properties. While initializing editor, I need the file handle (of the one which user opened/double clicked) or the corresponding project handle. I have my editor something this way: public class MyEditor extends TextEditor{ @Override protected void initializeEditor() { setSourceViewerConfiguration(new MySourceViewerConfiguration( CDTUITools.getColorManager(), store, "MyPartitions", this)); } //other required methods @Override protected void doSetInput(IEditorInput input) throws CoreException { if(input instanceof IFileEditorInput) { IFile file = ((IFileEditorInput) input).getFile(); } } } as I have done in the doSetInput() method , I want the file handle(even project handle is sufficient). But the problem is in initializeEditor() function there is no reference to editorInput, hence I am unable to get the file handle. In the source viewer configuration file, I set the code scanners and this needs some project specific information that will set the corresponding rules.

    Read the article

  • Jquery Find an XML element based on the value of one of it's children

    - by NateD
    I'm working on a simple XML phonebook app to learn JQuery, and I can't figure out how to do something like this: When the user enters the first name of a contact in a textbox I want to find the entire record of that person. The XML looks like this: <phonebook> <person> <number> 555-5555</number> <first_name>Evelyn</first_name> <last_name>Remington</last_name> <address>Edge of the Abyss</address> <image>path/to/image</image> </person> <person> <number>+34 1 6444 333 2223230</number> <first_name>Max</first_name> <last_name>Muscle</last_name> <address>Mining Belt</address> <image>path/to/image</image> </person> </phonebook> and the best I've been able to do with the jQuery is something like this: var myXML; function searchXML(){ $.ajax({ type:"GET", url: "phonebook.xml", dataType: "xml", success: function(xml){myXML = $("xml").find("#firstNameBox").val())} }); } What I want it to do is return the entire <person> element so I can iterate through and display all that person's information. Any help would be appreciated.

    Read the article

  • Learning libraries without books or tutorials

    - by Kawili-wili
    While many ask questions about where to find good books or tutorials, I'd like to take the opposite tack. I consider myself to be an entry-level programmer ready to move up to mid-level. I have written code in c, c++, c#, perl, python, clojure, vb, and java, so I'm not completely clueless. Where I see a problem in moving to the next level is learning to make better use of the literally hundreds upon hundreds of libraries available out there. I seem paralyzed unless there is a specific example in a book or tutorial to hand-hold me, yet I often read in various forums where another programmer attempts to assist with a question. He/she will look through the docs or scan the available classes/methods in their favorite IDE and seem to grok what's going on in a relatively short period of time, even if they had no previous experience with that specific library or function. I yearn to break the umbilical chord of constantly spending hour upon hour searching and reading, searching and reading, searching and reading. Many times there is no book or tutorial, or if there is, the discussion glosses over my specific needs or the examples shown are too far off the path for the usage I had in mind or the information is outdated and makes use of deprecated components or the library itself has fallen out of mainstream, yet is still perfectly usable (but no docs, books, or tutorials to hand-hold). My question is: In the absence of books or tutorials, what is the best way to grok new or unfamiliar libraries? I yearn to slicken the grok path so I can get down to the business of doing what I love most -- coding.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • opengl + glew in Eclipse (for windows)

    - by echo
    I'm trying to get glew to work under eclipse (mingw) in windows. Seems as if it is extremely unusual not to use Visual Studio in this context. The install instructions for glew is simply "use the project file in build/vc6/"... The glew readme also writes: "If you wish to build GLEW from scratch (update the extension data from the net or add your own extension information), you need a Unix environment (including wget, perl, and GNU make). The extension data is regenerated from the top level source directory with: make extensions" In order to get glew to work in eclipse and windows I have to compile it in a unix environment? Is there no other way? Sure, it would probably be a learning experience to pull that off (if I were to succeed) but I feel that my time is best spent actually working on my project. And even if I did manage to crosscompile everything, would it work in anything but Visual Studio? Is the whole thing unfeasible and the best solution is to install Visual Studio? Google haven't been of much help, I feel like I am the only one that has ever attempted to do this (is there a good reason this?).

    Read the article

  • Why are my connections not closed even if I explicitly dispose of the DataContext?

    - by Chris Simpson
    I encapsulate my linq to sql calls in a repository class which is instantiated in the constructor of my overloaded controller. The constructor of my repository class creates the data context so that for the life of the page load, only one data context is used. In my destructor of the repository class I explicitly call the dispose of the DataContext though I do not believe this is necessary. Using performance monitor, if I watch my User Connections count and repeatedly load a page, the number increases once per page load. Connections do not get closed or reused (for about 20 minutes). I tried putting Pooling=false in my config to see if this had any effect but it did not. In any case with pooling I wouldn't expect a new connection for every load, I would expect it to reuse connections. I've tried putting a break point in the destructor to make sure the dispose is being hit and sure enough it is. So what's happening? Some code to illustrate what I said above: The controller: public class MyController : Controller { protected MyRepository rep; public MyController () { rep = new MyRepository(); } } The repository: public class MyRepository { protected MyDataContext dc; public MyRepository() { dc = getDC(); } ~MyRepository() { if (dc != null) { //if (dc.Connection.State != System.Data.ConnectionState.Closed) //{ // dc.Connection.Close(); //} dc.Dispose(); } } // etc } Note: I add a number of hints and context information to the DC for auditing purposes. This is essentially why I want one connection per page load

    Read the article

  • Silverlight, Flash, or JavaScript for web app that runs client-side, or just stick with C#?

    - by Sootah
    Silverlight, Flash, and JavaScript, oh my.. I have a couple of applications that I need to develop for one of my business partners that will be distributed to dozens of people. These applications will need to be able to query information from the internet (query via Google, grab feeds from our other sites, just general web access) and save files to their computer. The reason I want to host the application is so that it all can be centrally managed, and any updates would be instantly deployed to everyone that uses the service. There always seems to be headaches with developing a pure desktop app in a language like C# with regards to making sure people use the latest version, don't have some odd problem with the installer, etc. Since we don't want to tie up our server's CPU I want effectively all of the processing done client-side. Meaning that they would log into their account, access the app, and then all the work done within the app is all handled by their machine. Only specific data would be sent back to the server. So - which language is best for this? Microsoft's Silverlight, Adobe's Flash, or Sun's JavaScript? I've heard a lot of good things about Silverlight and have wanted to try it for some time. I've only done extremely limited JavaScript programming, and absolutely none with Flash. Or, with my main requirement being that the client does all of its own processing should I just stick with C#? Also, is there any way to integrate a C# app into a webpage? I've never even considered it (or have any idea if it's even possible) until just now. Thanks in advance! -Sootah

    Read the article

  • How to format the node_redis info function output?

    - by hh54188
    I want check the Redis info on my pc with node, so I use node_redis and run the info function: var redis = require("redis"), client = redis.createClient(); client.on("connect", function () { client.info(function (err, replay) { console.log(replay); }) }) but the response is un-format: `#Server\r\nredis_version:2.6.16\r\nredis_git_sha1:00000000\r\nredis_git_dirty:0\r\nredis_mode:standalone\r\nos:Linux 3.8.0-29-generic x86_64\r\narch_bits:64\r\nmultiplexing_api:epoll\r\ngcc_version:4.6.3\r\nprocess_id:2941\r\nrun_id:e60f261a6f4f6f081563a47961315eff6b1c005d\r\ntcp_port:6379\r\nuptime_in_seconds:1777\r\nuptime_in_days:0\r\nhz:10\r\nlru_clock:2040689\r\n\r\n# Clients\r\nconnected_clients:2\r\nclient_longest_output_list:0\r\nclient_biggest_input_buf:0\r\nblocked_clients:0\r\n\r\n# Memory\r\nused_memory:562584\r\nused_memory_human:549.40K\r\nused_memory_rss:2031616\r\nused_memory_peak:561784\r\nused_memory_peak_human:548.62K\r\nused_memory_lua:31744\r\nmem_fragmentation_ratio:3.61\r\nmem_allocator:jemalloc-3.2.0\r\n\r\n# Persistence\r\nloading:0\r\nrdb_changes_since_last_save:0\r\nrdb_bgsave_in_progress:0\r\nrdb_last_save_time:1383553917\r\nrdb_last_bgsave_status:ok\r\nrdb_last_bgsave_time_sec:-1\r\nrdb_current_bgsave_time_sec:-1\r\naof_enabled:0\r\naof_rewrite_in_progress:0\r\naof_rewrite_scheduled:0\r\naof_last_rewrite_time_sec:-1\r\naof_current_rewrite_time_sec:-1\r\naof_last_bgrewrite_status:ok\r\n\r\n# Stats\r\ntotal_connections_received:3\r\ntotal_commands_processed:5\r\ninstantaneous_ops_per_sec:0\r\nrejected_connections:0\r\nexpired_keys:0\r\nevicted_keys:0\r\nkeyspace_hits:0\r\nkeyspace_misses:0\r\npubsub_channels:0\r\npubsub_patterns:0\r\nlatest_fork_usec:0\r\n\r\n# Replication\r\nrole:master\r\nconnected_slaves:0\r\n\r\n# CPU\r\nused_cpu_sys:0.13\r\nused_cpu_user:0.19\r\nused_cpu_sys_children:0.00\r\nused_cpu_user_children:0.00\r\n\r\n# Keyspace\r\n' How can I turn it to an object? like: { redis_version:2.6.16, redis_git_sha1:00000000, redis_git_dirty:0, ...... } so that I can read each property's value, get information I need

    Read the article

  • How to access child div elements under a given condition with javascript?

    - by hlovdal
    My main question is to calculate the last alert message, but any other information is also welcome. I am trying to learn javascript (to use with greasemonkey later), but I am struggling a bit to grasp the DOM and how to process it. <html> <head> <script type="text/javascript"> function my_test() { var elements = document.getElementsByTagName("div"); // prints "found [object HTMLCollection] with length 8" alert("found " + elements + " with length " + elements.length); // prints "0:[object HTMLDivElement]" alert("0:" + elements[0]); // how to calculate the following? alert("for intereting one is AAAA and three is CCCC"); } </script> </head> <body> <div class="interesing"> <div class="one">AAAA</div> <div class="two">BBBB</div> <div class="three">CCCC</div> </div> <div class="boring"> <div class="one">1111</div> <div class="two">2222</div> <div class="three">3333</div> </div> <input type="button" onclick="my_test()" value="my test" </body> </html> So elements is now an array of elements and I can access each of them individually. But where can I find what methods/properties these elements have?

    Read the article

  • Spring security - same page to deliver different content based on user role

    - by Ramesh
    Hello, i tried to search for any previous post related to my issue but couldnt find any. I have a scenario where in page handles 3 different scenarios and one of them not working. This page returns different content depending on if the user is authenticated or anonymous. localhost:8080/myApp/muUrl?test=authenticatedContent - used for Scenario 1 & 2 localhost:8080/myApp/muUrl?test=anonymousContent - used for Scenario 3 Scenario: 1) Authenticated user accesing the page url - the user gets displayed correct information. Works fine 2) Anonymous user accesing page URL with parameters that requires authentication - If anonymous, there is second level of check on the content they are accessing. for example, based on the GET parameters, there is custom logic to determine if the user has to be authenticated. In which case the page gets redirected to login page (WORKS fine). 3) Anonymous user accessing page URL with parameters that doesnt need authentication - in this case i get the SAvedRequest and redirect to the URL which is taking me to an infinite loop. Am i missing something very obvious or is there a way in AuthenticationProcessFilterEntryPoint to say "DON'T redirect to LOGIN page but process it" ? thanks.

    Read the article

  • PHP/Javascript limiting amount of checkboxes

    - by Carl294
    Hi everyone Im trying to limit the amount of checkboxes that can be checked, in this case only 3 can be checked. When using plain HTML this works fine. The code can be seen below. HTML example <td ><input type=checkbox name=ckb value=2 onclick='chkcontrol()';></td><td>Perl</td> Javascript Function <script type="text/javascript"> function chkcontrol(j) { var total=0; for(var i=0; i < document.form1.ckb.length; i++){ if(document.form1.ckb[i].checked){ total =total +1;} if(total > 3){ alert("Please Select only three") document.form1.ckb[j].checked = false; return false; } } } </script> The problem appears when replacing the fixed HTML values with values from a MYSQL database. All the information appears correctly, and can be posted to another page via a submit button. However, it seems like the 'value' assigned to each record from the database is not making its way too the javascript function. <td><input name="checkbox[]" type="checkbox" value="<?php echo $rows['TCA_QID'];?>" onclick="chkcontrol();"></td> I have tried changed the name in the javascript function to match the 'checkbox' name.Any advice would be greatly appreciated Thanks

    Read the article

  • Why can't I display a unicode character in the Python Interpreter on Mac OS X Terminal.app?

    - by apphacker
    If I try to paste a unicode character such as the middle dot: · in my python interpreter it does nothing. I'm using Terminal.app on Mac OS X and when I'm simply in in bash I have no trouble: :~$ · But in the interpreter: :~$ python Python 2.6.1 (r261:67515, Feb 11 2010, 00:51:29) [GCC 4.2.1 (Apple Inc. build 5646)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> ^^ I get nothing, it just ignores that I just pasted the character. If I use the escape \xNN\xNN representation of the middle dot '\xc2\xb7', and try to convert to unicode, trying to show the dot causes the interpreter to throw an error: >>> unicode('\xc2\xb7') Traceback (most recent call last): File "<stdin>", line 1, in <module> UnicodeDecodeError: 'ascii' codec can't decode byte 0xc2 in position 0: ordinal not in range(128) I have setup 'utf-8' as my default encoding in sitecustomize.py so: >>> sys.getdefaultencoding() 'utf-8' What gives? It's not the Terminal. It's not Python, what am I doing wrong?! This question is not related to this question, as that indivdiual is able to paste unicode into his Terminal.

    Read the article

  • Android ArrayList<Location> passing between activities

    - by squixy
    I have simple class Track, which stores information about route: import java.io.Serializable; import java.util.ArrayList; import java.util.Date; import android.location.Location; public class Track implements Serializable { private static final long serialVersionUID = -5317697499269650204L; private Date date; private String name; private int time; private double distance, speed; private ArrayList<Location> route; public Track(String name, int time, double distance, ArrayList<Location> route) { this.date = new Date(); this.name = name; this.time = time; this.distance = distance; this.speed = distance / (time / 3600.); this.route = route; } public String getDate() { return String.format("Date: %1$td-%1$tb-%1$tY%nTime: %1$tH:%1$tM:%1$tS", date); } public String getName() { return name; } public int getTime() { return time; } public double getDistance() { return distance; } public float getSpeed() { return (float) speed; } public ArrayList<Location> getRoute() { return route; } @Override public String toString() { return String.format("Name: %s%nDate: %2$td-%2$tb-%2$tY%nTime: %2$tH:%2$tM:%2$tS", name, date); } } And I'm passing it from one activity to another: Intent showTrackIntent = new Intent(TabSavedActivity.this, ShowTrackActivity.class); showTrackIntent.putExtra("track", adapter.getItem(position)); startActivity(showTrackIntent); Where (Track object is element on ListView). I get error during passing Track object: java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = classes.Track) What is happening?

    Read the article

  • Updating a listitem in an ASPX page in SharePoint Designer

    - by Andy
    Hey All, Right now I'm using SharePoint Designer to create a new aspx page. I am using a data view to display information from a list. One of the fields in the list is a choice field. I was wondering if there was anyway that I could display all of the other fields but allow one field in the list to be edited on the page without adding an edit link. Ideally, I would like a user to go in and be able to edit a field value (hopefully in a drop down list) within a data view without being redirected to the list or a form. I'm thinking there is a way to do this through javascript to embed inside the HTML or through a workflow of some sort. I'm new to javascript and don't know how to do this. I have tried to insert a drop down list and provide a data source for it but it will only show all of the field values in the list. Thus, I am unable to display the choice options, show the current value in the listitem and edit/update the listitem. Hopefully this makes sense. Can anyone help me out here? Thanks a lot, Andy

    Read the article

  • how to Solve the "Digg" problem in MongoDB

    - by user193116
    A while back,a Digg developer had posted this blog ,"http://about.digg.com/blog/looking-future-cassandra", where the he described one of the issues that were not optimally solved in MySQL. This was cited as one of the reasons for their move to Cassandra. I have been playing with MongoDB and I would like to understand how to implement the MongoDB collections for this problem From the article, the schema for this information in MySQL : CREATE TABLE Diggs ( id INT(11), itemid INT(11), userid INT(11), digdate DATETIME, PRIMARY KEY (id), KEY user (userid), KEY item (itemid) ) ENGINE=InnoDB DEFAULT CHARSET=utf8; CREATE TABLE Friends ( id INT(10) AUTO_INCREMENT, userid INT(10), username VARCHAR(15), friendid INT(10), friendname VARCHAR(15), mutual TINYINT(1), date_created DATETIME, PRIMARY KEY (id), UNIQUE KEY Friend_unique (userid,friendid), KEY Friend_friend (friendid) ) ENGINE=InnoDB DEFAULT CHARSET=utf8; This problem is ubiquitous in social networking scenario implementation. People befriend a lot of people and they in turn digg a lot of things. Quickly showing a user what his/her friends are up to is very critical. I understand that several blogs have since then provided a pure RDBMs solution with indexes for this issue; however I am curious as to how this could be solved in MongoDB.

    Read the article

  • C++ Declarative Parsing Serialization

    - by Martin York
    Looking at Java and C# they manage to do some wicked processing based on special languaged based anotation (forgive me if that is the incorrect name). In C++ we have two problems with this: 1) There is no way to annotate a class with type information that is accessable at runtime. 2) Parsing the source to generate stuff is way to complex. But I was thinking that this could be done with some template meta-programming to achieve the same basic affect as anotations (still just thinking about it). Like char_traits that are specialised for the different types an xml_traits template could be used in a declaritive way. This traits class could be used to define how a class is serialised/deserialized by specializing the traits for the class you are trying to serialize. Example Thoughs: template<typename T> struct XML_traits { typedef XML_Empty Children; }; template<> struct XML_traits<Car> { typedef boost::mpl::vector<Body,Wheels,Engine> Children; }; template<typename T> std::ostream& Serialize(T const&) { // my template foo is not that strong. // but somthing like this. boost::mpl::for_each<typename XML_Traits<T>::Children,Serialize>(data); } template<> std::ostream& Serialize<XML_Empty>(T const&) { /* Do Nothing */ } My question is: Has anybody seen any projects/decumentation (not just XML) out there that uses techniques like this (template meta-programming) to emulate the concept of annotation used in languges like Java and C# that can then be used in code generation (to effectively automate the task by using a declaritive style). At this point in my research I am looking for more reading material and examples.

    Read the article

  • Lost in dates and timezones

    - by Sebastien
    I'm working on an application that stores conferences with their start and end date. Up until now, I was developing in Belgium and my server is in France, so everything is in the same timezone, no problem. But today, I'm in San Francisco, my server is in France and I noticed I have a bug. I'm setting dates from a Flex client (ActionScript automatically adapts date display according to client local timezone, which is GMT-8 for me today. My server runs on Hibernate and MySQL in France (GMT+1). So when I look at my database using phpMyAdmin, I see a date set to "2010-06-07 00:00:01" but in my Flex client it displays "2010-06-06 15:00:01". Ultimately, what I want is that the dates are displayed in the local timezone of the event, which is the date I set it to. So when I'm in Belgium and I set the start date of an event to be "2010-06-07 00:00:01" I want to retrieve it that way. But I'm lost as to what layer adapts what. Is timezone stored in DATETIME MySQL columns (I can't see it in MySQL)? Does Hibernate to anything to it when it transfers it to java.lang.Date that has Timezone information? And ultimately, what is the best way to solve this mess?

    Read the article

  • Potential problem with C standard malloc'ing chars.

    - by paxdiablo
    When answering a comment to another answer of mine here, I found what I think may be a hole in the C standard (c1x, I haven't checked the earlier ones and yes, I know it's incredibly unlikely that I alone among all the planet's inhabitants have found a bug in the standard). Information follows: Section 6.5.3.4 ("The sizeof operator") para 2 states "The sizeof operator yields the size (in bytes) of its operand". Para 3 of that section states: "When applied to an operand that has type char, unsigned char, or signed char, (or a qualified version thereof) the result is 1". Section 7.20.3.3 describes void *malloc(size_t sz) but all it says is "The malloc function allocates space for an object whose size is specified by size and whose value is indeterminate". It makes no mention at all what units are used for the argument. Annex E startes the 8 is the minimum value for CHAR_BIT so chars can be more than one byte in length. My question is simply this: In an environment where a char is 16 bits wide, will malloc(10 * sizeof(char)) allocate 10 chars (20 bytes) or 10 bytes? Point 1 above seems to indicate the former, point 2 indicates the latter. Anyone with more C-standard-fu than me have an answer for this?

    Read the article

  • Dynamic TextBox on LinkButton click

    - by Alex Peta
    I am creating dynamic TextBoxes in a page by clicking a LinkButton. However, after that, if the page is submitted, I can't find the items created dynamically, thus, can't send the information to the database. protected void lbAddTag_Click(object sender, EventArgs e) { for (int i = 0; i < 3;i++ ) { CreateTextBox("txtTag-" + i.ToString()); } } private void CreateTextBox(string ID) { TextBox txt = new TextBox(); txt.ID = ID; txt.Width = Unit.Pixel(300); //txt.TextChanged += new EventHandler(OnTextChanged); txt.AutoPostBack = false; tagsPanel.Controls.Add(txt); Literal lt = new Literal(); lt.Text = "<br /><br />"; tagsPanel.Controls.Add(lt); } If I put: foreach (Control c in tagsPanel.Controls) { if (c is TextBox) { lblError.Text += c.ClientID + " , "; } } in the lbAddTag_Click method I can see the items, and they exist, but if I submit the page and try to insert the values in the database nothing... Any hint is much appreciated.

    Read the article

  • Determine whether app is communicating with APNS sandbox or production environment

    - by goldierox
    I have push notifications set up in my app. I'm trying to determine whether the device token I've received from APNS in the application:didRegisterForRemoteNotificationsWithDeviceToken: method came from the sandbox or development environment. If I can distinguish which environment initialized the token, I'll be able to tell my server to which environment to send the push notification. I've tried using the DEBUG macro to determine this, but I've seen some strange behavior with this and don't trust it to be 100% correct. #ifdef DEBUG BOOL isProd = YES; #else BOOL isProd = NO; #endif Ideally, I'd be able to examine the aps-environment entitlement (value is Development or Production) in code, but I'm not sure if this is even possible. What's the proper way to determine whether your app is communicating with the APNS sandbox or production environments? I'm assuming that the server needs to know this in the first place. Please correct me if this is assumption is incorrect. Edited: Apple's documentation on Provider Communication with APNS details the difference between communicating with the sandbox and production. However, the documentation doesn't give information on how to be consistent with registering the token (from the iOS client app) and communicating with the server.

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Why am I returning empty records when querying in mysql with php?

    - by Brian Bolton
    I created the following script to query a table and return the first 30 results. The query returns 30 results, but they do not have any text or information. Why would this be? The table stores Vietnamese characters. The database is mysql4. Here's the page: http://saomaidanang.com/recentposts.php Here's the code: <?php header( 'Content-Type: text/html; charset=utf-8' ); //CONNECTION INFO $dbms = 'mysql'; $dbhost = 'xxxxx'; $dbname = 'xxxxxxx'; $dbuser = 'xxxxxxx'; $dbpasswd = 'xxxxxxxxxxxx'; $conn = mysql_connect($dbhost, $dbuser, $dbpasswd ) or die('Error connecting to mysql'); mysql_select_db($dbname , $conn); //QUERY $result = mysql_query("SET NAMES utf8"); $cmd = 'SELECT * FROM `phpbb_posts_text` ORDER BY `phpbb_posts_text`.`post_subject` DESC LIMIT 0, 30 '; $result = mysql_query($cmd); ?> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html dir="ltr"> <head> <title>recent posts</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> </head> <body> <p> <?php //DISPLAY while ($myrow = mysql_fetch_row($result)) { echo 'post subject:'; echo(utf8_encode($myrow ['post_subject'])); echo 'post text:'; echo(utf8_encode($myrow ['post_text'])); } ?> </p> </body>

    Read the article

< Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >