Search Results

Search found 22900 results on 916 pages for 'pascal case'.

Page 851/916 | < Previous Page | 847 848 849 850 851 852 853 854 855 856 857 858  | Next Page >

  • log4bash: Cannot find a way to add MaxBackupIndex to this logger implementation

    - by Syffys
    I have been trying to modify this log4bash implementation but I cannot manage to make it work. Here's a sample: #!/bin/bash TRUE=1 FALSE=0 ############### Added for testing log4bash_LOG_ENABLED=$TRUE log4bash_rootLogger=$TRACE,f,s log4bash_appender_f=file log4bash_appender_f_dir=$(pwd) log4bash_appender_f_file=test.log log4bash_appender_f_roll_format=%Y%m log4bash_appender_f_roll=$TRUE log4bash_appender_f_maxBackupIndex=10 #################################### log4bash_abs(){ if [ "${1:0:1}" == "." ]; then builtin echo ${rootDir}/${1} else builtin echo ${1} fi } log4bash_check_app_dir(){ if [ "$log4bash_LOG_ENABLED" -eq $TRUE ]; then dir=$(log4bash_abs $1) if [ ! -d ${dir} ]; then #log a seperation line mkdir $dir fi fi } # Delete old log files # $1 Log directory # $2 Log filename # $3 Log filename suffix # $4 Max backup index log4bash_delete_old_files(){ ##### Added for testing builtin echo "Running log4bash_delete_old_files $@" &2 ##### if [ "$log4bash_LOG_ENABLED" -eq $TRUE ] && [ -n "$3" ] && [ "$4" -gt 0 ]; then local directory=$(log4bash_abs $1) local filename=$2 local maxBackupIndex=$4 local suffix=$(echo "${3}" | sed -re 's/[^.]/?/g') local logFileList=$(find "${directory}" -mindepth 1 -maxdepth 1 -name "${filename}${suffix}" -type f | xargs ls -1rt) local fileCnt=$(builtin echo -e "${logFileList}" | wc -l) local fileToDeleteCnt=$(($fileCnt-$maxBackupIndex)) local fileToDelete=($(builtin echo -e "${logFileList}" | head -n "${fileToDeleteCnt}" | sed ':a;N;$!ba;s/\n/ /g')) ##### Added for testing builtin echo "log4bash_delete_old_files About to start deletion ${fileToDelete[@]}" &2 ##### if [ ${fileToDeleteCnt} -gt 0 ]; then for f in "${fileToDelete[@]}"; do #### Added for testing builtin echo "Removing file ${f}" &2 #### builtin eval rm -f ${f} done fi fi } #Appender # $1 Log directory # $2 Log file # $3 Log file roll ? # $4 Appender Name log4bash_filename(){ builtin echo "Running log4bash_filename $@" &2 local format local filename log4bash_check_app_dir "${1}" if [ ${3} -eq 1 ];then local formatProp=${4}_roll_format format=${!formatProp} if [ -z ${format} ]; then format=$log4bash_appender_file_format fi local suffix=.`date "+${format}"` filename=${1}/${2}${suffix} # Old log files deletion local previousFilenameVar=int_${4}_file_previous local maxBackupIndexVar=${4}_maxBackupIndex if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then builtin eval export $previousFilenameVar=$filename log4bash_delete_old_files "${1}" "${2}" "${suffix}" "${!maxBackupIndexVar}" else builtin echo "log4bash_filename $previousFilenameVar = ${!previousFilenameVar}" fi else filename=${1}/${2} fi builtin echo $filename } ######################## Added for testing filename_caller(){ builtin echo "filename_caller Call $1" output=$(log4bash_abs $(log4bash_filename "${log4bash_appender_f_dir}" "${log4bash_appender_f_file}" "1" "log4bash_appender_f" )) builtin echo ${output} } #### Previous logs generation for i in {1101..1120}; do file="${log4bash_appender_f_file}.2012${i:2:3}" builtin echo "${file} $i" touch -m -t "2012${i}0000" ${log4bash_appender_f_dir}/$file done for i in {1..4}; do filename_caller $i done I expect log4bash_filename function to step into the following if only when the calculated log filename is different from the previous one: if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then For this scenario to apply, I'd need ${!previousFilenameVar} to be correctly set, but it's not the case, so log4bash_filename steps into this if all the time which is really not necessary... It looks like the issue is due to the following line not working properly: builtin eval export $previousFilenameVar=$filename I have a some theories to explain why: in the original code, functions are declared and exported as readonly which makes them unable to modify global variable. I removed readonly declarations in the above sample, but probleme persists. Function calls are performed in $() which should make them run into seperated shell instances so variable modified are not exported to the main shell But I cannot manage to find a workaround to this issue... Any help is appreciated, thanks in advance!

    Read the article

  • Android Bluetooth Fails to Pair

    - by CaseyB
    I am having a problem getting my devices to pair in Android. If I go into the settings and pair them manually I can get them to connect using the following code: Server // Make sure the device it discoverable mServerSocket = mAdapter.listenUsingRfcommWithServiceRecord("Moo Productions Bluetooth Server", mUUID); mState = State.ACCEPTING; BluetoothSocket socket = mServerSocket.accept(); mServerSocket.close(); connected(socket); Client Set<BluetoothDevice> pairedDevices = mAdapter.getBondedDevices(); BluetoothSocket socket = null; // Search the list of paired devices for the right one for(BluetoothDevice device : pairedDevices) { try { mState = State.SEARCHING; socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); connected(socket); break; } catch (IOException e) { socket = null; continue; } } But if the devices hadn't already been paired it gets out of the foreach without connecting to a valid socket. In that case I start discovering. // If that didn't work, discover if(socket == null) { mState = State.SEARCHING; mReceiver = new SocketReceiver(); mContext.registerReceiver(mReceiver, new IntentFilter(BluetoothDevice.ACTION_FOUND)); mAdapter.startDiscovery(); } // ... Later ... private class SocketReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if(BluetoothDevice.ACTION_FOUND.equals(intent.getAction())) { try { // Get the device and try to open a socket BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); BluetoothSocket socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); // This is our boy, so stop looking mAdapter.cancelDiscovery(); mContext.unregisterReceiver(mReceiver); connected(socket); } catch (IOException ioe) { ioe.printStackTrace(); } } } } But it will never find the other device. I never get a pairing dialog and when I step through I see that it discovers the correct device, but it fails to connect with this exception java.io.IOException: Service discovery failed. Any ideas as to what I'm missing?

    Read the article

  • Asp.net MVC jquery-ajax dont render html

    - by Troublesum
    Hi, Im trying to use jqeury ajax with MVC i can get it to post back to the action i want and it returns the ViewData objects with updated Data but never renders the HTML. I have i View which contains some MVC User Controls and i want them to update on a timer. Here is my View Markup <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/PageWithSummaryViewAndTabs.Master" Inherits="System.Web.Mvc.ViewPage" %> <asp:Content ID="FullCaseTitle" ContentPlaceHolderID="TitleContent" runat="server"> </asp:Content> <asp:Content ID="FullCaseContent" ContentPlaceHolderID="MainContent" runat="server"> <script type="text/javascript"> window.setInterval(test, 5000); function test() { jQuery.get("/PatientCase/RefreshEPRF", function(response) { }); } </script> <div id="loadingDiv" style="display:none">Updating</div> <input id="refreshPatientCaseIndexButton" type="submit" visible="true" title="refresh" value="Refresh" /> <h2>Full Case</h2> <div id="EPRFContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> </div> <div id="ImageContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionImagery.ascx"); % On postback i call a Action Called RefreshEPRF which loads just the required user controls again <%@ Page Language="C#" Inherits="System.Web.Mvc.ViewPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> And finaly the marpup in the control <table id="detailstable"> <tr><td id="detailslablecolumn">Patient Name : </td><td> <% foreach (var item in (List<STS_Lite.Models.PatinetCase.EPRFItem>)ViewData["EPRF"]) { if (item.datumItemId == 46) { if (item.Stroke) { %> <img src="/PatientCaseIndex/InkImageData/GetInkImage/<%=ViewData["PatientCaseId"]%>/<%=ViewData["TemplateInstanceId"]%>/<%=item.TemplateItemId %>" /> <% } else {%> <%=item.Value.ToString()%> <%} break; } } %></td></tr><table> When i step through this code the ViewData in the user control has the new updated values but the page comes back with no new values. I have tried the jquery.get and ajax but with no luck. Any help would be great thanks

    Read the article

  • linq to sql with nservicebus table lock issue

    - by IGoor
    I am building a system using NServiceBus and my DataLayer is using Linq 2 SQL. The system is made up of 2 services. Service1 receives messages from NSB. It will query Table1 in my database and inserts a record into Table1 If a certain condition is met a new NSB message is sent to the 2nd service Service2 will update records also in Table1 when it receives messages from Service1 and it does some other non database related work. Service2 is a long running process. The problem I am having is the moment Service2 updates a record in Table1, the table is locked. The lock seems to be in place until Service2 has completed all it is processing. i.e. The lock is not released after my datacontext is disposed. This causes the query in Service1 to timeout. Once Service2 completes processing, Service1 resumes processing again without problem. So for example Service1 code may look like: int x =0; using (DataContext db = new DataContext()) { x = (from dp in db.Table1 select dp).Count(); // this line will timeout while service2 is processing Table1 t = new Table1(); t.Data = "test"; db.Table1.InsertOnSubmit(t); db.SubmitChanges(); } if(x % 50 == 0) CallService2(); The code in service2 may look like: using (DataContext db = new DataContext()) { Table1 t = db.Table1.Where(t => t.id == myId); t.Data = "updated"; db.SubmitChanges(); } // I would have expected the lock to have been released at this point, but this is not the case. DoSomeLongRunningTasks(); // lock will be released once service2 exits I don't understand why the lock is not released when the datacontext is disposed in Service2. To get around the problem I have been calling: db.ExecuteCommand("SET TRANSACTION ISOLATION LEVEL READ UNCOMMITTED"); and this works, but I am not happy using it. I want to solve this problem properly. Has any one experienced this sort of problem before and does any one know how to solve it? Why is the lock not released after the datacontext has been disposed? Thanks in advance. p.s. sorry for the extremely long post.

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • Hibernate @Transactional not starting transaction

    - by rhinds
    I have a web app using Hibernate, and I am attempting to persist some data, but it is failing to persist within a Transaction despite using the @Transactional annotation. My service class is as follows: @Service("profileService") public class ProfileService { private EntityManager entityManager; @Autowired private AccountService accountService; @Autowired private ProfileDAOImpl profileDao; @PersistenceContext public void setEntityManager(EntityManager em) { this.entityManager = em; } @Transactional public void addConnectionToAccount(SocialConnection sc) { entityManager.persist(sc); } } The addConnectionToAccount() method is being called from another Spring bean in a normal method, and the ProfileService class is currently being injected there: public class HibernateConnectionRepository implements ConnectionRepository { @Inject private ProfileService profileService; @Override @Transactional public void addConnection(SocialConnection sc) { try { profileService.addConnectionToAccount(accountId, sc); } catch (Exception e) { e.printStackTrace(); } } I tried putting the @Transactional annotation on the calling method in the vain hope that it might make a difference but nothing. Previously I have experienced problems like this its been because the object being persisted does not satisfy table restrictions (such as non-nullable columns as null) or because the method is being called from within the same class and the calling method is not Transactional, but neither of those are the case here.. Any ideas? it just fails silently, the logs are as follows: 2012-03-26 22:25:04,702 [http-bio-8085-exec-9] DEBUG com.mchange.v2.resourcepool.BasicResourcePool - trace com.mchange.v2.resourcepool.BasicResourcePool@1bc25c8 [managed: 3, unused: 2, excluded: 0] (e.g. com.mchange.v2.c3p0.impl.NewPooledConnection@e5b006) 2012-03-26 22:25:04,710 [http-bio-8085-exec-9] DEBUG org.hibernate.SQL - select SEQ_COUNT from SEQUENCE where SEQ_NAME = 'PO_SEQ' for update 2012-03-26 22:25:04,711 [http-bio-8085-exec-9] DEBUG org.hibernate.SQL - update SEQUENCE set SEQ_COUNT = ? where SEQ_COUNT = ? and SEQ_NAME = 'PO_SEQ' 2012-03-26 22:25:04,723 [http-bio-8085-exec-9] DEBUG com.mchange.v2.resourcepool.BasicResourcePool - trace com.mchange.v2.resourcepool.BasicResourcePool@1bc25c8 [managed: 3, unused: 2, excluded: 0] (e.g. com.mchange.v2.c3p0.impl.NewPooledConnection@e5b006) 2012-03-26 22:25:04,723 [http-bio-8085-exec-9] DEBUG org.hibernate.event.internal.AbstractSaveEventListener - Generated identifier: 2200, using strategy: org.hibernate.id.MultipleHiLoPerTableGenerator UPDATE Also wanted to mention that the HibernateConnectionRepository bean is not annotated and is actually being configured in an @Configuration class (if this makes any difference? not used @Configuration classes much). The method to create the bean is as follows: @Bean @Scope(value = "request", proxyMode = ScopedProxyMode.INTERFACES) public ConnectionRepository connectionRepository() { Authentication authentication = SecurityContextHolder.getContext().getAuthentication(); if (authentication == null) { throw new IllegalStateException("Unable to get a ConnectionRepository: no user signed in"); } ApplicationUser user = (ApplicationUser) authentication.getPrincipal(); return usersConnectionRepository().createConnectionRepository(String.valueOf(user.getAccountId())); } The bean is scoped to the logged in user, but may also be created multiple times for each user..

    Read the article

  • Backtracking infinite loop

    - by Greenhorn
    This is Exercise 28.1.2 from HtDP. I've successfully implemented the neighbors function and all test cases pass. (define Graph (list (list 'A (list 'B 'E)) (list 'B (list 'E 'F)) (list 'C (list 'D)) (list 'D empty) (list 'E (list 'C 'F)) (list 'F (list 'D 'G)) (list 'G empty))) (define (first-line n alist) (cond [(symbol=? (first alist) n) alist] [else empty])) ;; returns empty if node is not in graph (define (neighbors n g) (cond [(empty? g) empty] [(cons? (first g)) (cond [(symbol=? (first (first g)) n) (first-line n (first g))] [else (neighbors n (rest g))])])) ; test cases (equal? (neighbors 'A Graph) (list 'A (list 'B 'E))) (equal? (neighbors 'B Graph) (list 'B (list 'E 'F))) (equal? (neighbors 'C Graph) (list 'C (list 'D))) (equal? (neighbors 'D Graph) (list 'D empty)) (equal? (neighbors 'E Graph) (list 'E (list 'C 'F))) (equal? (neighbors 'F Graph) (list 'F (list 'D 'G))) (equal? (neighbors 'G Graph) (list 'G empty)) (equal? (neighbors 'H Graph) empty) The problem comes when I copy-paste the code from Figure 77 of the text. It is supposed to determine whether a destination node is reachable from an origin node. However it appears that the code goes into an infinite loop except for the most trivial case where the origin and destination nodes are the same. ;; find-route : node node graph -> (listof node) or false ;; to create a path from origination to destination in G ;; if there is no path, the function produces false (define (find-route origination destination G) (cond [(symbol=? origination destination) (list destination)] [else (local ((define possible-route (find-route/list (neighbors origination G) destination G))) (cond [(boolean? possible-route) false] [else (cons origination possible-route)]))])) ;; find-route/list : (listof node) node graph -> (listof node) or false ;; to create a path from some node on lo-Os to D ;; if there is no path, the function produces false (define (find-route/list lo-Os D G) (cond [(empty? lo-Os) false] [else (local ((define possible-route (find-route (first lo-Os) D G))) (cond [(boolean? possible-route) (find-route/list (rest lo-Os) D G)] [else possible-route]))])) Does the problem lie in my code? Thank you.

    Read the article

  • How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

    - by warvair
    I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

    Read the article

  • Passing objects to a UITypeEditor

    - by Kath
    I am currently hoping to use a PropertyGrid to allow users to edit some of my classes, however I've hit a wall with passing objects to the UITypeEditor(s) they use. When the user presses the drop down I want to show a listbox of already loaded textures to choose from, if they want to use a texture the application hasn't loaded yet they can click a button to choose one from a file dialog. In case I make no sense here a mock of the form: . My problem: To fill the listbox I need access to the class that manages the list of resources from the UITypeEditor. Now I've solved this problem for my own classes by giving them a reference on creation to their managing object. In the UITypeEditor I then use that reference to access what I need. However I can't do this for classes I haven't written, such as the XNA Texture2D class. Here are what the classes I'm using look like: class StaticGeometryChunk { // Geometry data to draw with. Contains a reference to its managing // class for use in its UITypeEditor. public GeometryData { get; set; } .... } class Material { // These are XNA classes. I can't just add a reference to its managing // class (I think?). public Texture2D Texture1 { get; set; } public Texture2D Texture2 { get; set; } .... } I've been looking at my options and they seem to be: Make the managing classes static. I don't really want to do this. There are several managing classes as each resource is loaded differently. There are also classes that need to be created before these and are passed in. Make the managing classes singletons. I don't really want to do this either. It seems like a quick and dirty way to "hide" the problem instead of "solve" it. I also might want the option of having several managing classes in the future which the singletons eliminate. Create a wrapper class which holds the reference to a managing class and its target (such as the XNA Texture2D). This is currently what I'm thinking of doing. Its would be quite simple and quick to do but something about it nags me but I don't know what. Any thoughts on the above or other methods to pass what I need into the UITypeEditor? Thank you for reading.

    Read the article

  • Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

    - by Ian Leslie
    I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

    Read the article

  • How to efficently build an interpreter (lexer+parser) in C?

    - by Rizo
    I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • User Defined Exceptions with JMX

    - by Daniel
    I have exposed methods for remote management in my application server using JMX by creating an MXBean interface, and a class to implement it. Included in this interface are operations for setting attributes on my server, and for getting the current value of attributes. For example, take the following methods: public interface WordManagerMXBean { public void addWord(String word); public WordsObject getWords(); public void removeWord(String word); } The WordsObject is a custom, serializable class used to retrieve data about the state of the server. Then I also have a WordManager class that implements the above interface. I then create a JMX agent to manage my resource: MBeanServer mbs = ManagementFactory.getPlatformMBeanServer(); ObjectName wordManagerName = new ObjectName("com.example:type=WordManager"); mbs.registerMBean(wordManager, wordManagerName); I have created a client that invokes these methods, and this works as expected. However, I would like to extend this current configuration by adding user defined exceptions that can be sent back to my client. So I would like to change my interface to something like this: public interface WordManagerMXBean { public void addWord(String word) throws WordAlreadyExistsException; public WordsObject getWords(); public void removeWord(String word); } My WordAlreadyExistsException looks like this: public class WordAlreadyExistsException extends Exception implements Serializable { private static final long serialVersionUID = -9095552123119275304L; public WordAlreadyExistsException() { super(); } } When I call the addWord() method in my client, I would like to get back a WordAlreadyExistsException if the word already exists. However, when I do this, I get an error like this: java.rmi.UnmarshalException: Error unmarshaling return; nested exception is: java.lang.ClassNotFoundException: com.example.WordAlreadyExistsException The WordAlreadyExistsException, the WordsObject and the WordManagerMXBean interface are all in a single jar file that is available to both the client and the server. If I call the getWords() method, the client has no difficulty handling the WordsObject. However, if a user defined exception, like the one above, is thrown, then the client gives the error shown above. Is it possible to configure JMX to handle this exception correctly in the client? Following some searching, I noticed that there is an MBeanException class that is used to wrap exceptions. I'm not sure if this wrapping is performed by the agent automatically, or if I'm supposed to do the wrapping myself. I tried both, but in either case I get the same error on the client. I have also tried this with both checked and unchecked exceptions, again the same error occurs. One solution to this is to simply pass back the error string inside a generic error, as all of the standard java exceptions work. But I'd prefer to get back the actual exception for processing by the client. Is it possible to handle user defined exceptions in JMX? If so, any ideas how?

    Read the article

  • Hibernate MappingException Unknown entity: $Proxy2

    - by slynn1324
    I'm using Hibernate annotations and have a VERY basic data object: import java.io.Serializable; import javax.persistence.Entity; import javax.persistence.Id; @Entity public class State implements Serializable { /** * */ private static final long serialVersionUID = 1L; @Id private String stateCode; private String stateFullName; public String getStateCode() { return stateCode; } public void setStateCode(String stateCode) { this.stateCode = stateCode; } public String getStateFullName() { return stateFullName; } public void setStateFullName(String stateFullName) { this.stateFullName = stateFullName; } } and am trying to run the following test case: public void testCreateState(){ Session s = HibernateUtil.getSessionFactory().getCurrentSession(); Transaction t = s.beginTransaction(); State state = new State(); state.setStateCode("NE"); state.setStateFullName("Nebraska"); s.save(s); t.commit(); } and get an org.hibernate.MappingException: Unknown entity: $Proxy2 at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.event.def.AbstractSaveEventListener.saveWithGeneratedId(AbstractSaveEventListener.java:121) .... I haven't been able to find anything referencing the $Proxy part of the error - and am at a loss.. Any pointers to what I'm missing would be greatly appreciated. hibernate.cfg.xml <property name="hibernate.connection.driver_class">org.hsqldb.jdbcDriver</property> <property name="connection.url">jdbc:hsqldb:hsql://localhost/xdb</property> <property name="connection.username">sa</property> <property name="connection.password"></property> <property name="current_session_context_class">thread</property> <property name="dialect">org.hibernate.dialect.HSQLDialect</property> <property name="show_sql">true</property> <property name="hbm2ddl.auto">update</property> <property name="hibernate.transaction.factory_class">org.hibernate.transaction.JDBCTransactionFactory</property> <mapping class="com.test.domain.State"/> in HibernateUtil.java public static SessionFactory getSessionFactory(boolean testing ) { if ( sessionFactory == null ){ try { String configPath = HIBERNATE_CFG; AnnotationConfiguration config = new AnnotationConfiguration(); config.configure(configPath); sessionFactory = config.buildSessionFactory(); } catch (Exception e){ e.printStackTrace(); throw new ExceptionInInitializerError(e); } } return sessionFactory; }

    Read the article

  • A NSMutableArray is destroying my life!

    - by camilo
    EDITED to show the relevant part of the code Hi. There's a strange problem with an NSMutableArray which I'm just not understanding... Explaining: I have a NSMutableArray, defined as a property (nonatomic, retain), synthesized, and initialized with 29 elements. realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; After the initialization, I can insert elements as I wish and everything seems to be working fine. While I'm running the application, however, if I insert a new element in the array, I can print the array in the function where I inserted the element, and everything seems ok. However, when I select a row in the table, and I need to read that array, my application crashes. In fact, it cannot even print the array anymore. Is there any "magical and logical trick" everybody should know when using a NSMutableArray that a beginner like myself can be missing? Thanks a lot. I declare my array as realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; I insert objects in my array with [realSectionNames addObject:[category categoryFirstLetter]]; although I know i can also insert it with [realSectionNames insertObject:[category categoryFirstLetter] atIndex:i]; where the "i" is the first non-occupied position. After the insertion, I reload the data of my tableView. Printing the array before or after reloading the data shows it has the desired information. After that, selecting a row at the table makes the application crash. This realSectionNames is used in several UITableViewDelegate functions, but for the case it doesn't matter. What truly matters is that printing the array in the beginning of the didSelectRowAtIndexPath function crashes everything (and of course, doesn't print anything). I'm pretty sure it's in that line, for printing anything he line before works (example): NSLog(@"Anything"); NSLog(@"%@", realSectionNames); gives the output: 2010-03-24 15:16:04.146 myApplicationExperience[3527:207] Anything [Session started at 2010-03-24 15:16:04 +0000.] GNU gdb 6.3.50-20050815 (Apple version gdb-967) (Tue Jul 14 02:11:58 UTC 2009) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 3527. Still not understanding what kind of stupidity I've done this time... maybe it's not too late to follow the career of brain surgeon?

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • How can I create a Base64-Encoded string from an GDI+ Image in C++?

    - by Schnapple
    I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

    Read the article

  • assistance required, hangman game.

    - by Phillip Gibson
    I am making a hangman game and am having trouble with part of it. I have selected a random word from a file, but I want to display the word as a series of undersocres __ and then match the letter chosen to a position in the undersocres. Can anyone help me? cout <<"1. Select to play the game\n"; cout <<"2. Ask for help\n"; cout <<"3. Select to quit the game\n"; cout << "Enter a selection: "; int number; cin >> number; while(number < 1 || number > 3 || cin.fail()) { if(cin.fail()) { cin.sync(); cin.clear(); cout << "You have not entered a number, please enter a menu selection between 1 and 3\n"; cin >> number; } else { cout << "Your selection must be between 1 and 3!\n"; cin >> number; } } switch (number) { case 1: { string word; string name; cout << " Whats your name? "; cin >> name; Player player(); ifstream FileReader; FileReader.open("words.txt"); if(!FileReader.is_open()) cout << "Error"; //this is for the random selection of words srand(time(0)); int randnum = rand()%10+1; for(int counter = 0; counter < randnum; counter++) { getline(FileReader, word, '\n'); } cout << "my word: " << word << "\n"; // get length of word int length; //create for loop for(int i = 0; i < length; i++) cout << "_"; //_ _ _ _ _ SetCursorPos(2,10); FileReader.close(); break;

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • How to draw a filled envelop like a cone on OpenGL (using GLUT)?

    - by ashishsony
    Hi, I am relatively new to OpenGL programming...currently involved in a project that uses freeglut for opengl rendering... I need to draw an envelop looking like a cone (2D) that has to be filled with some color and some transparency applied. Is the freeglut toolkit equipped with such an inbuilt functionality to draw filled geometries(or some trick)?? or is there some other api that has an inbuilt support for filled up geometries.. Thanks. Best Regards. Edit1: just to clarify the 2D cone thing... the envelop is the graphical interpretation of the coverage area of an aircraft during interception(of an enemy aircraft)...that resembles a sector of a circle..i should have mentioned sector instead.. and glutSolidCone doesnot help me as i want to draw a filled sector of a circle...which i have already done...what remains to do is to fill it with some color... how to fill geometries with color in opengl?? Thanks. Edit2: Ok thanks for replying...all the answers posted to this questions can work for my problem in a way.. But i would definitely would want to know a way how to fill a geometry with some color. Say if i want to draw an envelop which is a parabola...in that case there would be no default glut function to actually draw a filled parabola(or is there any??).. So to generalise this question...how to draw a custom geometry in some solid color?? Thanks. Edit3: The answer that mstrobl posted works for GL_TRIANGLES but for such a code: glBegin(GL_LINE_STRIP); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glEnd(); which draws a square...only a wired square is drawn...i need to fill it with blue color. anyway to do it? if i put some drawing commands for a closed curve..like a pie..and i need to fill it with a color is there a way to make it possible... i dont know how its possible for GL_TRIANGLES... but how to do it for any closed curve?? Thanks.

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

< Previous Page | 847 848 849 850 851 852 853 854 855 856 857 858  | Next Page >