Search Results

Search found 1546 results on 62 pages for 'lazy sequences'.

Page 9/62 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Trouble with Berkeley DB JE Base API Secondary Databases and Sequences

    - by milosz
    I have a class Document which consists of Id (int) and Url (String). I would like to have a primary index on Id and secondary index on Url. I would also like to have a sequence for Id auto-incrementation. So I create a SecondaryDatabase and then I create a Sequence. During initialisation of the Sequence I get an exception: Exception in thread "main" java.lang.IllegalArgumentException at com.sleepycat.util.UtfOps.getCharLength(UtfOps.java:137) at com.sleepycat.util.UtfOps.bytesToString(UtfOps.java:259) at com.sleepycat.bind.tuple.TupleInput.readString(TupleInput.java:152) at pl.edu.mimuw.zbd.berkeley.zadanie.rozwiazanie.MyDocumentBiding.entryToObject(MyDocumentBiding.java:12) at pl.edu.mimuw.zbd.berkeley.zadanie.rozwiazanie.MyDocumentBiding.entryToObject(MyDocumentBiding.java:1) at com.sleepycat.bind.tuple.TupleBinding.entryToObject(TupleBinding.java:76) at pl.edu.mimuw.zbd.berkeley.zadanie.rozwiazanie.UrlKeyCreator.createSecondaryKey(UrlKeyCreator.java:20) at com.sleepycat.je.SecondaryDatabase.updateSecondary(SecondaryDatabase.java:835) at com.sleepycat.je.SecondaryTrigger.databaseUpdated(SecondaryTrigger.java:42) at com.sleepycat.je.Database.notifyTriggers(Database.java:2004) at com.sleepycat.je.Cursor.putNotify(Cursor.java:1692) at com.sleepycat.je.Cursor.putInternal(Cursor.java:1616) at com.sleepycat.je.Cursor.putNoOverwrite(Cursor.java:663) at com.sleepycat.je.Sequence.<init>(Sequence.java:188) at com.sleepycat.je.Database.openSequence(Database.java:546) at pl.edu.mimuw.zbd.berkeley.zadanie.rozwiazanie.MyFullTextSearchEngine.init(MyFullTextSearchEngine.java:131) at pl.edu.mimuw.zbd.berkeley.zadanie.testy.MyFullTextSearchEngineTest.main(MyFullTextSearchEngineTest.java:18) It seems that during the initialisation of the sequence the secondary database is forced to update. When I debug the entryToObject method of MyDocumentBiding the bytes that it tries to convert to object seem random. What am I doing wrong?

    Read the article

  • Algorithm for measuring distance between disordered sequences

    - by Kinopiko
    The Levenshtein distance gives us a way to calculate the distance between two similar strings in terms of disordered individual characters: quick brown fox quikc brown fax The Levenshtein distance = 3. What is a similar algorithm for the distance between two strings with similar subsequences? For example, in quickbrownfox brownquickfox the Levenshtein distance is 10, but this takes no account of the fact that the strings have two similar subsequences, which makes them more "similar" than completely disordered words like quickbrownfox qburiocwknfox and yet this completely disordered version has a Levenshtein distance of eight. What distance measures exist which take the length of subsequences into account, without assuming that the subsequences can be easily broken into distinct words?

    Read the article

  • Merging sequences by type With LINQ

    - by jankor
    I want to use LINQ to convert this IEnumerable<int>[] value1ByType = new IEnumerable<int>[3]; value1ByType[0]= new [] { 0}; value1ByType[1]= new [] {10,11}; value1ByType[2]= new [] {20}; var value2ToType = new Dictionary<int,int> { {100,0}, {101,1}, {102,2}, {103,1}}; to this var value2ToValue1 = new Dictionary<int,int> { {100, 0}, {101,10}, {102,20}, {103,11}}; Is there a way to do this with LINQ? Without LINQ I would use multiple IEnumerators, one for each IEnumerable of value1ByType. like this: // create enumerators var value1TypeEnumerators = new List<IEnumerator<int>>(); for (int i = 0; i < value1ByType.Length; i++) { value1TypeEnumerators.Add(value1ByType[i].GetEnumerator()); value1TypeEnumerators[i].MoveNext(); } // create wanted dictionary var value2ToValue1 = new Dictionary<int, int>(); foreach (var item in Value2ToType) { int value1=value1TypeEnumerators[item.Value].Current; value2ToValue1.Add(item.Key, value1); value1TypeEnumerators[item.Value].MoveNext(); } Any Idea how to do this in LINQ?

    Read the article

  • How (and where) to get aligned tRNA sequences (and import it into R)

    - by Tal Galili
    (This is a database / R commands question) I wish (for my thesis work), to import tRNA data into R and have it aligned. My questions are: 1) What resources can I use for the data. 2) What commands might help me with the import/alignment. So far, I found two nice repositories that holds such data: http://trnadb.bioinf.uni-leipzig.de/Resulthttp://trnadb.bioinf.uni-leipzig.de/Result http://gtrnadb.ucsc.edu/download.htmlhttp://gtrnadb.ucsc.edu/download.html And also the readFASTA command from Biostrings, that does basic importing of the data into R. My problem still remains with how to handle the alignment of the tRNA. Since I am not from the field, I might be missing a very basic answer (like where I should download the data from, or what command to use). If you might be willing to advice me, that would be most helpful. Many thanks in advance, Tal

    Read the article

  • Algorithm for measuring distance between disordered sequences of strings

    - by Kinopiko
    The Levenshtein distance gives us a way to calculate the distance between two similar strings in terms of disordered individual characters: quick brown fox quikc brown fax The Levenshtein distance = 3. What is a similar algorithm for the distance between two strings with similar subsequences? For example, in quickbrownfox brownquickfox the Levenshtein distance is 10, but this takes no account of the fact that the strings have two similar subsequences, which makes them more "similar" than completely disordered words like quickbrownfox qburiocwknfox and yet this completely disordered version has a Levenshtein distance of eight. What distance measures exist which take the length of subsequences into account, without assuming that the subsequences can be easily broken into distinct words?

    Read the article

  • Generate number sequences with LINQ

    - by tanascius
    I try to write a LINQ statement which returns me all possible combinations of numbers (I need this for a test and I was inspired by this article of Eric Lippert). The method's prototype I call looks like: IEnumerable<Collection<int>> AllSequences( int start, int end, int size ); The rules are: all returned collections have a length of size number values within a collection have to increase every number between start and end should be used So calling the AllSequences( 1, 5, 3 ) should result in 10 collections, each of size 3: 1 2 3 1 2 4 1 2 5 1 3 4 1 3 5 1 4 5 2 3 4 2 3 5 2 4 5 3 4 5 Now, somehow I'd really like to see a pure LINQ solution. I am able to write a non LINQ solution on my own, so please put no effort into a solution without LINQ. My tries so far ended at a point where I have to join a number with the result of a recursive call of my method - something like: return from i in Enumerable.Range( start, end - size + 1 ) select BuildCollection(i, AllSequences( i, end, size -1)); But I can't manage it to implement BuildCollection() on a LINQ base - or even skip this method call. Can you help me here?

    Read the article

  • rake test not copying development postgres db with sequences

    - by Robert Crida
    I am trying to develop a rails application on postgresql using a sequence to increment a field instead of a default ruby approach based on validates_uniqueness_of. This has proved challenging for a number of reasons: 1. This is a migration of an existing table, not a new table or column 2. Using parameter :default = "nextval('seq')" didn't work because it tries to set it in parenthesis 3. Eventually got migration working in 2 steps: change_column :work_commencement_orders, :wco_number_suffix, :integer, :null => false#, :options => "set default nextval('wco_number_suffix_seq')" execute %{ ALTER TABLE work_commencement_orders ALTER COLUMN wco_number_suffix SET DEFAULT nextval('wco_number_suffix_seq'); } Now this would appear to have done the correct thing in the development database and the schema looks like: wco_number_suffix | integer | not null default nextval('wco_number_suffix_seq'::regclass) However, the tests are failing with PGError: ERROR: null value in column "wco_number_suffix" violates not-null constraint : INSERT INTO "work_commencement_orders" ("expense_account_id", "created_at", "process_id", "vo2_issued_on", "wco_template", "updated_at", "notes", "process_type", "vo_number", "vo_issued_on", "vo2_number", "wco_type_id", "created_by", "contractor_id", "old_wco_type", "master_wco_number", "deadline", "updated_by", "detail", "elective_id", "authorization_batch_id", "delivery_lat", "delivery_long", "operational", "state", "issued_on", "delivery_detail") VALUES(226, '2010-05-31 07:02:16.764215', 728, NULL, E'Default', '2010-05-31 07:02:16.764215', NULL, E'Procurement::Process', NULL, NULL, NULL, 226, NULL, 276, NULL, E'MWCO-213', '2010-06-14 07:02:16.756952', NULL, E'Name 4597', 220, NULL, NULL, NULL, 'f', E'pending', NULL, E'728 Test Road; Test Town; 1234; Test Land') RETURNING "id" The explanation can be found when you inspect the schema of the test database: wco_number_suffix | integer | not null So what happened to the default? I tried adding task: template: smmt_ops_development to the database.yml file which has the effect of issuing create database smmt_ops_test template = "smmt_ops_development" encoding = 'utf8' I have verified that if I issue this then it does in fact copy the default nextval. So clearly rails is doing something after that to suppress it again. Any suggestions as to how to fix this? Thanks Robert

    Read the article

  • db:migrate creates sequences but doesn't alter table?

    - by RewbieNewbie
    Hello, I have a migration that creates a postres sequence for auto incrementing a primary identifier, and then executes a statement for altering the column and specifying the default value: execute 'CREATE SEQUENCE "ServiceAvailability_ID_seq";' execute <<-SQL ALTER TABLE "ServiceAvailability" ALTER COLUMN "ID" set DEFAULT NEXTVAL('ServiceAvailability_ID_seq'); SQL If I run db:migrate everything seems to work, in that no errors are returned, however, if I run the rails application I get: Mnull value in column "ID" violates not-null constraint I have discovered by executing the sql statement in the migration manually, that this error is because the alter statement isn't working, or isn't being executed. If I manually execute the following statement: CREATE SEQUENCE "ServiceAvailability_ID_seq; I get: error : ERROR: relation "serviceavailability_id_seq" already exists Which means the migration successfully created the sequence! However, if I manually run: ALTER TABLE "ServiceProvider" ALTER COLUMN "ID" set DEFAULT NEXTVAL('ServiceProvider_ID_seq'); SQL It runs successfully and creates the default NEXTVAL. So the question is, why is the migration file creating the sequence with the first execute statement, but not altering the table in the second execute? (Remembering, no errors are output on running db:migrate) Thank you and apologies for tl:dr

    Read the article

  • Unescape _xHHHH_ XML escape sequences using Python

    - by John Machin
    I'm using Python 2.x [not negotiable] to read XML documents [created by others] that allow the content of many elements to contain characters that are not valid XML characters by escaping them using the _xHHHH_ convention e.g. ASCII BEL aka U+0007 is represented by the 7-character sequence u"_x0007_". Neither the functionality that allows representation of any old character in the document nor the manner of escaping is negotiable. I'm parsing the documents using cElementTree or lxml [semi-negotiable]. Here is my best attempt at unescapeing the parser output as efficiently as possible: import re def unescape(s, subber=re.compile(r'_x[0-9A-Fa-f]{4,4}_').sub, repl=lambda mobj: unichr(int(mobj.group(0)[2:6], 16)), ): if "_" in s: return subber(repl, s) return s The above is biassed by observing a very low frequency of "_" in typical text and a better-than-doubling of speed by avoiding the regex apparatus where possible. The question: Any better ideas out there?

    Read the article

  • need help transforming an XML file, whose part of it is with escape sequences, into html

    - by shlomi
    hello, i need help transforming the following XML <?xml-stylesheet type=text/xsl href=XSL_17.xsl?> <Root> <Book> <Author>John smith</Author> <Genre>Novel</Genre> <Details>&lt;?xml version="1.0" encoding="utf-16"?&gt;&lt;Dets&gt;&lt;Ds&gt;&lt;D DN="Pages" DV="381" /&gt;&lt;D DN="Binding" DV="Hardcover" /&gt;&lt;D DN="Rate" DV="7.8" /&gt;&lt;/Ds&gt;&lt;/Dets&gt;</Details> </Book> <Car> <Year>2010</Year> <Name>Charger</Name> <Manufacturer>Dodge</Manufacturer> </Car> </Root> to the following HTML <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title></title> </head> <body> <table> <tr> <td><strong>Book</strong></td> </tr> <tr> <td><strong>Name</strong></td> <td><strong>Value</strong></td> </tr> <tr> <td>Author</td> <td>John smith</td> </tr> <tr> <td>Genre</td> <td>Novel</td> </tr> <tr> <td>Details</td> <td> <table> <tr> <td><strong>Name</strong></td> <td><strong>Value</strong></td> </tr> <tr> <td>Pages</td> <td>381</td> </tr> <tr> <td>Binding</td> <td>Hardcover</td> </tr> <tr> <td>Rate</td> <td>7.8</td> </tr> </table> </td> </tr> </table> <table> <tr> <td><strong>Car</strong></td> </tr> <tr> <td><strong>Name</strong></td> <td><strong>Value</strong></td> </tr> <tr> <td>Year</td> <td>2010</td> </tr> <tr> <td>Name</td> <td>Charger</td> </tr> <tr> <td>Manufacturer</td> <td>Dodge</td> </tr> </table> </body> </html> i.e. i need to represent both normal XML and escaped XML in HTML tables.

    Read the article

  • Distinct rand() sequences yielding the same results in an expression

    - by suszterpatt
    Ok, this is a really weird one. I have an MPI program, where each process has to generate random numbers in a fixed range (the range is read from file). What happens is that even though I seed each process with a different value, and the numbers generated by rand() are different in each process, the expression to generate the random numbers still yields the same sequence between them. Here's all relevant code: // 'rank' will be unique for each process int rank; MPI_Comm_rank(MPI_COMM_WORLD, &rank); // seed the RNG with a different value for each process srand(time(NULL) + rank); // print some random numbers to see if we get a unique sequence in each process // 'log' is a uniquely named file, each process has its own log << rand() << " " << rand() << " " << rand() << std::endl; // do boring deterministic stuff while (true) { // waitTimeMin and waitTimeMax are integers, Max is always greater than Min waitSecs = waitTimeMin + rand() % (waitTimeMax - waitTimeMin); log << "waiting " << waitSecs << " seconds" << std::endl; sleep(waitSecs); // do more boring deterministic stuff } Here's the output of each process, with 3 processes generating numbers in the range [1,9]. process 1: 15190 28284 3149 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 2: 286 6264 3153 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 3: 18151 17013 3156 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds So while rand() clearly generates different numbers, the expression to calculate waitSecs still evaluates to the same sequence on all processes. What's even weirder: if I run the program with the same parameteres again, only the first 3 random numbers will change, the rest of the "random" sequence will be exactly the same in each run! Changing the range of numbers will obviously produce a different result from this one, but the same parameters always yield the same sequence, between processes and between executions: except for the first 3 numbers. Just what the hell is going on here?

    Read the article

  • Postgresql sequences

    - by Dylan
    When I delete all records from a Postgresql table and then try to reset the sequence to start a new record with number 1 when it is inserted, i get different results : SELECT setval('tblname_id_seq', (SELECT COALESCE(MAX(id),1) FROM tblname)); This sets the current value of the sequence to 1, but the NEXT record (actually the first because there are no records yet) gets number 2! And I can't set it to 0, because the minimum value in the sequence is 1! When I use : ALTER SEQUENCE tblname_id_seq RESTART WITH 1; the first record that is inserted actually gets number 1 ! But the above code doesn't accept a SELECT as a value instead of 1. I wish to reset the sequence to number 1 when there are no records, and the first record then should start with 1. But when there ARE already records in the table, I want to reset the sequence so that the next record that is inserted will get {highest}+1 Does anyone have a clear solution for this?

    Read the article

  • Regular Expression - Capture and Replace Select Sequences

    - by Chad
    Take the following file... ABCD,1234,http://example.com/mpe.exthttp://example/xyz.ext EFGH,5678,http://example.com/wer.exthttp://example/ljn.ext Note that "ext" is a constant file extension throughout the file. I am looking for an expression to turn that file into something like this... ABCD,1234,http://example.com/mpe.ext ABCD,1234,http://example/xyz.ext EFGH,5678,http://example.com/wer.ext EFGH,5678,http://example/ljn.ext In a nutshell I need to capture everything up to the urls. Then I need to capture each URL and put them on their own line with the leading capture. I am working with sed to do this and I cannot figure out how to make it work correctly. Any ideas?

    Read the article

  • packaging sequences of png files in iPhone APP for animations to reduce bundle size

    - by Brad Smith
    Basically, I have an application that uses a flip-book style animation technique. I am simply cycling through around 1000 320x480 pngs at 12fps, and everything works really well. Except for the fact that 1000 images takes up a ton of disk space. Ideally I'd like to be able to compress these images as a movie file and pull out each frame as I need them, or simply play back a movie with frame by frame precision. Ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Lazy loading is not working for one to many

    - by Shire
    Any 1-M that use the primary key of the parent table, but any 1-M that uses a different column does not work. It generates the SQL correctly, but put the value of the key into the SQL instead of the column value I want. Example mapping: public TemplateMap() { Table("IMPORT"); LazyLoad(); Id(x => x.ImportId).Column("IMPORT_ID").GeneratedBy.Assigned(); Map(x => x.ImportSetId).Column("IMPORTSET_ID"); HasMany(x => x.GoodChildren) .Access.CamelCaseField() .KeyColumns.Add("IMPORT_ID") .Cascade.Delete() .Inverse(); HasMany(x => x.BadChildren) .Access.CamelCaseField() .KeyColumns.Add("IMPORTSET_ID") .Cascade.Delete() .Inverse(); } Lazy loading works for GoodChildren, but not for BadChildren. The SQL statement is correct for both children. But the wrong values are use. If the value of IMPORT_ID is 10 and the value of IMPORTSET_ID is 12. The value 10 will be used for the IMPORTSET_ID in the SQL for BadChildren instead of 12. Anyone have any ideas what I need to change to get BadChildren to work correctly? Note: GoodChildren links to IMPORT_ID on Template BadChildren links to IMPORTSET_ID on Template

    Read the article

  • How to lazy process an xml documentwith hexpat?

    - by Florian
    In my search for a haskell library that can process large (300-1000mb) xml files i came across hexpat. There is an example in the Haskell Wiki that claims to -- Process document before handling error, so we get lazy processing. For testing purposes i have redirected the output to /dev/null and throw a 300mb file at it. Memory consumption kept rising until i had to kill the process. Now i removed the error handling from the process function: process :: String -> IO () process filename = do inputText <- L.readFile filename let (xml, mErr) = parse defaultParseOptions inputText :: (UNode String, Maybe XMLParseError) hFile <- openFile "/dev/null" WriteMode L.hPutStr hFile $ format xml hClose hFile return () As a result the function now uses constant memory. Why does the error handling result in massive memory consumption? As far as i understand xml and mErr are two seperate unevaluated thunks after the call to parse. Does format xml evaluate xml and build the evaluation tree of 'mErr'? If yes is there a way to handle the error while using constant memory? http://www.haskell.org/haskellwiki/Hexpat/

    Read the article

  • where is the best palce to count the lazy load property using JPA

    - by Ke
    Let's say we have a "Question" and "Answer" entity, @Entity public class Question extends IdEntity { @Lob private String content; @Transient private int answerTotal; @OneToMany(fetch = FetchType.LAZY) private List<Answer> answers = new ArrayList<Answer>(); ...... I need to tell how many answers for the question every time Question is queryed. So I need to do count: String count = "select count(o) from Answer o WHERE o.question=:q"; My question is, where is the best place to do the count? (Because I did a lot of query about Question entity, by date, by tag, by category, by asker, etc. It is obviously not a good solution to add count operation in each query. My first attempt is to implement a @PostLoad listener, so every time Question entity is loaded, I do count. However, EntityManager cannot be injected in listener. So this way does not work. Any hint?

    Read the article

  • Lazy load images in UITableViewCell

    - by lostInTransit
    Hi I have some 50 custom cells in my UITableView. I want to display an image and a label in the cells where I get the images from URLs. I want to do a lazy load of images so the UI does not freeze up while the images are being loaded. I tried getting the images in separate threads but I have to load each image every time a cell becomes visible again (Otherwise reuse of cells shows old images) Apps like Facebook load images only for cells currently visible and once the images are loaded, they are not loaded again. Can someone please tell me how to duplicate this behavior. Thanks. Edit Trying to cache images in an NSMutableDictionary object creates problems when the user scrolls fast. I am getting images only when scrolling completely stops and clearing out the cache on memory warning. But the app invariably gets a memory warning (due to size of images being cached) and clears the cache before reloading. If scrolling is very fast, it crashes. Any other suggestions are welcome

    Read the article

  • Lazy loading Javascript, object not created from IE8 cache

    - by doum-ti-di-li-doom
    Unfortunately the bug does not happen outside of my application! Scenario index.php <?php header('Expires: Mon, 26 Jul 1997 05:00:00 GMT'); header('Last-Modified: '.gmdate('D, d M Y H:i:s').'GMT'); header('Cache-Control: no-cache, must-revalidate'); header('Pragma: no-cache'); ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" lang="en"> <head> <meta http-equiv="content-type" content="text/html; charset=UTF-8" /> <title>Lazy loader</title> </head> <body> ... <script type="text/javascript" src="internal.js"></script> ... </body> </html> internal.js myApp = { timerHitIt: false, hitIt: function () { if (arguments.callee.done) { return; } arguments.callee.done = true; if (myApp.timerHitIt) { clearInterval(myApp.timerHitIt); } var elt = document.createElement("script"); elt.async = true; elt.type = "text/javascript"; elt.src = "external.js"; elt.onload = elt.onreadystatechange = function () { alert(typeof(something)); } document.body.appendChild(elt); } } if (document.addEventListener) { document.addEventListener("DOMContentLoaded", myApp.hitIt, false); } /*@cc_on @*/ /*@if (@_win32) document.write("<script id=__ie_onload defer src="+((location.protocol == "https:") ? "//:" : "javascript:void(0)")+"><\/script>"); document.getElementById("__ie_onload").onreadystatechange = function () { if (this.readyState == "complete") { myApp.hitIt(); } }; /*@end @*/ if (/WebKit/i.test(navigator.userAgent)) { timerHitIt = setInterval(function () { if (/loaded|complete/.test(document.readyState)) { myApp.hitIt(); } }, 10); } window.onload = myApp.hitIt; external.js something = {}; alert(true); Valid results are undefined - true - object (± new request) true - object (± cached javascript) But sometimes, when hitting F5, I get true - undefined Does anyone have a clue why alert(true) is executed but something is not set?

    Read the article

  • Is there a theory for "transactional" sequences of failing and no-fail actions?

    - by Ross Bencina
    My question is about writing transaction-like functions that execute sequences of actions, some of which may fail. It is related to the general C++ principle "destructors can't throw," no-fail property, and maybe also with multi-phase transactions or exception safety. However, I'm thinking about it in language-neutral terms. My concern is with correctly designing error handling in C++ functions that must be reliable. I would like to know what the concepts below are called so that I can learn more about them. I'm sorry that I can't ask the question more directly. Since I don't know this area I have provided an example to explain my question. The question is at the end. Here goes: Consider a sequence of steps or actions executed sequentially, where actions belong to one of two classes: those that always succeed, and those that may fail. In the examples below: S stands for an action that always succeeds (called "no-fail" in some settings). F stands for an action that may fail (for example, it might fail to allocate memory or do I/O that could fail). Consider a sequences of actions (executed sequentially from left to right): S->S->S->S Since each action in the sequence above succeeds, the whole sequence succeeds. On the other hand, the following sequence may fail because the last action may fail: S->S->S->F So, claim: a sequence has the no-fail (S) property if and only if all of its actions are no-fail. Now, I'm interested in action sequences that form "atomic transactions", with "failure atomicity," i.e. where either the whole sequence completes successfully, or there is no effect. I.e. if some action fails, the earlier ones must be rolled back. This requires that any successfully executed actions prior to a failing action must always be able to be rolled back. Consider the sequence: S->S->S->F S<-S<-S In the example above, the first row is the forward path of the transaction, and the second row are inverse actions (executed from right to left) that can be used to roll back if the final top row actions fails. It seems to me that for a transaction to support failure atomicity, the following invariant must hold: Claim: To support failure atomicity (either completion or complete roll-back on failure) all actions preceding the latest failable (F) action on the forward path (marked * in the example below) must have no-fail (S) inverses. The following is an example of a sequence that supports failure atomicity: * S->F->F->F S<-S<-S Further, if we want the transaction to be able to attempt cancellation mid-way through, but still guarantee either full completion or full rollback then we need the following property: Claim: To support failure atomicity and cancellation mid-way through execution, in the face of errors in the inverse (cancellation) path, all actions following the earliest failable (F) inverse on the reverse path (marked *) must be no-fail (S). F->F->F->S->S S<-S<-F<-F * I believe that these two conditions guarantee that an abortable/cancelable transaction will never get "stuck". My questions are: What is the study and theory of these properties called? are my claims correct? and what else is there to know? UPDATE 1: Updated terminology: what I previously called "robustness" is called atomicity in the database literature. UPDATE 2: Added explicit reference to failure atomicity, which seems to be a thing.

    Read the article

  • EF4 POCO WCF Serialization problems (no lazy loading, proxy/no proxy, circular references, etc)

    - by kdawg
    OK, I want to make sure I cover my situation and everything I've tried thoroughly. I'm pretty sure what I need/want can be done, but I haven't quite found the perfect combination for success. I'm utilizing Entity Framework 4 RTM and its POCO support. I'm looking to query for an entity (Config) that contains a many-to-many relationship with another entity (App). I turn off lazy loading and disable proxy creation for the context and explicitly load the navigation property (either through .Include() or .LoadProperty()). However, when the navigation property is loaded (that is, Apps is loaded for a given Config), the App objects that were loaded already contain references to the Configs that have been brought to memory. This creates a circular reference. Now I know the DataContractSerializer that WCF uses can handle circular references, by setting the preserveObjectReferences parameter to true. I've tried this with a couple of different attribute implementations I've found online. It is needed to prevent the "the object graph contains circular references and cannot be serialized" error. However, it doesn't prevent the serialization of the entire graph, back and forth between Config and App. If I invoke it via WcfTestClient.exe, I get a stackoverflow (ha!) exception from the client and I'm hosed. I get different results from different invocation environments (C# unit test with a local reference to the web service appears to work ok though I still can drill back and forth between Configs and Apps endlessly, but calling it from a coldfusion environment only returns the first Config in the list and errors out on the others.) My main goal is to have a serialized representation of the graph I explicitly load from EF (ie: list of Configs, each with their Apps, but no App back to Config navigation.) NOTE: I've also tried using the ProxyDataContractResolver technique and keeping the proxy creation enabled from my context. This blows up complaining about unknown types encountered. I read that the ProxyDataContractResolver didn't fully work in Beta2, but should work in RTM. For some reference, here is roughly how I'm querying the data in the service: var repo = BootStrapper.AppCtx["AppMeta.ConfigRepository"] as IRepository<Config>; repo.DisableLazyLoading(); repo.DisableProxyCreation(); //var temp2 = repo.Include(cfg => cfg.Apps).Where(cfg => cfg.Environment.Equals(environment)).ToArray(); var temp2 = repo.FindAll(cfg => cfg.Environment.Equals(environment)).ToArray(); foreach (var cfg in temp2) { repo.LoadProperty(cfg, c => c.Apps); } return temp2; I think the crux of my problem is when loading up navigation properties for POCO objects from Entity Framework 4, it prepopulates navigation properties for objects already in memory. This in turn hoses up the WCF serialization, despite every effort made to properly handle circular references. I know it's a lot of information, but it's really standing in my way of going forward with EF4/POCO in our system. I've found several articles and blogs touching upon these subjects, but for the life of me, I cannot resolve this issue. Feel free to simply ask questions and help me brainstorm this situation. PS: For the sake of being thorough, I am injecting the WCF services using the HEAD build of Spring.NET for the fix to Spring.ServiceModel.Activation.ServiceHostFactory. However I don't think this is the source of the problem.

    Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >