Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 908/1507 | < Previous Page | 904 905 906 907 908 909 910 911 912 913 914 915  | Next Page >

  • a href nested in DIV element in ASP.NET C#

    - by Gal V
    Hello all, My question is quite simple, I created a DIV, with a HyperLink control in it. As following: I created an 'onclick' event in jQuery for the DIV as well: $('#divOne').click(function() { alert('You clicked on the DIV element'); }); My goal is to trigger this event when the DIV area is clicked (working fine), BUT- When the HyperLink is clicked, I need the page to redirect WITHOUT triggering the DIV 'onclick' event (can use JavaScript or jQuery as needed). Thanks all!

    Read the article

  • How to encrypt/decrypt a long string in PHP?

    - by jodeci
    I doubt if this is encryption but I can't find a better phrase. I need to pass a long query string like this: http://test.com/test.php?key=[some_very_loooooooooooooooooooooooong_query_string] The query string contains NO sensitive information so I'm not really concerned about security in this case. It's just...well, too long and ugly. Is there a library function that can let me encode/encrypt/compress the query string into something similar to the result of a md5() (similar as in, always a 32 character string), but decode/decrypt/decompress-able?

    Read the article

  • jQuery Dynamic Button Click Handler

    - by Neb
    I have a code the change the html of a div to make a button. When I make a click handler for the dynamic button, nothing happens $('#signinup').html("<button id=\"login_submit\">Sign In</button>"); And the handler: $('#login_submit').click(function() { alert("Works!"); });

    Read the article

  • ckeditor using ajax

    - by sundowatch
    I am preparing a script. I am using AJAX(load()) with jQuery. I am getting a page which includes textarea with ckeditor by load() jQuery AJAX function. Although I include ckeditor's.js file, loaded page doesn't includes javascript file and shows a normal textarea without ckeditor. How can I load file which includes textarea with ckeditor?

    Read the article

  • jQuery oembed plugin z-index problem

    - by Ben
    I'm using the jQuery oembed plugin to display videos from a Vimeo feed. The only problem is they display over the top of my navigation menu. I have tried setting the z-index of the menu but this makes no difference. A common suggestion seems to be to set the wmode parameter to transparent or opaque. However, passing this as a parameter to the oembed function makes no difference. Thanks

    Read the article

  • PHP curly string syntax question

    - by zildjohn01
    I'm running PHP 5.3.0. I've found that the curly string syntax only works when the first character of the expression is $. Is there a way to include other types of expressions (function calls, etc)? Trivial example: <?php $x = '05'; echo "{$x}"; // works as expected echo "{intval($x)}"; // hoped for "5", got "{intval(05)}"

    Read the article

  • color objects in C or C ++ [closed]

    - by jazz
    Possible Duplicate: Colors in C language i copied a game from a book which name is paratrooper i ask this question again i also provide the code of the objects which i create there i want to change the color of these objects but i didn't understand how to do that so can any one plz help me how to do that.Listen guys they are not the standard functions but i use the graphics library for these functions and i can't find the function in the library file of graphics. i hope u understand know.this code will not run properly so plz tell me something about the function which color it i can't put the image other wize i show u the image it will make alot easieer #include "graphics.h" #include "stdio.h" #include "conio.h" #include "process.h" #include "alloc.h" #include "stdlib.h" #include "math.h" #include "dos.h" main() { int gm=CGAHI, gd=CGA, key=0, area; initgraph(&gd, &gm, "C:\\tc\\bgi"); helidraw(246,50,-1); getch(); return 0; } helidraw ( int x, int y, int d ) { int direction, i, j ; if ( d ) direction = -1 ; else direction = 1 ; i = 3 ; j = 8 ; line ( x - j - 8, y - i - 2, x + j + 8, y - i - 2 ) ; line ( x - j + 5, y - i - 1, x + j - 5, y - i - 1 ) ; line ( x - j, y - i, x + j, y - i ) ; for ( ; i > 0 ; i--, j += 2 ) { putpixel ( x - ( direction * j ), y - i, 1 ) ; line ( x + ( direction * j ), y - i, x + ( direction * ( j - 8 ) ), y - i ) ; } i = 0 ; j -= 2 ; line ( x - ( direction * j ), y - i, x - ( direction * ( j + 17 ) ), y - i ) ; line ( x - ( direction * j ), y - i + 1, x - ( direction * ( j + 7 ) ), y - i + 1 ) ; putpixel ( x - ( direction * ( j + 19 ) ), y - i - 1, 1 ) ; for ( ; i < 3 ; i++, j -= 2 ) { putpixel ( x - j, y + i, 1 ) ; putpixel ( x + j, y + i, 1 ) ; } line ( x - j, y + i, x + j, y + i ) ; putpixel ( x - j + 3, y + i + 1, 1 ) ; putpixel ( x + j - 3, y + i + 1, 1 ) ; line ( x - j - 10, y + i + 2, x + j + 10, y + i + 2 ) ; putpixel ( x + ( direction * ( j + 12 ) ), y + i + 1, 1 ) ; }

    Read the article

  • How can I cast authoritatively in asp classic?

    - by Tchalvak
    In asp classic, the cint() function or procedure or whatever it is won't allow me to cast arbitrary strings, like "bob" or "null" or anything like that. Is there anything that will allow me to simply cast integers, numeric strings, and arbitrary strings to actual integers, with some sane default like 0 for strings?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Template render callback

    - by Zsolt Németh
    I'm using Handlebar's {{#each}} to render out my collection to the DOM. After each item is rendered, I want to run a script on these elements. I'm trying to find a callabck function wich fires only once, when the whole render is completed. Meteor's Template.rendered() run's each time a new item is inserted, so it runs as many times as much item I have in my collection. Is there any solution for this? Thanks a lot!

    Read the article

  • Is there any way to achieve multiple inheritance in php?

    - by Starx
    Lets say I have a parent class class parent { } ..... This parent has three sub class class child1 { } class child2 { } class child3 { } and these child classes have further smaller parts like class child1subpar1 { } class child1subpar2 { public function foo() { echo "hi"; } } class child2subpar1 { } class child2subpar2 { } Now, how to sum this whole up like class child1 extends child1subpar1, child1subpar2 { } class child2 extends child2subpar1, childsubpar1 { } class parent extends child1,child2,child3 { } I need to execute the methods in its inherited classes and do something like this $objparent = new parent; $objparent - foo();

    Read the article

  • log4bash: Cannot find a way to add MaxBackupIndex to this logger implementation

    - by Syffys
    I have been trying to modify this log4bash implementation but I cannot manage to make it work. Here's a sample: #!/bin/bash TRUE=1 FALSE=0 ############### Added for testing log4bash_LOG_ENABLED=$TRUE log4bash_rootLogger=$TRACE,f,s log4bash_appender_f=file log4bash_appender_f_dir=$(pwd) log4bash_appender_f_file=test.log log4bash_appender_f_roll_format=%Y%m log4bash_appender_f_roll=$TRUE log4bash_appender_f_maxBackupIndex=10 #################################### log4bash_abs(){ if [ "${1:0:1}" == "." ]; then builtin echo ${rootDir}/${1} else builtin echo ${1} fi } log4bash_check_app_dir(){ if [ "$log4bash_LOG_ENABLED" -eq $TRUE ]; then dir=$(log4bash_abs $1) if [ ! -d ${dir} ]; then #log a seperation line mkdir $dir fi fi } # Delete old log files # $1 Log directory # $2 Log filename # $3 Log filename suffix # $4 Max backup index log4bash_delete_old_files(){ ##### Added for testing builtin echo "Running log4bash_delete_old_files $@" &2 ##### if [ "$log4bash_LOG_ENABLED" -eq $TRUE ] && [ -n "$3" ] && [ "$4" -gt 0 ]; then local directory=$(log4bash_abs $1) local filename=$2 local maxBackupIndex=$4 local suffix=$(echo "${3}" | sed -re 's/[^.]/?/g') local logFileList=$(find "${directory}" -mindepth 1 -maxdepth 1 -name "${filename}${suffix}" -type f | xargs ls -1rt) local fileCnt=$(builtin echo -e "${logFileList}" | wc -l) local fileToDeleteCnt=$(($fileCnt-$maxBackupIndex)) local fileToDelete=($(builtin echo -e "${logFileList}" | head -n "${fileToDeleteCnt}" | sed ':a;N;$!ba;s/\n/ /g')) ##### Added for testing builtin echo "log4bash_delete_old_files About to start deletion ${fileToDelete[@]}" &2 ##### if [ ${fileToDeleteCnt} -gt 0 ]; then for f in "${fileToDelete[@]}"; do #### Added for testing builtin echo "Removing file ${f}" &2 #### builtin eval rm -f ${f} done fi fi } #Appender # $1 Log directory # $2 Log file # $3 Log file roll ? # $4 Appender Name log4bash_filename(){ builtin echo "Running log4bash_filename $@" &2 local format local filename log4bash_check_app_dir "${1}" if [ ${3} -eq 1 ];then local formatProp=${4}_roll_format format=${!formatProp} if [ -z ${format} ]; then format=$log4bash_appender_file_format fi local suffix=.`date "+${format}"` filename=${1}/${2}${suffix} # Old log files deletion local previousFilenameVar=int_${4}_file_previous local maxBackupIndexVar=${4}_maxBackupIndex if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then builtin eval export $previousFilenameVar=$filename log4bash_delete_old_files "${1}" "${2}" "${suffix}" "${!maxBackupIndexVar}" else builtin echo "log4bash_filename $previousFilenameVar = ${!previousFilenameVar}" fi else filename=${1}/${2} fi builtin echo $filename } ######################## Added for testing filename_caller(){ builtin echo "filename_caller Call $1" output=$(log4bash_abs $(log4bash_filename "${log4bash_appender_f_dir}" "${log4bash_appender_f_file}" "1" "log4bash_appender_f" )) builtin echo ${output} } #### Previous logs generation for i in {1101..1120}; do file="${log4bash_appender_f_file}.2012${i:2:3}" builtin echo "${file} $i" touch -m -t "2012${i}0000" ${log4bash_appender_f_dir}/$file done for i in {1..4}; do filename_caller $i done I expect log4bash_filename function to step into the following if only when the calculated log filename is different from the previous one: if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then For this scenario to apply, I'd need ${!previousFilenameVar} to be correctly set, but it's not the case, so log4bash_filename steps into this if all the time which is really not necessary... It looks like the issue is due to the following line not working properly: builtin eval export $previousFilenameVar=$filename I have a some theories to explain why: in the original code, functions are declared and exported as readonly which makes them unable to modify global variable. I removed readonly declarations in the above sample, but probleme persists. Function calls are performed in $() which should make them run into seperated shell instances so variable modified are not exported to the main shell But I cannot manage to find a workaround to this issue... Any help is appreciated, thanks in advance!

    Read the article

  • jquery fade element does not show elements styled 'visibility: hidden'

    - by kalpaitch
    I have a bunch of thumbnails which I am loading with a style of visibility: hidden; so that they all maintain their correct layouts. Once the page is fully loaded I have a jquery function that fades them in. This worked when their style was set to display: none; but obviously the layout screwed up then. Any suggestions? Heres the fade line: $('.littleme').fadeIn('slow');

    Read the article

  • PHP XML encoding

    - by Jeremey
    I need a function that will convert € or chr(0x20AC) or chr(8364) to € without having a static map. I tried using htmlentities(), but it only seems to work for the symbol itself and it converts to €

    Read the article

  • How do I force jquery to center an element when it snaps to another container using the draggable method?

    - by David
    Here's my script. I want some square-shaped draggable objects (in this case just td boxes with numbers in them) to be able to snap to some empty table cells and snap to the center of those cells (empty td boxes), not the top or bottom of those cells, which is what is seems to do by default. <script type="text/javascript"> $(document).ready(function () { $(".inputs div").draggable( { snap: ".spaces" } ); }); </script>

    Read the article

  • PHP Force Apache error

    - by Rolf
    Hi dear stackers :P Thanks to this forum, I learnt PHP header function does not actually send header to Apache server but only to the client. What I wanna do is to generate an error 500, and let Apache displays its corresponding page. Is there a way to force it ? Thanks in advance ! (and allez les bleus !)

    Read the article

  • can i get the font information from Graphics System.Drawing.Graphics in c#

    - by Bahgat Mashaly
    Hello i get the Graphics from Graphics g= System.Drawing.Graphics.FromHwnd(button1.Handle); can i get the font information from this Graphics i was try to get a font by using GetTextFace api function but it return "system" it mean default font in OS and i was try to use SendMessage(button1.Handle, WM_GETFONT, 0, 0); bu it return me 0 also it is mean default font in OS I have known the cause of the problem, it due to FlatStyle property See this link http://blogs.msdn.com/b/michkap/archive/2008/09/26/8965526.aspx thanks

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

< Previous Page | 904 905 906 907 908 909 910 911 912 913 914 915  | Next Page >