Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 909/1507 | < Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • how to hide the div which is inside an iframe?

    - by user2092317
    I want to hide a div which is inside a iframe , is there any way to hide a div by its attributes example: i have a iframe i need to hide the div id="content" content in php.net <iframe src="http://php.net/" id = 'iframe'> <div id="content">...</div> </iframe> Dont know where i am doing mistake, please help me to resolve this issue function hideIt(){ document.getElementById('iframe').contentWindow.document.getElementById('content').style.display = 'none'; }

    Read the article

  • PHP curly string syntax question

    - by zildjohn01
    I'm running PHP 5.3.0. I've found that the curly string syntax only works when the first character of the expression is $. Is there a way to include other types of expressions (function calls, etc)? Trivial example: <?php $x = '05'; echo "{$x}"; // works as expected echo "{intval($x)}"; // hoped for "5", got "{intval(05)}"

    Read the article

  • Howto suppress one command's output in R?

    - by Tor
    In R I'm looking to suppress the output of one command (in this case, the apply function). Is it possible to do this without using sink()? I've found the described solution below, but would like to do this inline if possible. Danke. http://stackoverflow.com/questions/2501895/how-to-suppress-output-in-r

    Read the article

  • PHP XML encoding

    - by Jeremey
    I need a function that will convert € or chr(0x20AC) or chr(8364) to € without having a static map. I tried using htmlentities(), but it only seems to work for the symbol itself and it converts to €

    Read the article

  • Why does Javascript's OR return a value other than true/false?

    - by Fletcher Moore
    I saw this construction in order to get the browser viewport width: function () { return window.innerWidth || document.documentElement.clientWidth || document.body.clientWidth; } I understand the browser quirks involved. What I don't understand is why || returns the value. So I tried this alert(undefined || 0 || 3); and sure enough, it alerts 3. I find this bizarre, because I expect true or false. Could anyone explain what's going on?

    Read the article

  • C compiler for iPhone?

    - by thyrgle
    If you want to see why I am asking this look at my other question: http://stackoverflow.com/questions/2894615/how-to-display-console-text-in-uitextview So basically, I need to know if there is an iPhone C compiler that can be installed on the iPhone... Then I need to know what parameter I would put in the system("compile Foo") function. Thanks for the help in advanced.

    Read the article

  • color objects in C or C ++ [closed]

    - by jazz
    Possible Duplicate: Colors in C language i copied a game from a book which name is paratrooper i ask this question again i also provide the code of the objects which i create there i want to change the color of these objects but i didn't understand how to do that so can any one plz help me how to do that.Listen guys they are not the standard functions but i use the graphics library for these functions and i can't find the function in the library file of graphics. i hope u understand know.this code will not run properly so plz tell me something about the function which color it i can't put the image other wize i show u the image it will make alot easieer #include "graphics.h" #include "stdio.h" #include "conio.h" #include "process.h" #include "alloc.h" #include "stdlib.h" #include "math.h" #include "dos.h" main() { int gm=CGAHI, gd=CGA, key=0, area; initgraph(&gd, &gm, "C:\\tc\\bgi"); helidraw(246,50,-1); getch(); return 0; } helidraw ( int x, int y, int d ) { int direction, i, j ; if ( d ) direction = -1 ; else direction = 1 ; i = 3 ; j = 8 ; line ( x - j - 8, y - i - 2, x + j + 8, y - i - 2 ) ; line ( x - j + 5, y - i - 1, x + j - 5, y - i - 1 ) ; line ( x - j, y - i, x + j, y - i ) ; for ( ; i > 0 ; i--, j += 2 ) { putpixel ( x - ( direction * j ), y - i, 1 ) ; line ( x + ( direction * j ), y - i, x + ( direction * ( j - 8 ) ), y - i ) ; } i = 0 ; j -= 2 ; line ( x - ( direction * j ), y - i, x - ( direction * ( j + 17 ) ), y - i ) ; line ( x - ( direction * j ), y - i + 1, x - ( direction * ( j + 7 ) ), y - i + 1 ) ; putpixel ( x - ( direction * ( j + 19 ) ), y - i - 1, 1 ) ; for ( ; i < 3 ; i++, j -= 2 ) { putpixel ( x - j, y + i, 1 ) ; putpixel ( x + j, y + i, 1 ) ; } line ( x - j, y + i, x + j, y + i ) ; putpixel ( x - j + 3, y + i + 1, 1 ) ; putpixel ( x + j - 3, y + i + 1, 1 ) ; line ( x - j - 10, y + i + 2, x + j + 10, y + i + 2 ) ; putpixel ( x + ( direction * ( j + 12 ) ), y + i + 1, 1 ) ; }

    Read the article

  • passing an array structure as an array

    - by Matias
    I'm having trouble passing a structure array as a parameter of a function struct Estructure{ int a; int b; }; and a funtion Begining(Estructure &s1[]) { //modifi the estructure s1 }; and the main would be something like this int main() { Estructure m[200]; Begining(m); }; is this valid?

    Read the article

  • MVC + Extjs + IIS6 + Wildcard Mapping = Post Form resulting in 302 object moved

    - by Orkun Balkanci
    Everything seems to work fine until i want to submit the form and update the database. Wildcard mapping works on requests like "/navigation/edit/1", but when i submit the form as: var ajaxPost = function(Url, Params) { Ext.Ajax.request({ url: Url, params: Params, method: 'POST', async: false, scope: this }); }; it says "200 bad response: syntax error" and in firebug there is "Failed to load source for: http://.../Navigation/edit/1". Any help?

    Read the article

  • SqlBulkCopy with SqlHelper class

    - by Pandiya Chendur
    I've installed DataAccessApplicationBlock.msi and I got the Microsoft.ApplicationBlocks.Data.dll file into my bin folder. I found every other sqlhelper methods except ExecuteBulkCopy. How do I add ExecuteBulkCopy function to the SqlHelper class?

    Read the article

  • Should a g_object_new have a matching g_object_unref?

    - by legends2k
    I'm using libnotify to show desktop notifications in my application; notify_notification_new() returns a NotifyNotification*, which should be passed as the first param to further function calls of the notification library. There is no notify_notification_free() which frees the pointer it returns. I looked up the source of notify_notification_new() and internally it does a g_object_new(), gets a GObject* and returns it as a NotfiyNotification*, so when my application does the clean up, should I call a g_object_unref() on the pointer returned by notify_notification_new()?

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Overloading new, delete in C++

    - by user265260
    i came across this line is stroustrup An operator function must either be a member or take at least one argument of a user-defined type (functions redefining the new and delete operators need not). Dont operator new and operator delete take an user defined type as one of their arguments? what does it mean, am i missing something here

    Read the article

  • Why is my PowerShell multi dimensional array being interpreted as a 1 dimensional array?

    - by Jim
    I have the following code: function HideTemplates($File, $Templates) { foreach ($Template in $Templates) { Write-Host $Template[0] $Template[1] $Template[2] } } HideTemplates "test.xml" @(("one", "two", "three")) HideTemplates "test.xml" @(("four", "five", "six"), ("seven", "eight", "nine")) It prints: o n e t w o t h r four five six seven eight nine I want it to print: one two three four five six seven eight nine Am I doing something wrong in my code? Is there a way to force PowerShell to tread a multi-dimensional array with a single item differently?

    Read the article

  • WPF RichTextBox support for document links?

    - by Rox Wen
    I'm attempting to render RTF documents using the WPF RichTextBox control. So far, the appearance of the rendered RTF documents is quite true to the originals which were authored using MS Word. The one issue I've found is that the "document anchors" which are hyperlinks to different locations within the document, do not function as hoped. While they look like links, clicking on them does nothing. Can the WPF RichTextBox support this type of link?

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Problem with PHP/Java bridge.

    - by Jack
    I am using Tomcat 6. I am running a php script using the JavaBridge. I get the following error when I run my code. Fatal error: Call to undefined function mysqli_connect() in C:\Program Files\apache-tomcat-6.0.26\webapps\JavaBridge\xxxx\xxxxx.php on line 534 Please help.

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How a database is loaded into an application?

    - by Audel
    Hi All i need is a simple explanation on how does this function work I also attached a piece of php which I think is the one that retrieves the data from the database. Please correct me if I'm wrong Cheers. function loadDatabaseRecords () { // Mozilla/Safari if (window.XMLHttpRequest) { xmlHttpReq = new XMLHttpRequest(); } // IE else if (window.ActiveXObject) { xmlHttpReq = new ActiveXObject("Microsoft.XMLHTTP"); } alert ("To Server (Load Records):\n\najax-open-DB.php"); xmlHttpReq.open('GET', "ajax-open-DB.php", true); xmlHttpReq.onreadystatechange = loadDatabaseRecordsCallback; xmlHttpReq.send(null); } <?php $link = mysql_connect ("ipaddress", "localhost", "password"); mysql_select_db ("database1"); $query = "SELECT * from addressbook"; $result = mysql_query ($query); print "<table>"; print "<tr>"; print "<th>Firstname</th><th>Lastname</th><th>Address</th><th>Telephone</th>"; print "</tr>"; for ($i = 0; $i < mysql_num_rows ($result); $i ++) { $row = mysql_fetch_object ($result); print "<tr>"; print "<td>$row->firstname</td>"; print "<td>$row->lastname</td>"; print "<td>$row->address</td>"; print "<td>$row->telephone</td>"; print "</tr>"; } print "</table>"; mysql_close ($link); ?>

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

< Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >