Search Results

Search found 41095 results on 1644 pages for 'empty string'.

Page 366/1644 | < Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >

  • Print XML file and download it

    - by Pankaj
    I am create xml using serialization and trying to print them using this code string xmlDate = xml.GetXML(); string name = string.Format("{0}_HighEST", ProjectName); Response.AddHeader("Content-disposition", "attachment; filename=\"" + name + "_HighEST.xml\""); Response.ContentType = string.Format("application/.xml", name); how can assign my xmldata to Response so that data will write on downloaded xml?

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • asp.net mvc HttpPostedFileBase getting file extension

    - by mazhar kaunain baig
    public string ContructOrganizationNameLogo(HttpPostedFileBase upload, string OrganizationName, int OrganizationID,string LangName) { var UploadedfileName = Path.GetFileName(upload.FileName); string type = upload.ContentType; } I want to get the extension of the file to dynamically generate the name of the file.One way i will use to split the type. but can i use HttpPostedFileBase object to get the extension in the clean way?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to use LINQ to query list of strings that do not contain substring entries from another list

    - by p.campbell
    string candidates = new string[] { "Luke_jedi", "Force_unknown", "Vader_jedi" , "Emperor_human", "r2d2_robot" }; string[] disregard = new string[] {"_robot", "_jedi"}; //find those that aren't jedi or robots. var nonJedi = candidates.Where(c=> c.??? //likely using EndsWith() and Any() ); How would you implement this solution using LINQ to find all those that do not end with any of the disregards items?

    Read the article

  • How does Java pick which method to call?

    - by Gaurav
    Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

    Read the article

  • Type problem with Observable.Create from Boo

    - by Tristan
    I'm trying to use Reactive Extensions from Boo and am running into type problems. Here's the basic example: def OnSubscribe(observer as IObservable[of string]) as callable: print "subscribing" def Dispose(): print "disposing" return Dispose observable = System.Linq.Observable.Create[of string](OnSubscribe) observer = System.Linq.Observer.Create[of string]({x as string | print x}) observable.Subscribe(observer) The Subscribe here gives a System.InvalidCastException: Cannot cast from source type to destination type. The issue appears to be with how I'm creating the observable, but I've struggled to see where the type problem arises from. Ideas?

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • Is Abstract Factory Pattern implemented correctly for given scenario.... ???

    - by Amit
    First thing... I am novice to pattern world, so correct me if wrong anywhere Scenario: There are multiple companies providing multiple products of diff size so there are 3 entities i.e. Companies, Their Product and size of product I have implement Abstract Pattern on this i.e. so that I will create instance of IProductFactory interface to get desired product... Is below implementation of Abstract Factory Pattern correct ??? If not then please correct the approach + Also tell me if any other pattern can be used for such scenario Thanks in advance... public enum Companies { Samsung = 0, LG = 1, Philips = 2, Sony = 3 } public enum Product { PlasmaTv = 0, DVD = 1 } public enum ProductSize { FortyTwoInch, FiftyFiveInch } interface IProductFactory { IPhilips GetPhilipsProduct(); ISony GetSonyProduct(); } interface ISony { string CreateProducts(Product product, ProductSize size); } interface IPhilips { string CreateProducts(Product product, ProductSize size); } class ProductFactory : IProductFactory { public IPhilips GetPhilipsProduct() { return new Philips(); } public ISony GetSonyProduct() { return new Sony(); } } class Philips : IPhilips { #region IPhilips Members public string CreateProducts(Product product, ProductSize size) {// I have ingnore size for now.... string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } class Sony : ISony {// I have ingnore size for now.... #region ISony Members public string CreateProducts(Product product, ProductSize size) { string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } IProductFactory prodFactory = new ProductFactory(); IPhilips philipsObj = prodFactory.GetPhilipsProduct(); MessageBox.Show(philipsObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch)); or //ISony sonyObj = prodFactory.GetSonyProduct(); //MessageBox.Show(sonyObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch));

    Read the article

  • Can one create Sized Types in Scala?

    - by Jens Schauder
    Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

    Read the article

  • How to access a field's value in an object using reflection

    - by kentcdodds
    My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • How to bind a ComboBox to generic dictionary with xaml code

    - by MMD MNC
    I'm using the following code : private Dictionary<string, string> GetNumber { get; set; } public ReportsLetterTra() { GetMonth = new Dictionary<string, string> { {"1", "First"}, {"2", "Second"} }; InitializeComponent(); } xaml code : <ComboBox DisplayMemberPath="value" SelectedValuePath="key" ItemsSource="{Binding ElementName=reportslettra,Path=GetNumber}" SelectedIndex="0" Name="cmbFromNumber" /> Why is not bind GetNumber to cmbFromNumber?!

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • Mac Safari randomly recreating cookie when I refresh my login screen. Very bizarre

    - by mcintyre321
    We have found an issue in our app where Safari on the Mac randomly recreates a login cookie from a logged off session. I have a fiddler archive with this behaviour here. Note that some stuff has been removed from this to make it easier to get, but nothing which sets a cookie or anything has been taken out - only repetitions of requests 3-8. I'll talk you through the running order Request 1: user logs out via call to /logout.aspx - Set-Cookie returned setting cookie expiry date to 1999 Requests 2-8: user refreshes login page sending calls to root or /res/en-US/s.js - no cookie is sent to server or received back, and access is denied. I have cut out a lot of requests of this nature from the log as they are boring Request 9: request for /res/en-US/s.js - Hv3 authentication cookie has mysteriously reappeared! Wat. There was NO set-cookie! WTFF! Request 10+ : now the cookie has reappeared, the site logs the user in AGAIN The cookie, when examined in Safari looks like <dict> <key>Created</key> <real>259603523.26834899</real> <key>Domain</key> <string>.mysite.dev</string> <key>Expires</key> <date>2010-03-24T16:05:22Z</date> <key>HttpOnly</key> <string>TRUE</string> <key>Name</key> <string>.Hv3</string> <key>Path</key> <string>/</string> </dict> One thing to note is that in Safari, the cookie domain is .mysite.dev not mysite.dev (which is the cookie domain specified in web.config) - however, given that access is denied in requests 2-8, it looks like the cookie has expired OK. If you look in the list of cookies in the browser during 2-8, the .Hv3 cookie is not there. Is this our bug or Safari's? What can I do to stop it happening?

    Read the article

  • C#: why have all static methods/variables in a non-static class?

    - by Craig Johnston
    I have come across a class which is non-static, but all the methods and variables are static. Eg: public class Class1 { private static string String1 = "one"; private static string String2 = "two"; public static void PrintStrings(string str1, string str2) { ... All the variables are static across all instances, so there is no point having separate instances of the class. Is there any reason to create a class such as this?

    Read the article

  • convert 0.5 to 0.50 in C#

    - by Rohit
    I have a string which holds 0.5. I have to convert in to 0.50. I have tried following ways but nothing works.Please help hdnSliderValue.Value is 0.5,I want workFlow.QualityThresholdScore to be 0.50 workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:d}",hdnSliderValue.Value)); workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:0.00}",hdnSliderValue.Value)); IS there any built in function or will i have to do string handling to accomplish this.

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Can't figure out where race condition is occuring

    - by Nik
    I'm using Valgrind --tool=drd to check my application that uses Boost::thread. Basically, the application populates a set of "Book" values with "Kehai" values based on inputs through a socket connection. On a seperate thread, a user can connect and get the books send to them. Its fairly simple, so i figured using a boost::mutex::scoped_lock on the location that serializes the book and the location that clears out the book data should be suffice to prevent any race conditions. Here is the code: void Book::clear() { boost::mutex::scoped_lock lock(dataMutex); for(int i =NUM_KEHAI-1; i >= 0; --i) { bid[i].clear(); ask[i].clear(); } } int Book::copyChangedKehaiToString(char* dst) const { boost::mutex::scoped_lock lock(dataMutex); sprintf(dst, "%-4s%-13s",market.c_str(),meigara.c_str()); int loc = 17; for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(ask[i].changed > 0) { sprintf(dst+loc,"A%i%-21s%-21s%-21s%-8s%-4s",i,ask[i].price.c_str(),ask[i].volume.c_str(),ask[i].number.c_str(),ask[i].postTime.c_str(),ask[i].status.c_str()); loc += 77; } } for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(bid[i].changed > 0) { sprintf(dst+loc,"B%i%-21s%-21s%-21s%-8s%-4s",i,bid[i].price.c_str(),bid[i].volume.c_str(),bid[i].number.c_str(),bid[i].postTime.c_str(),bid[i].status.c_str()); loc += 77; } } return loc; } The clear() function and the copyChangedKehaiToString() function are called in the datagetting thread and data sending thread,respectively. Also, as a note, the class Book: struct Book { private: Book(const Book&); Book& operator=(const Book&); public: static const int NUM_KEHAI=10; struct Kehai; friend struct Book::Kehai; struct Kehai { private: Kehai& operator=(const Kehai&); public: std::string price; std::string volume; std::string number; std::string postTime; std::string status; int changed; Kehai(); void copyFrom(const Kehai& other); Kehai(const Kehai& other); inline void clear() { price.assign(""); volume.assign(""); number.assign(""); postTime.assign(""); status.assign(""); changed = -1; } }; std::vector<Kehai> bid; std::vector<Kehai> ask; tm recTime; mutable boost::mutex dataMutex; Book(); void clear(); int copyChangedKehaiToString(char * dst) const; }; When using valgrind --tool=drd, i get race condition errors such as the one below: ==26330== Conflicting store by thread 1 at 0x0658fbb0 size 4 ==26330== at 0x653AE68: std::string::_M_mutate(unsigned int, unsigned int, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653AFC9: std::string::_M_replace_safe(unsigned int, unsigned int, char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B064: std::string::assign(char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B134: std::string::assign(char const*) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x8055D64: Book::Kehai::clear() (Book.h:50) ==26330== by 0x8094A29: Book::clear() (Book.cpp:78) ==26330== by 0x808537E: RealKernel::start() (RealKernel.cpp:86) ==26330== by 0x804D15A: main (main.cpp:164) ==26330== Allocation context: BSS section of /usr/lib/libstdc++.so.6.0.8 ==26330== Other segment start (thread 2) ==26330== at 0x400BB59: pthread_mutex_unlock (drd_pthread_intercepts.c:633) ==26330== by 0xC59565: pthread_mutex_unlock (in /lib/libc-2.5.so) ==26330== by 0x805477C: boost::mutex::unlock() (mutex.hpp:56) ==26330== by 0x80547C9: boost::unique_lock<boost::mutex>::~unique_lock() (locks.hpp:340) ==26330== by 0x80949BA: Book::copyChangedKehaiToString(char*) const (Book.cpp:134) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x8092D05: BookSnapshotManager::getSnaphotDataList() (BookSnapshotManager.cpp:72) ==26330== by 0x8088179: SnapshotServer::getDataList() (SnapshotServer.cpp:246) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) ==26330== by 0x808BB90: boost::_bi::bind_t<void, boost::_mfi::mf0<void, RealThread>, boost::_bi::list1<boost::_bi::value<RealThread*> > >::operator()() (bind_template.hpp:20) ==26330== Other segment end (thread 2) ==26330== at 0x400B62A: pthread_mutex_lock (drd_pthread_intercepts.c:580) ==26330== by 0xC59535: pthread_mutex_lock (in /lib/libc-2.5.so) ==26330== by 0x80546B8: boost::mutex::lock() (mutex.hpp:51) ==26330== by 0x805473B: boost::unique_lock<boost::mutex>::lock() (locks.hpp:349) ==26330== by 0x8054769: boost::unique_lock<boost::mutex>::unique_lock(boost::mutex&) (locks.hpp:227) ==26330== by 0x8094711: Book::copyChangedKehaiToString(char*) const (Book.cpp:113) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) For the life of me, i can't figure out where the race condition is. As far as I can tell, clearing the kehai is done only after having taken the mutex, and the same holds true with copying it to a string. Does anyone have any ideas what could be causing this, or where I should look? Thank you kindly.

    Read the article

  • Problem with copying arrays.

    - by Machta
    I have the following code: string[] firstarray = { "bla bla", "bla bla", "bla bla"}; string[] secondArray = {"aaaaaaaaaaaa", "aaaaaaaaaaa", "aaaaaaaaa"}; string[] newArray = array; array = secondArray; foreach (string item in newArray) { Console.WriteLine(item); } This code gives the following results: bla bla bla bla bla bla I can't understand why the newArray has the same conntent after I assign a different instance to the array. Please help me.

    Read the article

  • Scala Map conversion

    - by Benjamin Metz
    I'm a Scala newbie I'm afraid: I'm trying to convert a Map to a new Map based on some simple logic: val postVals = Map("test" - "testing1", "test2" - "testing2", "test3" - "testing3") I want to test for value "testing1" and change the value (while creating a new Map) def modMap(postVals: Map[String, String]): Map[String, String] = { postVals foreach {case(k, v) => if(v=="testing1") postVals.update(k, "new value")} }

    Read the article

  • Get individual query parameters from Uri

    - by Ghostrider
    I have a uri string like: http://example.com/file?a=1&b=2&c=string%20param Is there an existing function that would convert query parameter string into a dictionary same way as ASP.NET Context.Request does it. I'm writing a console app and not a web-service so there is no Context.Request to parse the URL for me. I know that it's pretty easy to crack the query string myself but I'd rather use a FCL function is if exists.

    Read the article

  • JSP functions - How to declare long as parameter in TLD

    - by Spines
    I'm getting an error WARNING: Method "pl" for function "pl" not found, I think its because I'm not declaring the parameters right. <function-signature>java.lang.String pl(java.lang.Long, java.lang.String)</function-signature> is what I have in the TLD. and public static String pl(long num, String str) is what I have in the .java file.

    Read the article

  • xstream handles non-english character

    - by Yan Cheng CHEOK
    I have the following code : /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package helloworld; import com.thoughtworks.xstream.XStream; import java.io.File; import java.io.FileOutputStream; import java.io.InputStream; import java.io.OutputStream; import javax.swing.JOptionPane; /** * * @author yccheok */ public class Test { @SuppressWarnings("unchecked") public static <A> A fromXML(Class c, File file) { XStream xStream = new XStream(); InputStream inputStream = null; try { inputStream = new java.io.FileInputStream(file); Object object = xStream.fromXML(inputStream); if (c.isInstance(object)) { return (A)object; } } catch (Exception exp) { exp.printStackTrace(); } finally { if (inputStream != null) { try { inputStream.close(); inputStream = null; } catch (java.io.IOException exp) { exp.printStackTrace(); return null; } } } return null; } @SuppressWarnings("unchecked") public static <A> A fromXML(Class c, String filePath) { return (A)fromXML(c, new File(filePath)); } public static boolean toXML(Object object, File file) { XStream xStream = new XStream(); OutputStream outputStream = null; try { outputStream = new FileOutputStream(file); xStream.toXML(object, outputStream); } catch (Exception exp) { exp.printStackTrace(); return false; } finally { if (outputStream != null) { try { outputStream.close(); outputStream = null; } catch (java.io.IOException exp) { exp.printStackTrace(); return false; } } } return true; } public static boolean toXML(Object object, String filePath) { return toXML(object, new File(filePath)); } public static void main(String args[]) { String s = "\u6210\u4EA4\u91CF"; // print ??? System.out.println(s); // fine! show ??? JOptionPane.showMessageDialog(null, s); toXML(s, "C:\\A.XML"); String o = fromXML(String.class, "C:\\A.XML"); // show ??? JOptionPane.showMessageDialog(null, o); } } I run the following code through command prompt in Windows Vista. 1) May I know why System.out.println unable to print out Chinese Character in console? 2) I open up the xstream file. The saved value is <string>???</string> How can I make xstream save Chinese Character correctly? Thanks.

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

< Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >