Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 616/750 | < Previous Page | 612 613 614 615 616 617 618 619 620 621 622 623  | Next Page >

  • Convenient way to do "wrong way rebase" in git?

    - by Kaz
    I want to pull in newer commits from master into topic, but not in such a way that topic changes are replayed over top of master, but rather vice versa. I want the new changes from master to be played on top of topic, and the result to be installed as the new topic head. I can get exactly the right object if I rebase master to topic, the only problem being that the object is installed as the new head of master rather than topic. Is there some nice way to do this without manually shuffling around temporary head pointers? Edit: Here is how it can be achieved using a temporary branch head, but it's clumsy: git checkout master git checkout -b temp # temp points to master git rebase topic # topic is brought into temp, temp changes played on top Now we have the object we want, and it's pointed at by temp. git checkout topic git reset --hard temp Now topic has it; and all that is left is to tidy up by deleting temp: git branch -d temp Another way is to to do away with temp and just rebase master, and then reset topic to master. Finally, reset master back to what it was by pulling its old head from the reflog, or a cut-and-paste buffer.

    Read the article

  • UnicodeEncodeError: 'ascii' codec can't encode character [...]

    - by user1461135
    I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

    Read the article

  • Why would ASP.NET MVC use session state?

    - by ray247
    Recommended by the ASP.NET team to use cache instead of session, we stopped using session from working with the WebForm model the last few years. So we normally have the session turned off in the web.config <sessionState mode="Off" /> But, now when I'm testing out a ASP.NET MVC application with this setting it throw an error in class SessionStateTempDataProvider inside the mvc framework, it asked me to turn on session state, I did and it worked. Looking at the source it uses session Dictionary<string, object> tempDataDictionary = httpContext.Session[TempDataSessionStateKey] as Dictionary<string, object>; // line 20 in SessionStateTempDataProvider.cs So, why would they use session here? What am I missing? Thanks, Ray. ======================================================== Edit Sorry didn't mean for this post to debate on session vs. cache, but rather in the context of the ASP.NET MVC, I was just wondering why session is used here. In this Scott Watermasysk blog post he mentioned on turning off session too as a good practice, so I'm just wondering do I have to turn it on to use MVC from here on?

    Read the article

  • Why can't decimal numbers be represented exactly in binary?

    - by Barry Brown
    There have been several questions posted to SO about floating-point representation. For example, the decimal number 0.1 doesn't have an exact binary representation, so it's dangerous to use the == operator to compare it to another floating-point number. I understand the principles behind floating-point representation. What I don't understand is why, from a mathematical perspective, are the numbers to the right of the decimal point any more "special" that the ones to the left? For example, the number 61.0 has an exact binary representation because the integral portion of any number is always exact. But the number 6.10 is not exact. All I did was move the decimal one place and suddenly I've gone from Exactopia to Inexactville. Mathematically, there should be no intrinsic difference between the two numbers -- they're just numbers. By contrast, if I move the decimal one place in the other direction to produce the number 610, I'm still in Exactopia. I can keep going in that direction (6100, 610000000, 610000000000000) and they're still exact, exact, exact. But as soon as the decimal crosses some threshold, the numbers are no longer exact. What's going on? Edit: to clarify, I want to stay away from discussion about industry-standard representations, such as IEEE, and stick with what I believe is the mathematically "pure" way. In base 10, the positional values are: ... 1000 100 10 1 1/10 1/100 ... In binary, they would be: ... 8 4 2 1 1/2 1/4 1/8 ... There are also no arbitrary limits placed on these numbers. The positions increase indefinitely to the left and to the right.

    Read the article

  • How to display objects with dynamic fields in wpf data grid?

    - by Oliver Hanappi
    Hi! I want to display and edit some objects in a WPF data grid and I'm looking for a good way to do so. All objects I want to display have the same fields, but every execution the fields of my objects can differ. Here is a piece of the interface to illustrate what I mean: public interface IMyObject { IEnumerable<string> GetFieldNames(); IEnumerable<Type> GetFieldTypes(); object GetField(string name); void SetField(string name, object value); } How can I generate a data grid which displays this kind of objects? I thought of XAML generation to define the columns, but I'm still facing the problem of accessing the fields. I think I could realize this with value converters, another option would be to dynamically create a type which exposes the dynamic fields with properties. Are there any other ways and which should I favor? I'm keen on hearing your opinions. Best Regards, Oliver Hanappi

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Script to install and compile Python, Django, Virtualenv, Mercurial, Git, LessCSS, etc... on Dreamho

    - by tmslnz
    The Story After cleaning up my Dreamhost shared server's home folder from all the cruft accumulated over time, I decided to start afresh and compile/reinstall Python. All tutorials and snippets I found seemed overly simplistic, assuming (or ignoring) a bunch of dependencies needed by Python to compile all modules correctly. So, starting from http://andrew.io/weblog/2010/02/installing-python-2-6-virtualenv-and-virtualenvwrapper-on-dreamhost/ (so far the best guide I found), I decided to write a set-and-forget Bash script to automate this painful process, including along the way a bunch of other things I am planning to use. The Script I am hosting the script on http://bitbucket.org/tmslnz/python-dreamhost-batch/src/ The TODOs So far it runs fine, and does all it needs to do in about 900 seconds, giving me at the end of the process a fully functional Python / Mercurial / etc... setup without even needing to log out and back in. I though this might be of use for others too, but there are a few things that I think it's missing and I am not quite sure how to go for it, what's the best way to do it, or if this just doesn't make any sense at all. Check for errors and break Check for minor version bumps of the packages and give warnings Check for known dependencies Use arguments to install only some of the packages instead of commenting out lines Organise the code in a manner that's easy to update Optionally make the installers and compiling silent, with error logging to file failproof .bashrc modification to prevent breaking ssh logins and having to log back via FTP to fix it EDIT: The implied question is: can anyone, more bashful than me, offer general advice on the worthiness of the above points or highlight any problems they see with this approach? (see my answer to Ry4an's comment below) The Gist I am no UNIX or Bash or compiler expert, and this has been built iteratively, by trial and error. It is somehow going towards apt-get (well, 1% of it...), but since Dreamhost and others obviously cannot give root access on shared servers, this looks to me like a potentially very useful workaround; particularly so with some community work involved.

    Read the article

  • Possibility of a custom Contacts field with a set list of values and Contacts lookup performance

    - by areyling
    I'm pretty sure it's not viable to do what I'd like to based on some initial research, but I figured it couldn't hurt to ask the community of experts here in case someone knows a way. I'd like to create a custom field for contacts that the user is able to edit from the main Contacts app; however, the user should only be allowed to select from a list of four specific values. A short list of string values would be ideal, but an int with a min/max range would suffice. I'm interested in knowing if it's possible either way, but also wondering if it make sense to go this route performance wise. More specifically, would it be better to look up a contact (based on a phone number) each time a call or SMS message is received or better to store my own set of data (consisting of name, numbers, and the custom field) and just syncing contact info in a thread every so often? Or syncing contacts the first time the app is run and then registering for changes using ContentObserver? Here is a similar question with an answer that explains how to add a custom field to a contact. Thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to only fade content once it is ready in Jquery?

    - by Jared
    Hello, I've seen examples for load() and ready(), but they always seem to apply to the window or document body, or a div or img or something like that. I have a hover() function, and when you hover over it, it uses fadeIn() to reveal it. Problem is, the images inside the div aren't loaded yet, so it ends up just appearing anyway. I need code that will only allow the image to fade when it's contents are fully loaded. When I just plug in other selectors like the following, it doesn't work $(this).next(".menuPopup").ready(function () { //or load(), neither work fadeTo(300, 1); }); EDIT: Relevant code $( '.leftMenuProductButton' ).hover ( function () { $(this).next(".menuPopup").stop().css("opacity", 1).fadeIn('slow'); }, function () { $(this).next(".menuPopup").stop().hide(); }); HTML <div class="leftMenuProductButton"> Product 1</div> <div id="raceramps56" class="menuPopup"><IMG SRC="myimage.jpeg"> </div>

    Read the article

  • relative url in wcf service binding

    - by Jeremy
    I have a silverlight control which has a reference to a silverlight enabled wcf service. When I add a reference to the service in my silverlight control, it adds the following to my clientconfig file: <configuration> <system.serviceModel> <bindings> <basicHttpBinding> <binding name="BasicHttpBinding_DataAccess" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <security mode="None" /> </binding> </basicHttpBinding> </bindings> <client> <endpoint address="http://localhost:3097/MyApp/DataAccess.svc" binding="basicHttpBinding" bindingConfiguration="BasicHttpBinding_DataAccess" contract="svcMyService.DataAccess" name="BasicHttpBinding_DataAccess" /> </client> </system.serviceModel> </configuration> How do I specify a relative url in the endpoint address instead of the absolute url? I want it to work no matter where I deploy the web app to without having to edit the clientconfig file, because the silverlight component and the web app will always be deployed together. I thought I'd be able to specify just "DataAccess.svc" but it doesn't seem to like that.

    Read the article

  • Castle, sharing a transient component between a decorator and a decorated component

    - by Marius
    Consider the following example: public interface ITask { void Execute(); } public class LoggingTaskRunner : ITask { private readonly ITask _taskToDecorate; private readonly MessageBuffer _messageBuffer; public LoggingTaskRunner(ITask taskToDecorate, MessageBuffer messageBuffer) { _taskToDecorate = taskToDecorate; _messageBuffer = messageBuffer; } public void Execute() { _taskToDecorate.Execute(); Log(_messageBuffer); } private void Log(MessageBuffer messageBuffer) {} } public class TaskRunner : ITask { public TaskRunner(MessageBuffer messageBuffer) { } public void Execute() { } } public class MessageBuffer { } public class Configuration { public void Configure() { IWindsorContainer container = null; container.Register( Component.For<MessageBuffer>() .LifeStyle.Transient); container.Register( Component.For<ITask>() .ImplementedBy<LoggingTaskRunner>() .ServiceOverrides(ServiceOverride.ForKey("taskToDecorate").Eq("task.to.decorate"))); container.Register( Component.For<ITask>() .ImplementedBy<TaskRunner>() .Named("task.to.decorate")); } } How can I make Windsor instantiate the "shared" transient component so that both "Decorator" and "Decorated" gets the same instance? Edit: since the design is being critiqued I am posting something closer to what is being done in the app. Maybe someone can suggest a better solution (if sharing the transient resource between a logger and the true task is considered a bad design)

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Different results between Android Geocoder and Google Geocoding web service

    - by user3571822
    I am creating an Android application and I need to use the geolocation. I have started by using the Geocoder API from Android (android.location.geocoder) but it causes some issues (timed out waiting for response from server) which seem to be common according to what I have read. To make my application work when this kind of error occurs, I use the Geocoding web service. Now, the application works every time. The problem is that the results returned by the geocoder from API and the geocoder from the web service are not the same. For example the web service returns only 3 addresses with only city name and country whereas the geocoding from the API returns about 8 addresses with the feature name, the thoroughfare, the locality... The question is: is there a way to make the results from the web service exactly the same than the ones from the API? EDIT Here is my MainGeocoder class: public class MainGeocoder { private Geocoder geocoderAPI; private GeocoderRest geocoderRest; public MainGeocoder(Context context) { geocoderAPI = new Geocoder(context); geocoderRest = new GeocoderRest(context); } public List<Address> getFromLocationName(String search, int maxResults) { List<Address> addresses; try { addresses = geocoderAPI.getFromLocationName(search, maxResults); return addresses; } catch (IOException e) { e.printStackTrace(); try { addresses = geocoderRest.getFromLocationName(search, maxResults); return addresses; } catch (IOException e1) { return null; } catch (LimitExceededException e1) { return null; } } } } It basically tries to get the list of addresses from the API Geocoder. If an IO exception is thrown it gets this list from the web service by using the GeocoderRest class which has been pasted from here: http://stackoverflow.com/a/15117087/3571822

    Read the article

  • NetBeans Platform - how to refresh the property sheet view of a node?

    - by I82Much
    Hi all, I am using the PropertySheetView component to visualize and edit the properties of a node. This view should always reflect the most recent properties of the object; if there is a change to the object in another process, I want to somehow refresh the view and see the updated properties. The best way I was able to do this is something like the following (making use of EventBus library to publish and subscribe to changes in objects): public DomainObjectWrapperNode(DomainObject obj) { super (Children.LEAF, Lookups.singleton(obj)); EventBus.subscribe(DomainObject.class, this); } public void onEvent(DomainObject event) { // Do a check to determine if the updated object is the one wrapped by this node; // if so fire a property sets change firePropertySetsChange(null, this.getPropertySets()); } This works, but my place in the scrollpane is lost when the sheet refreshes; it resets the view to the top of the list and I have to scroll back down to where I was before the refresh action. So my question is, is there a better way to refresh the property sheet view of a node, specifically so my place in the property list is not lost upon refresh?

    Read the article

  • Prolog singleton variables in Python

    - by Rubens
    I'm working on a little set of scripts in python, and I came to this: line = "a b c d e f g" a, b, c, d, e, f, g = line.split() I'm quite aware of the fact that these are decisions taken during implementation, but shouldn't (or does) python offer something like: _, _, var_needed, _, _, another_var_needed, _ = line.split() as well as Prolog does offer, in order to exclude the famous singleton variables. I'm not sure, but wouldn't it avoid unnecessary allocation? Or creating references to the result of the split call does not count up as overhead? EDIT: Sorry, my point here is: in Prolog, as far as I'm concerned, in an expression like: test(L, N) :- test(L, 0, N). test([], N, N). test([_|T], M, N) :- V is M + 1, test(T, V, N). The variable represented by _ is not accessible, for what I suppose the reference to the value that does exist in the list [_|T] is not even created. But, in Python, if I use _, I can use the last value assigned to _, and also, I do suppose the assignment occurs for each of the variables _ -- which may be considered an overhead. My question here is if shouldn't there be (or if there is) a syntax to avoid such unnecessary attributions.

    Read the article

  • Is it safe to read regular expressions from a file?

    - by Zilk
    Assuming a Perl script that allows users to specify several text filter expressions in a config file, is there a safe way to let them enter regular expressions as well, without the possibility of unintended side effects or code execution? Without actually parsing the regexes and checking them for problematic constructs, that is. There won't be any substitution, only matching. As an aside, is there a way to test if the specified regex is valid before actually using it? I'd like to issue warnings if something like /foo (bar/ was entered. Thanks, Z. EDIT: Thanks for the very interesting answers. I've since found out that the following dangerous constructs will only be evaluated in regexes if the use re 'eval' pragma is used: (?{code}) (??{code}) ${code} @{code} The default is no re 'eval'; so unless I'm missing something, it should be safe to read regular expressions from a file, with the only check being the eval/catch posted by Axeman. At least I haven't been able to hide anything evil in them in my tests. Thanks again. Z.

    Read the article

  • Catch a thread's exception in the caller thread in Python

    - by Mikee
    Hi Everyone, I'm very new to Python and multithreaded programming in general. Basically, I have a script that will copy files to another location. I would like this to be placed in another thread so I can output "...." to indicate that the script is still running. The problem that I am having is that if the files cannot be copied it will throw an exception. This is ok if running in the main thread; however, having the following code does not work: try: threadClass = TheThread(param1, param2, etc.) threadClass.start() ##### **Exception takes place here** except: print "Caught an exception" In the thread class itself, I tried to re-throw the exception, but it does not work. I have seen people on here ask similar questions, but they all seem to be doing something more specific than what I am trying to do (and I don't quite understand the solutions offered). I have seen people mention the usage of sys.exc_info(), however I do not know where or how to use it. All help is greatly appreciated! EDIT: The code for the thread class is below: class TheThread(threading.Thread): def __init__(self, sourceFolder, destFolder): threading.Thread.__init__(self) self.sourceFolder = sourceFolder self.destFolder = destFolder def run(self): try: shul.copytree(self.sourceFolder, self.destFolder) except: raise

    Read the article

  • How to detect .NET WPF memory leak or GC long run?

    - by Néstor Sánchez A.
    I have the next very strange situation and problem: .NET 4.0 application for diagram editing (WPF). Runs ok in my PC: 8GM RAM, 3.0GHz, i7 quad-core. While creating objects (mostly diagram nodes and connectors, plus all the undo/redo information) the TaskManager show, as expected, some memory usage "jumps" (up and down). These mem-usage "jumps" also remains executing AFTER user interaction ended. Maybe this is the GC cleaning/regorganizing memory? To see what is going on, I've used the Ants mem profiler, but somewhat it prevents those "jumps" to happen after user interaction. PROBLEM: It Freezes/Hangs after seconds or minutes of usage in some slow/weak laptos/netbooks of my beta testers (under 2GHz of speed and under 2GB of RAM). I was thinking of a memory leak, but... EDIT: Also, there is the case that the memory usage grows and grows until collapse (only in slow machines). In a Windows XP Mode machine (VM in Win 7) with only 512MB of RAM Assigned it works fine without mem-usage "jumps" after user interaction (no GC cleaning?!). So, I really have a big trouble because I cannot reproduce the error, only see these strange behaviour (mem jumps), and the tool supposed to show me what is happening is hiding the problem (like the "observer's paradox"). Any ideas on what's happening and how to solve it?

    Read the article

  • Where to store site settings: DB? XML? CONFIG? CLASS FILES?

    - by Emin
    I am re-building a news portal of which already have a large number of visits every day. One of the major concerns when re-building this site was to maximize performance and speed. Having said this, we have done many things from caching, to all sort of other measures to ensure speed. Now towards the end of the project, I am having a dilemma of where to store my site settings that would least affect performance. The site settings will include things such as: Domain, DefaultImgPath, Google Analytics code, default emails of editors as well as more dynamic design/display feature settings such as the background color of specific DIVs and default color for links etc.. As far as I know, I have 4 choices in storing all these info. Database: Storing general settings in the DB and caching them may be a solution however, I want to limit the access to the database for only necessary and essential functions of the project which generally are insert/update/delete news items, author articles etc.. XML: I can store these settings in an XML file but I have not done this sort of thing before so I don't know what kind of problems -if any- I might face in the future. CONFIG: I can also store these settings in web.config CLASS FILE: I can hard code all these settings in a SiteSettings class, but since the site admin himself will be able to edit these settings, It may not be the best solution. Currently, I am more close to choosing web.config but letting people fiddle with it too often is something I do not want. E.g. if somehow, I miss out a validation for something and it breaks the web.config, the whole site will go down. My concern basically is that, I cannot forsee any possible consequences of using any of the methods above (or is there any other?), I was hoping to get this question over to more experienced people out here who hopefully help make my decision.

    Read the article

  • Quick MVC2 checkbox question

    - by kevinmajor1
    In order to get my EF4 EntityCollection to bind with check box values, I have to manually create the check boxes in a loop like so: <p> <%: Html.Label("Platforms") %><br /> <% for(var i = 0; i < Model.AllPlatforms.Count; ++i) { %> <%: Model.AllPlatforms[i].Platform.Name %> <input type="checkbox" name="PlatformIDs" value="<%: Model.AllPlatforms[i].Platform.PlatformID %>" /><br /> <% } %> </p> It works, but it doesn't automatically populate the group of check boxes with existing values when I'm editing a model entity. Can I fudge it with something like? <p> <%: Html.Label("Platforms") %><br /> <% for(var i = 0; i < Model.AllPlatforms.Count; ++i) { %> <%: Model.AllPlatforms[i].Platform.Name %> <input type="checkbox" name="PlatformIDs" value="<%: Model.AllPlatforms[i].Platform.PlatformID %>" checked=<%: Model.GameData.Platforms.Any(p => PlatformID == i) ? "true" : "false" %> /><br /> <% } %> </p> I figure there has to be something along those lines which will work, and am just wondering if I'm on the right track. EDIT: I'm purposely staying away from MVC's check box HTML helper methods as they're too inflexible for my needs. My check boxes use integers as their values by design.

    Read the article

  • Database design: Calculating the Account Balance

    - by 001
    How do I design the database to calculate the account balance? 1) Currently I calculate the account balance from the transaction table In my transaction table I have "description" and "amount" etc.. I would then add up all "amount" values and that would work out the user's account balance. I showed this to my friend and he said that is not a good solution, when my database grows its going to slow down???? He said I should create separate table to store the calculated account balance. If did this, I will have to maintain two tables, and its risky, the account balance table could go out of sync. Any suggestion? EDIT: OPTION 2: should I add an extra column to my transaction tables "Balance". now I do not need to go through many rows of data to perform my calculation. Example John buys $100 credit, he debt $60, he then adds $200 credit. Amount $100, Balance $100. Amount -$60, Balance $40. Amount $200, Balance $240.

    Read the article

  • alternative to #include within namespace { } block

    - by Jeff
    Edit: I know that method 1 is essentially invalid and will probably use method 2, but I'm looking for the best hack or a better solution to mitigate rampant, mutable namespace proliferation. I have multiple class or method definitions in one namespace that have different dependencies, and would like to use the fewest namespace blocks or explicit scopings possible but while grouping #include directives with the definitions that require them as best as possible. I've never seen any indication that any preprocessor could be told to exclude namespace {} scoping from #include contents, but I'm here to ask if something similar to this is possible: (see bottom for explanation of why I want something dead simple) // NOTE: apple.h, etc., contents are *NOT* intended to be in namespace Foo! // would prefer something most this: namespace Foo { #include "apple.h" B *A::blah(B const *x) { /* ... */ } #include "banana.h" int B::whatever(C const &var) { /* ... */ } #include "blueberry.h" void B::something() { /* ... */ } } // namespace Foo ... // over this: #include "apple.h" #include "banana.h" #include "blueberry.h" namespace Foo { B *A::blah(B const *x) { /* ... */ } int B::whatever(C const &var) { /* ... */ } void B::something() { /* ... */ } } // namespace Foo ... // or over this: #include "apple.h" namespace Foo { B *A::blah(B const *x) { /* ... */ } } // namespace Foo #include "banana.h" namespace Foo { int B::whatever(C const &var) { /* ... */ } } // namespace Foo #include "blueberry.h" namespace Foo { void B::something() { /* ... */ } } // namespace Foo My real problem is that I have projects where a module may need to be branched but have coexisting components from the branches in the same program. I have classes like FooA, etc., that I've called Foo::A in the hopes being able to branch less painfully as Foo::v1_2::A, where some program may need both a Foo::A and a Foo::v1_2::A. I'd like "Foo" or "Foo::v1_2" to show up only really once per file, as a single namespace block, if possible. Moreover, I tend to prefer to locate blocks of #include directives immediately above the first definition in the file that requires them. What's my best choice, or alternatively, what should I be doing instead of hijacking the namespaces?

    Read the article

  • implementing stretchable dialog borders in iphone sdk

    - by Joey
    Hi, I want to implement dialog borders that scale to the size I require the dialog to be. Perhaps there is a better more conventional name for this sort of thing. If there is, if someone would edit the title, that'd be great. Anyhow, I'd like to do this so I can have dialogs of any size without the visual artifacts that come with scaling border art to small, large, or wacky unproportional dimentions. I have a few ideas on how this is done, but am not sure which is better for iphone. I have a few questions. 1) Should I make a containing view object that basically overloads its drawRect method and draws the images where they should be at their appropriate scale when the method is called, or should I main a containing view object that simply contains 8 UIImageViews? I suspect the latter approach won't work if I need to actively scale the resulting dialog class like in an animation. 1b) If overloading drawRect is the way to go, does someone have some sample code or a link to an example that demonstrates drawing an image directly from drawRect()? 2) Is it generally better to create a) a 3 x 3 image where the segments are in their appropriate 1x1 grid of the image? If so, is it simple to draw from a portion of this image onto my target view in drawRect (if the former assumption is correct that I should use drawRect)? b) The pieces separately in 8 different files?

    Read the article

  • I'm trying to grasp the concept of creating a program that uses a SQL Server database, but I'm used

    - by Sergio Tapia
    How can I make a program use a SQL Server database, and have that program work on whatever computer it's installed on. If you've been following my string of questions today, you'd know that I'm making an open source and free Help Desk suite for small and medium businesses. The client application. The client application is a Windows Forms app. On installation and first launch on every client machine, it'll ask for the address of the main Help Desk server. The server. Here I plan to handle all incoming help requests, show them to the IT guys, and provide WCF services for the Client application to consume. My dilemma lies in that, I know how to make the program run on my local machine; but I'm really stumped on how to make this work for everyone who wants to download and install the server bit on their Windows Server. Would I have to make an SQL Script and have it run on the MS SQL server when a user wants to install the 'server' application? Many thanks to all for your valuable time and effort to teach me. It's really really appreciated. :) Edit: To clarify, each business will have their server completely separate from me. I will have no access whatsoever to them nor will they be in any way connected to me. (I don't know why I should clarify this :P ) So, assuming the have ABSOLUTELY NO DATABASE SERVER installed; what can I do?

    Read the article

< Previous Page | 612 613 614 615 616 617 618 619 620 621 622 623  | Next Page >