Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 619/750 | < Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >

  • "variable tracking" is eating my compile time!

    - by wowus
    I have an auto-generated file which looks something like this... static void do_SomeFunc1(void* parameter) { // Do stuff. } // Continues on for another 4000 functions... void dispatch(int id, void* parameter) { switch(id) { case ::SomeClass1::id: return do_SomeFunc1(parameter); case ::SomeClass2::id: return do_SomeFunc2(parameter); // This continues for the next 4000 cases... } } When I build it like this, the build time is enormous. If I inline all the functions automagically into their respective cases using my script, the build time is cut in half. GCC 4.5.0 says ~50% of the build time is being taken up by "variable tracking" when I use -ftime-report. What does this mean and how can I speed compilation while still maintaining the superior cache locality of pulling out the functions from the switch? EDIT: Interestingly enough, the build time has exploded only on debug builds, as per the following profiling information of the whole project (which isn't just the file in question, but still a good metric; the file in question takes the most time to build): Debug: 8 minutes 50 seconds Release: 4 minutes, 25 seconds

    Read the article

  • Why the HelloWorld of opennlp library works fine on Java but doesn't work with Jruby?

    - by 0x90
    I am getting this error: SyntaxError: hello.rb:13: syntax error, unexpected tIDENTIFIER public HelloWorld( InputStream data ) throws IOException { The HelloWorld.rb is: require "java" import java.io.FileInputStream; import java.io.InputStream; import java.io.IOException; import opennlp.tools.postag.POSModel; import opennlp.tools.postag.POSTaggerME; public class HelloWorld { private POSModel model; public HelloWorld( InputStream data ) throws IOException { setModel( new POSModel( data ) ); } public void run( String sentence ) { POSTaggerME tagger = new POSTaggerME( getModel() ); String[] words = sentence.split( "\\s+" ); String[] tags = tagger.tag( words ); double[] probs = tagger.probs(); for( int i = 0; i < tags.length; i++ ) { System.out.println( words[i] + " => " + tags[i] + " @ " + probs[i] ); } } private void setModel( POSModel model ) { this.model = model; } private POSModel getModel() { return this.model; } public static void main( String args[] ) throws IOException { if( args.length < 2 ) { System.out.println( "HelloWord <file> \"sentence to tag\"" ); return; } InputStream is = new FileInputStream( args[0] ); HelloWorld hw = new HelloWorld( is ); is.close(); hw.run( args[1] ); } } when running ruby HelloWorld.rb "I am trying to make it work" when I run the HelloWorld.java "I am trying to make it work" it works perfectly, of course the .java doesn't contain the require java statement. EDIT: I followed the following steps. The output for jruby -v : jruby 1.6.7.2 (ruby-1.8.7-p357) (2012-05-01 26e08ba) (Java HotSpot(TM) 64-Bit Server VM 1.6.0_35) [darwin-x86_64-java]

    Read the article

  • 60K+ Sprites on the 360?

    - by Jeffrey Kern
    Hey everyone, Just wondering - throwing ideas in my head - about starting a new XNA project for the 360. I would like it to be retro-old school, and emulating scanlines and color palettes and such. As part of this idea, what I would ideally like to do is manually draw each and every pixel of the screen. So, worst-case scenario I would have to draw about 60K sprites on a 252x240 resolution (I think thats correct). 60K sprites on the screen at a time. So, before I even attempt to code this - would the XBOX 360 be able to keep up with this even? That is a lot of sprites, but they aren't big sprites, and the texture data needed would be non-existant. However, I guess how this project would be implemented would make it or break it, but all I was thinking was coming up with a 2D array and mapping which color value would need to be drawn at that point. Of course, this is watered down talk right now. But what you all suggest? EDIT: Each sprite would represent one pixel. E.g., a sprite at 0,0. Another at 0,1. etc.

    Read the article

  • rails not recognizing project

    - by tipu
    I can create a new project using rails and I can use stuff like rails migration ... and i (correctly) get a error because the sqlite gem is missing. but when i try using rails migration ... with a project i checked out from github, it doesn't recognize that it is a rails project i get: Usage: rails new APP_PATH [options] Options: -d, [--database=DATABASE] # Preconfigure for selected database (options: mysql/oracle/postgresql/sqlite3/frontbase/ibm_db) # Default: sqlite3 -O, [--skip-active-record] # Skip Active Record files [--dev] # Setup the application with Gemfile pointing to your Rails checkout -J, [--skip-prototype] # Skip Prototype files -T, [--skip-test-unit] # Skip Test::Unit files -G, [--skip-git] # Skip Git ignores and keeps -b, [--builder=BUILDER] # Path to an application builder (can be a filesystem path or URL) [--edge] # Setup the application with Gemfile pointing to Rails repository -m, [--template=TEMPLATE] # Path to an application template (can be a filesystem path or URL) -r, [--ruby=PATH] # Path to the Ruby binary of your choice # Default: /usr/bin/ruby1.8 [--skip-gemfile] # Don't create a Gemfile and it goes on. any ideas? edit: it's probably an important detail that earlier my rails wasn't working at all. i had to cp /usr/bin/ruby to /usr/bin/local/ruby

    Read the article

  • Optimizing an embedded SELECT query in mySQL

    - by Crazy Serb
    Ok, here's a query that I am running right now on a table that has 45,000 records and is 65MB in size... and is just about to get bigger and bigger (so I gotta think of the future performance as well here): SELECT count(payment_id) as signup_count, sum(amount) as signup_amount FROM payments p WHERE tm_completed BETWEEN '2009-05-01' AND '2009-05-30' AND completed > 0 AND tm_completed IS NOT NULL AND member_id NOT IN (SELECT p2.member_id FROM payments p2 WHERE p2.completed=1 AND p2.tm_completed < '2009-05-01' AND p2.tm_completed IS NOT NULL GROUP BY p2.member_id) And as you might or might not imagine - it chokes the mysql server to a standstill... What it does is - it simply pulls the number of new users who signed up, have at least one "completed" payment, tm_completed is not empty (as it is only populated for completed payments), and (the embedded Select) that member has never had a "completed" payment before - meaning he's a new member (just because the system does rebills and whatnot, and this is the only way to sort of differentiate between an existing member who just got rebilled and a new member who got billed for the first time). Now, is there any possible way to optimize this query to use less resources or something, and to stop taking my mysql resources down on their knees...? Am I missing any info to clarify this any further? Let me know... EDIT: Here are the indexes already on that table: PRIMARY PRIMARY 46757 payment_id member_id INDEX 23378 member_id payer_id INDEX 11689 payer_id coupon_id INDEX 1 coupon_id tm_added INDEX 46757 tm_added, product_id tm_completed INDEX 46757 tm_completed, product_id

    Read the article

  • Returning HTML in the JS portion of a respond_to block throws errors in IE

    - by Horace Loeb
    Here's a common pattern in my controller actions: respond_to do |format| format.html {} format.js { render :layout => false } end I.e., if the request is non-AJAX, I'll send the HTML content in a layout on a brand new page. If the request is AJAX, I'll send down the same content, but without a layout (so that it can be inserted into the existing page or put into a lightbox or whatever). So I'm always returning HTML in the format.js portion, yet Rails sets the Content-Type response header to text/javascript. This causes IE to throw this fun little error message: Of course I could set the content-type of the response every time I did this (or use an after_filter or whatever), but it seems like I'm trying to do something relatively standard and I don't want to add additional boilerplate code. How do I fix this problem? Alternatively, if the only way to fix the problem is to change the content-type of the response, what's the best way to achieve the behavior I want (i.e., sending down content with layout for non-AJAX and the same content without a layout for AJAX) without having to deal with these errors? Edit: This blog post has some more info

    Read the article

  • How do I implement aasm in Rails 3 for what I want it to do?

    - by marcamillion
    I am a Rails n00b and have been advised that in order for me to keep track of the status of my user's accounts (i.e. paid, unpaid (and therefore disabled), free trial, etc.) I should use an 'AASM' gem. So I found one that seems to be the most popular: https://github.com/rubyist/aasm But the instructions are pretty vague. I have a Users model and a Plan model. User's model manages everything you might expect (username, password, first name, etc.). Plan model manages the subscription plan that users should be assigned to (with the restrictions). So I am trying to figure out how to use the AASM gem to do what I want to do, but no clue where to start. Do I create a new model ? Then do I setup a relationship between my User model and the model for AASM ? How do I setup a relationship? As in, a user 'has_many' states ? That doesn't seem to make much sense to me. Any guidance would be really appreciated. Thanks. Edit: If anyone else is confused by AASMs like myself, here is a nice explanation of their function in Rails by the fine folks at Envy Labs: http://blog.envylabs.com/2009/08/the-rails-state-machine/ Edit2: How does this look: include AASM aasm_column :current_state aasm_state :paid aasm_state :free_trial aasm_state :disabled #this is for accounts that have exceed free trial and have not paid #aasm_state :free_acct aasm_event :pay do transitions :to => :paid, :from => [:free_trial, :disabled] transitions :to => :disabled, :from => [:free_trial, :paid] end

    Read the article

  • Synchronizing one or more databases with a master database - Foreign keys

    - by Ikke
    I'm using Google Gears to be able to use an application offline (I know Gears is deprecated). The problem I am facing is the synchronization with the database on the server. The specific problem is the primary keys or more exactly, the foreign keys. When sending the information to the server, I could easily ignore the primary keys, and generate new ones. But then how would I know what the relations are. I had one sollution in mind, bet the I would need to save all the pk for every client. What is the best way to synchronize multiple client with one server db. Edit: I've been thinking about it, and I guess seqential primary keys are not the best solution, but what other possibilities are there? Time based doesn't seem right because of collisions which could happen. A GUID comes to mind, is that an option? It looks like generating a GUID in javascript is not that easy. I can do something with natural keys or composite keys. As I'm thinking about it, that looks like the best solution. Can I expect any problems with that?

    Read the article

  • Rails can't find my route but it exists!

    - by DJTripleThreat
    Ok I have events that I want to publish/unpublish with an extra action (nonRESTful) I watched Ryan Bates' railscast on this: http://railscasts.com/episodes/35-custom-rest-actions and it got me most of the way. I think the problem is that my route is nested in an /admin section so even though when I run rake routes and get: publish_admin_event PUT /admin/events/:id/publish(.:format) {:controller=>"event_services", :action=>"publish"} This won't work in my /views/admin/index.html.erb file: <%= link_to 'Publish', publish_admin_event(event), :method => :put %> because it claims that path doesn't exist! And neither will this: <%= link_to 'Publish', {:controller => :event_services, :action => :publish}, {:method => :put, :id => event} %> and says that "No route matches {:controller=>"event_services", :action=>"publish"}" so what gives? (And I've tried restarting my server so that isn't it.) EDIT: This DOES work: <%= link_to 'Publish', "/admin/events/" + event.id.to_s + "/publish", :method => :put %> But I'd rather NOT do this.

    Read the article

  • NetBeans Platform - how to refresh the property sheet view of a node?

    - by I82Much
    Hi all, I am using the PropertySheetView component to visualize and edit the properties of a node. This view should always reflect the most recent properties of the object; if there is a change to the object in another process, I want to somehow refresh the view and see the updated properties. The best way I was able to do this is something like the following (making use of EventBus library to publish and subscribe to changes in objects): public DomainObjectWrapperNode(DomainObject obj) { super (Children.LEAF, Lookups.singleton(obj)); EventBus.subscribe(DomainObject.class, this); } public void onEvent(DomainObject event) { // Do a check to determine if the updated object is the one wrapped by this node; // if so fire a property sets change firePropertySetsChange(null, this.getPropertySets()); } This works, but my place in the scrollpane is lost when the sheet refreshes; it resets the view to the top of the list and I have to scroll back down to where I was before the refresh action. So my question is, is there a better way to refresh the property sheet view of a node, specifically so my place in the property list is not lost upon refresh?

    Read the article

  • Mootools Javascript can't push to array

    - by nona
    I have an array set with the heights of each hidden div, but when I use it, the div instantly jumps down, rather than slowly sliding as when there is a literal number. EDIT: testing seems to reveal that it's a problem with the push method, as content_height.push(item.getElement('.moreInfo').offsetHeight);alert(content_height[i]);gives undefined, but alert(item.getElement('.moreInfo').offsetHeight); gives the correct values Javascript: window.addEvent('domready', function(){ var content_height = [];i=0; $$( '.bio_accordion' ).each(function(item){ i++; content_height.push( item.getElement('.moreInfo').offsetHeight); var thisSlider = new Fx.Slide( item.getElement( '.moreInfo' ), { mode: 'horizontal' } ); thisSlider.hide(); item.getElement('.moreInfo').set('tween').tween('height', '0px'); var morph = new Fx.Morph(item.getElement( '.divToggle' )); var selected = 0; item.getElement( '.divToggle' ).addEvents({ 'mouseenter': function(){ if(!selected) this.morph('.div_highlight'); }, 'mouseleave': function(){ if(!selected) { this.morph('.divToggle'); } }, 'click': function(){ if (!selected){ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; item.getElement('.moreInfo').set('tween', { duration: 1500, transition: Fx.Transitions.Bounce.easeOut }).tween('height', content_height[i]); //replacing this with '650' keeps it smooth selected = 1; thisSlider.slideIn(); } else{ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; thisSlider.slideOut(); item.getElement('.moreInfo').set('tween', { duration: 1000, transition: Fx.Transitions.Bounce.easeOut }).tween('height', '0px'); selected = 0; } } }); } ); }); Why could this be? Thanks so much!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I make JPA POJO classes + Netbeans forms play well together?

    - by Zak
    I started using netbeans to design forms to edit the instances of various classes I have made in a small app I am writing. Basically, the app starts, an initial set of objects is selected from the DB and presented in a list, then an item in the list can be selected for editing. When the editor comes up it has form fields for many of the data fields in the class. The problem I run into is that I have to create a controller that maps each of the data elements to the correct form element, and create an inordinate number of small conversion mapping lines of code to convert numbers into strings and set the correct element in a dropdown, then another inordinate amount of code to go back and update the underlying object with all the values from the form when the save button is clicked. My question is; is there a more directly way to make the editing of the form directly modify the contents of my class instance? I would like to be able to have a default mapping "controller" that I can configure, then override the getter/setter for a particular field if needed. Ideally, there would be standard field validation for things like phone numbers, integers, floats, zip codes, etc... I'm not averse to writing this myself, I would just like to see if it is already out there and use the right tool for the right job.

    Read the article

  • What is the IoC / "Springy" way to handle MVP in GWT? (Hint, probably not the Spring Roo 1.1 way)

    - by Ehrann Mehdan
    This is the Spring Roo 1.1 way of doing a factory that returns a GWT Activity (Yes, Spring Framework) public Activity getActivity(ProxyPlace place) { switch (place.getOperation()) { case DETAILS: return new EmployeeDetailsActivity((EntityProxyId<EmployeeProxy>)place.getProxyId(), requests, placeController, ScaffoldApp.isMobile() ? EmployeeMobileDetailsView.instance() : EmployeeDetailsView.instance()); case EDIT: return makeEditActivity(place); case CREATE: return makeCreateActivity(); } throw new IllegalArgumentException("Unknown operation " + place.getOperation()); } It seems to me that we just went back hundred of years if we use a switch case with constants to make a factory. Now this is official auto generated Spring roo 1.1 with GWT / GAE integration, I kid you not I can only assume this is some executives empty announcements because this is definitly not Spring It seems VMWare and Google were too fast to get something out and didn't quite finish it, isn't it? Am I missing something or this is half baked and by far not the way Spring + GWT MVP should work? Do you have a better example of how Spring, GWT (2.1 MVP approach) and GAE should connect? I would hate to do all the plumbing of managing history and activities like this. (no annotations? IOC?) I also would hate to reinvent the wheel and write my own Spring enhancement just to find someone else did the same, or worse, find out that SpringSource and Google will release roo 1.2 soon and make it right

    Read the article

  • Creating a ComboBox with one or more separator items?

    - by Steve
    I'm using Delphi7 and I'd like to have a ComboBox with separator items (Just like in popup menus). I've seen this beautifully implemented in Mozilla Sunbird (I know, it's not Delphi...) the following way: The separator item is a simple gray line drawn in the center of the item If you hover over the separator with the mouse, the selection doesn't appear If the user clicks the separator, it's not selected either AND the combobox doesn't closeup. No. 1 could be implemented using DrawItem. I could live without No. 2 because I have no idea about that. For No. 3 I'm asking for your help. I've figured out that straight after closing up a CBN_CLOSEUP message is sent to the combobox. I thought about hooking the window proc and if CBN_CLOSEUP is sent to a certain combobox then countering it. But I'm unsure if this is the best solution, or maybe there are other, more elegant ways? Whatever the solution is, I'd like to have a standard ComboBox which supports WinXP/Vista/7 theming properly. Thanks! Edit: For a working component please see this thread: Can you help translating this very small C++ component to Delphi?

    Read the article

  • iOS - Passing variable to view controller

    - by gj15987
    I have a view with a view controller and when I show this view on screen, I want to be able to pass variables to it from the calling class, so that I can set the values of labels etc. First, I just tried creating a property for one of the labels, and calling that from the calling class. For example: SetTeamsViewController *vc = [[SetTeamsViewController alloc] init]; vc.myLabel.text = self.teamCount; [self presentModalViewController:vc animated:YES]; [vc release]; However, this didn't work. So I tried creating a convenience initializer. SetTeamsViewController *vc = [[SetTeamsViewController alloc] initWithTeamCount:self.teamCount]; And then in the SetTeamsViewController I had - (id)initWithTeamCount:(int)teamCount { self = [super initWithNibName:nil bundle:nil]; if (self) { // Custom initialization self.teamCountLabel.text = [NSString stringWithFormat:@"%d",teamCount]; } return self; } However, this didn't work either. It's just loading whatever value I've given the label in the nib file. I've littered the code with NSLog()s and it is passing the correct variable values around, it's just not setting the label. Any help would be greatly appreciated. EDIT: I've just tried setting an instance variable in my designated initializer, and then setting the label in viewDidLoad and that works! Is this the best way to do this? Also, when dismissing this modal view controller, I update the text of a button in the view of the calling ViewController too. However, if I press this button again (to show the modal view again) whilst the other view is animating on screen, the button temporarily has it's original value again (from the nib). Does anyone know why this is?

    Read the article

  • Vim: Making Auto-Completion Smarter

    - by Rafid K. Abdullah
    I use ctags, taglist, etc., to have auto completion in Vim. However, it is very limited compared to Visual Studio intellisense or Eclipse auto-completion. I am wondering whether it is possible to tune Vim to: Show auto-completion whenever . or - are typed. But only after some text that might be a variable (e.g. avoid showing auto completion after a number). Show function parameters when ( is typed. Stop removing the auto completion list when some delete all characters after . or -: When I enter a variable name, then press . or - to search for a certain member, I frequently have to delete all the characters I type after the . or -, but this makes Vim hide the auto completion list. I would like to keep it visible unless I press Esc. Showing related auto completion: When I type a variable and press ^X ^O, it usually shows me all the tags in the ctags file. I would like to have it showing only the tags related to the variable. Thanks for the help. EDIT: Some people are voting for this question, but no body seems to know the answer. So just wanted to mention that you don't have to provide a complete answer; partial answers to any of the mentioned points would be good also.

    Read the article

  • pushing view controller inside a tab bar from app delegate, after a notification.

    - by shani
    hi i have an app with tab bar and a navigation controller inside every tab. i have set a notification that when it lunches the user can get lunch the app by pressing the action on the alert. i want to redirect the user to one of the views inside one of the controllers. i have tried this: (void)application:(UIApplication *)app didReceiveLocalNotification:(UILocalNotification *)notif { NSArray *data = [notif.userInfo objectForKey:@"todoDate"]; NSInteger ind = [[data objectAtIndex:2] integerValue]; QuickViewController *detailViewController ; detailViewController = [[QuickViewController alloc] initWithNibName:@"QuickViewController" bundle:nil]; detailViewController.title = @"Edit"; detailViewController.personName = [data objectAtIndex:0]; detailViewController.DelitionDate=[data objectAtIndex:1]; detailViewController.personCategory=@"NO Category"; detailViewController.personID = ind r ; rootControler.selectedIndex = 1; [rootControler.tabBarController.selectedViewController.navigationController pushViewController:detailViewController animated:YES]; } but nothing is happening (no crashing) except of the :rootControler.selectedIndex = 1; when i tried : presentModalViewController i got the view perfectly but without the navigation controller. thanks shani

    Read the article

  • Way to store a large dictionary with low memory footprint + fast lookups (on Android)

    - by BobbyJim
    I'm developing an android word game app that needs a large (~250,000 word dictionary) available. I need: reasonably fast look ups e.g. constant time preferable, need to do maybe 200 lookups a second on occasion to solve a word puzzle and maybe 20 lookups within 0.2 second more often to check words the user just spelled. EDIT: Lookups are typically asking "Is in the dictionary?". I'd like to support up to two wildcards in the word as well, but this is easy enough by just generating all possible letters the wildcards could have been and checking the generated words (i.e. 26 * 26 lookups for a word with two wildcards). as it's a mobile app, using as little memory as possible and requiring only a small initial download for the dictionary data is top priority. My first naive attempts used Java's HashMap class, which caused an out of memory exception. I've looked into using the SQL lite databases available on android, but this seems like overkill. What's a good way to do what I need?

    Read the article

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Strange problem with simple multithreading program in Java

    - by Elizabeth
    Hello, I am just starting play with multithreading programming. I would like to my program show alternately character '-' and '+' but it doesn't. My task is to use synchronized keyword. As far I have: class FunnyStringGenerator{ private char c; public FunnyStringGenerator(){ c = '-'; } public synchronized char next(){ if(c == '-'){ c = '+'; } else{ c = '-'; } return c; } } class ThreadToGenerateStr implements Runnable{ FunnyStringGenerator gen; public ThreadToGenerateStr(FunnyStringGenerator fsg){ gen = fsg; } @Override public void run() { for(int i = 0; i < 10; i++){ System.out.print(gen.next()); } } } public class Main{ public static void main(String[] args) throws IOException { FunnyStringGenerator FSG = new FunnyStringGenerator(); ExecutorService exec = Executors.newCachedThreadPool(); for(int i = 0; i < 20; i++){ exec.execute(new ThreadToGenerateStr(FSG)); } } } EDIT: I also testing Thread.sleep in run method instead for loop.

    Read the article

  • Editable, growable DataGrid that retains values on postback and updates underlying DataTable

    - by jlstrecker
    I'm trying to create an ASP.NET/C# page that allows the user to edit a table of data, add rows to it, and save the data back to the database. For the table of data, I'm using a DataGrid whose cells contain TextBoxes or CheckBoxes. I have a button for adding rows (which works) and a button for saving the data. However, I'm quite stuck on two things: The TextBoxes and CheckBoxes should retain their values on postback. So if the user edits a TextBox and clicks the button to add more rows, the edits should be retained when the page reloads. However, the edits should not be saved to the database at this point. When the user clicks the save button, or anytime before, the DataTable underlying the DataGrid needs to be updated with the values of the TextBoxes and CheckBoxes so that the DataTable can be sent to the database. I have a method that does this, but I can't figure out when to call it. Any help getting this to work, or suggestions of alternative user interfaces that would behave similarly, would be appreciated.

    Read the article

  • Should I use IDisposable for purely managed resources?

    - by John Gietzen
    Here is the scenario: I have an object called a Transaction that needs to make sure that only one entity has permission to edit it at any given time. In order to facilitate a long-lived lock, I have the class generating a token object that can be used to make the edits. You would use it like this: var transaction = new Transaction(); using (var tlock = transaction.Lock()) { transaction.Update(data, tlock); } Now, I want the TransactionLock class to implement IDisposable so that its usage can be clear. But, I don't have any unmanaged resources to dispose. however, the TransctionLock object itself is a sort of "unmanaged resource" in the sense that the CLR doesn't know how to properly finalize it. All of this would be fine and dandy, I would just use IDisposable and be done with it. However, my issue comes when I try to do this in the finalizer: ~TransactionLock() { this.Dispose(false); } I want the finalizer to release the transaction from the lock, if possible. How, in the finalizer, do I detect if the parent transaction (this.transaction) has already been finalized? Is there a better pattern I should be using? The Transaction class looks something like this: public sealed class Transaction { private readonly object lockMutex = new object(); private TransactionLock currentLock; public TransactionLock Lock() { lock (this.lockMutex) { if (this.currentLock != null) throw new InvalidOperationException(/* ... */); this.currentLock = new TransactionLock(this); return this.currentLock; } } public void Update(object data, TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); // ... } } internal void ValidateLock(TransactionLock tlock) { if (this.currentLock == null) throw new InvalidOperationException(/* ... */); if (this.currentLock != tlock) throw new InvalidOperationException(/* ... */); } internal void Unlock(TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); this.currentLock = null; } } }

    Read the article

  • Modifying C# dictionary value

    - by minjang
    I'm a C++ expert, but not at all for C#. I created a Dictionary<string, STATS>, where STATS is a simple struct. Once I built the dictionary with initial string and STATS pairs, I want to modify the dictionary's STATS value. In C++, it's very clear: Dictionary<string, STATS*> benchmarks; Initialize it... STATS* stats = benchmarks[item.Key]; // Touch stats directly However, I tried like this in C#: Dictionary<string, STATS> benchmarks = new Dictionary<string, STATS>(); // Initialize benchmarks with a bunch of STATS foreach (var item in _data) benchmarks.Add(item.app_name, item); foreach (KeyValuePair<string, STATS> item in benchmarks) { // I want to modify STATS value inside of benchmarks dictionary. STATS stat_item = benchmarks[item.Key]; ParseOutputFile("foo", ref stat_item); // But, not modified in benchmarks... stat_item is just a copy. } This is a really novice problem, but wasn't easy to find an answer. EDIT: I also tried like the following: STATS stat_item = benchmarks[item.Key]; ParseOutputFile(file_name, ref stat_item); benchmarks[item.Key] = stat_item; However, I got the exception since such action invalidates Dictionary: Unhandled Exception: System.InvalidOperationException: Collection was modified; enumeration operation may not execute. at System.ThrowHelper.ThrowInvalidOperationException(ExceptionResource resource) at System.Collections.Generic.Dictionary`2.Enumerator.MoveNext() at helper.Program.Main(String[] args) in D:\dev\\helper\Program.cs:line 75

    Read the article

< Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >