Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 618/750 | < Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >

  • How do I ensure a Flex dataProvider processes the data synchronously?

    - by Matt Calthrop
    I am using an component, and currently have a dataProvider working that is an ArrayCollection (have a separate question about how to make this an XML file... but I digress). Variable declaration looks like this: [Bindable] private var _dpImageList : ArrayCollection = new ArrayCollection([ {"location" : "path/to/image1.jpg"}, {"location" : "path/to/image2.jpg"}, {"location" : "path/to/image3.jpg"} ]); I then refer to like this: <s:List id="lstImages" width="100%" dataProvider="{_dpImageList}" itemRenderer="path.to.render.ImageRenderer" skinClass="path.to.skins.ListSkin" > <s:layout> <s:HorizontalLayout gap="2" /> </s:layout> </s:List> Currently, it would appear that each item is processed asynchronously. However, I want them to be processed synchronously. Reason: I am displaying a list of images, and I want the leftmost one rendered first, followed by the one to its right, and so on. Edit: I just found this answer. Do you think that could be the same issue?

    Read the article

  • Loading specific icon size into TIcon from stream (Delphi XE)

    - by moodforaday
    My application downloads and displays favicons for specific websites. I followed Bing's solution for detecting image format from stream, but have hit another snag. Assuming an actual icon image, the code goes like this: var icon : TIcon; begin icon := TIcon.Create; try icon.LoadFromStream( faviconStream ); spFavicon.Glyph.Assign( icon ); finally icon.Free; end; end; (spFavicon is TRzGlyphStatus from Raize Components. Its Glyph property is a TBitmap) Now, this works, but sometimes the downloaded icon contains multiple images in different sizes, e.g. 32x32 in addition to the expected 16x16. For some reason the control's Glyph property picks the larger size. How can I load only the 16x16 size into TIcon, or from TIcon into TBitmap? Test favicon: http://www.kpfa.org/favicon.ico On edit: If at all possible, I'd rather avoid saving the icon to a file first.

    Read the article

  • jQuery AJAX Redirection problem

    - by meosoft
    Hello please consider this: On page A I have a link that takes you to page B when JS is off, but when JS is on, I want to replace content on current page with content from the page B. Pages A and B are in fact the same script that is able to tell AJAX calls from regular ones and serve the content appropriately. Everything works fine, as long as there are no redirects involved. But, sometimes there is a 301 redirect and what seems to be happening is that client browser then makes a second request, which will return with a 200 OK. Only the second request is sent without a X-Requested-With header, therefore I cannot tell within my script wether it came from AJAX or not, and will send a complete page instead of just the content. I have tried checking for 301 status code in my error, success, and complete handlers but none of them worked. It seems to be handling the 301 behind the scenes. Could anyone help me with this? jQuery 1.4, PHP 5 Edit: People requested the code to this, which I didn't think was necessary but here goes: // hook up menu ajax loading $('#menu a').live("click", function(){ // update menu highlight if($(this).parents('#menu').size() > 0){ $("#menu>li").removeClass("current_page_item"); $(this).parent().addClass("current_page_item"); } // get the URL where we will be retrieving content from var url = $(this).attr('href'); window.location.hash = hash = url; $.ajax({ type: "GET", url: url, success: function(data){ // search for an ID that is only present if page is requested directly if($(data).find('#maincontent').size() > 0){ data = $(data).find('#maincontent .content-slide *').get(); } // the rest is just animating the content into view $("#scroller").html(data); $('.content-slide').each(setHeight); $('.content-slide').animate({ left: "0px" }, 1000, 'easeOutQuart', function(){ $('#home').css("left", "-760px").html(data); $('#scroller').css("left", "-760px"); $('.content-slide').each(setHeight); } ); } }); return false; });

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • SSIS - Skip Missing Files

    - by Greg
    I have a SSIS 2008 package that calls about 10 other SSIS packages (legacy issues, don't ask). Each of those child packages loads a specific file into a table. But sometimes one or more of these input files will be missing. How can I let a child package fail (because a file is missing) but let the rest of the parent package keep on running? I've tried increasing the maximum error count on the parent package, the tasks in the parent package that call each child, and in the child package itself. None of that seemed to make any difference. I still get this error when I run it with a file missing: SSIS Warning Code DTS_W_MAXIMUMERRORCOUNTREACHED. The Execution method succeeded, but the number of errors raised (2) reached the maximum allowed (1); resulting in failure. This occurs when the number of errors reaches the number specified in MaximumErrorCount. Change the MaximumErrorCount or fix the errors. Edit: failpackageonfailure and faulparentonfailure are already all set to false everywhere.

    Read the article

  • Database design: Calculating the Account Balance

    - by 001
    How do I design the database to calculate the account balance? 1) Currently I calculate the account balance from the transaction table In my transaction table I have "description" and "amount" etc.. I would then add up all "amount" values and that would work out the user's account balance. I showed this to my friend and he said that is not a good solution, when my database grows its going to slow down???? He said I should create separate table to store the calculated account balance. If did this, I will have to maintain two tables, and its risky, the account balance table could go out of sync. Any suggestion? EDIT: OPTION 2: should I add an extra column to my transaction tables "Balance". now I do not need to go through many rows of data to perform my calculation. Example John buys $100 credit, he debt $60, he then adds $200 credit. Amount $100, Balance $100. Amount -$60, Balance $40. Amount $200, Balance $240.

    Read the article

  • How to find an embedded platform?

    - by gmagana
    I am new to the locating hardware side of embedded programming and so after being completely overwhelmed with all the choices out there (pc104, custom boards, a zillion option for each board, volume discounts, devel kits, ahhh!!) I am asking here for some direction. Basically, I must find a new motherboard and (most likely) re-implement the program logic. Rewriting this in C/C++/Java/C#/Pascal/BASIC is not a problem for me. so my real problem is finding the hardware. This motherboard will have several other devices attached to it. Here is a summary of what I need to do: Required: 2 RS232 serial ports (one used all the time for primary UI, the second one not continuous) 1 modem (9600+ baud ok) [Modem will be in simultaneous use with only one of the serial port devices, so interrupt sharing with one serial port is OK, but not both] Minimum permanent/long term storage: Whatever O/S requires + 1 MB (executable) + 512 KB (Data files) RAM: Minimal, whatever the O/S requires plus maybe 1MB for executable. Nice to have: USB port(s) Ethernet network port Wireless network Implementation languages (any O/S I will adapt to): First choice Java/C# (Mono ok) Second choice is C/Pascal Third is BASIC Ok, given all this, I am having a lot of trouble finding hardware that will support this that is low in cost. Every manufacturer site I visit has a lot of options, and it's difficult to see if their offering will even satisfy my must-have requirements (for example they sometimes list 3 "serial ports", but it appears that only one of the three is RS232, for example, and don't mention what the other two are). The #1 constraint is cost, #2 is size. Can anyone help me with this? This little task has left me thinking I should have gone for EE and not CS :-). EDIT: A bit of background: This is a system currently in production, but the original programmer passed away, and the current hardware manufacturer cannot find hardware to run the (currently) DOS system, so I need to reimplement this in a modern platform. I can only change the programming and the motherboard hardware.

    Read the article

  • Reporting Services "cannot connect to the report server database"

    - by Dano
    We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

    Read the article

  • Castle, sharing a transient component between a decorator and a decorated component

    - by Marius
    Consider the following example: public interface ITask { void Execute(); } public class LoggingTaskRunner : ITask { private readonly ITask _taskToDecorate; private readonly MessageBuffer _messageBuffer; public LoggingTaskRunner(ITask taskToDecorate, MessageBuffer messageBuffer) { _taskToDecorate = taskToDecorate; _messageBuffer = messageBuffer; } public void Execute() { _taskToDecorate.Execute(); Log(_messageBuffer); } private void Log(MessageBuffer messageBuffer) {} } public class TaskRunner : ITask { public TaskRunner(MessageBuffer messageBuffer) { } public void Execute() { } } public class MessageBuffer { } public class Configuration { public void Configure() { IWindsorContainer container = null; container.Register( Component.For<MessageBuffer>() .LifeStyle.Transient); container.Register( Component.For<ITask>() .ImplementedBy<LoggingTaskRunner>() .ServiceOverrides(ServiceOverride.ForKey("taskToDecorate").Eq("task.to.decorate"))); container.Register( Component.For<ITask>() .ImplementedBy<TaskRunner>() .Named("task.to.decorate")); } } How can I make Windsor instantiate the "shared" transient component so that both "Decorator" and "Decorated" gets the same instance? Edit: since the design is being critiqued I am posting something closer to what is being done in the app. Maybe someone can suggest a better solution (if sharing the transient resource between a logger and the true task is considered a bad design)

    Read the article

  • C++ - passing references to boost::shared_ptr

    - by abigagli
    If I have a function that needs to work with a shared_ptr, wouldn't it be more efficient to pass it a reference to it (so to avoid copying the shared_ptr object)? What are the possible bad side effects? I envision two possible cases: 1) inside the function a copy is made of the argument, like in ClassA::take_copy_of_sp(boost::shared_ptr<foo> &sp) { ... m_sp_member=sp; //This will copy the object, incrementing refcount ... } 2) inside the function the argument is only used, like in Class::only_work_with_sp(boost::shared_ptr<foo> &sp) //Again, no copy here { ... sp->do_something(); ... } I can't see in both cases a good reason to pass the boost::shared_ptr by value instead of by reference. Passing by value would only "temporarily" increment the reference count due to the copying, and then decrement it when exiting the function scope. Am I overlooking something? Andrea. EDIT: Just to clarify, after reading several answers : I perfectly agree on the premature-optimization concerns, and I alwasy try to first-profile-then-work-on-the-hotspots. My question was more from a purely technical code-point-of-view, if you know what I mean.

    Read the article

  • Jquery click event propagation

    - by ozsenegal
    I've a table with click events bind to it rows (tr). Also,there're A elements with it owns click events assigned inside those rows. Problem is when i click on A element,it also fires click event from TD.And Im dont want this behavior,i just want to fire A click's event. Code: //Event row TR $("tr:not(:first)").click(function(){ $(".window,.backFundo,.close").remove(); var position = $(this).offset().top; position = position < 0 ? 20 : position; $("body").append($("<div></div>").addClass("backFundo")); $("body").append($("<div></div>").addClass("window").html("<span class=close><img src=Images/close.png id=fechar /></span>").append("<span class=titulo>O que deseja fazer?</span><span class=crud><a href=# id=edit>Editar</a></span><span class=crud><a href=# id=delete codigo=" + $(this).children("td:first").html() + ">Excluir</a></span>").css({top:"20px"}).fadeIn("slow")); $(document).scrollTop(0); }); //Element event $("a").live("click",function(){alert("clicked!");}); Whenever you click the anchor it fires event from it parent row.Any ideas?

    Read the article

  • iOS - Passing variable to view controller

    - by gj15987
    I have a view with a view controller and when I show this view on screen, I want to be able to pass variables to it from the calling class, so that I can set the values of labels etc. First, I just tried creating a property for one of the labels, and calling that from the calling class. For example: SetTeamsViewController *vc = [[SetTeamsViewController alloc] init]; vc.myLabel.text = self.teamCount; [self presentModalViewController:vc animated:YES]; [vc release]; However, this didn't work. So I tried creating a convenience initializer. SetTeamsViewController *vc = [[SetTeamsViewController alloc] initWithTeamCount:self.teamCount]; And then in the SetTeamsViewController I had - (id)initWithTeamCount:(int)teamCount { self = [super initWithNibName:nil bundle:nil]; if (self) { // Custom initialization self.teamCountLabel.text = [NSString stringWithFormat:@"%d",teamCount]; } return self; } However, this didn't work either. It's just loading whatever value I've given the label in the nib file. I've littered the code with NSLog()s and it is passing the correct variable values around, it's just not setting the label. Any help would be greatly appreciated. EDIT: I've just tried setting an instance variable in my designated initializer, and then setting the label in viewDidLoad and that works! Is this the best way to do this? Also, when dismissing this modal view controller, I update the text of a button in the view of the calling ViewController too. However, if I press this button again (to show the modal view again) whilst the other view is animating on screen, the button temporarily has it's original value again (from the nib). Does anyone know why this is?

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to keep activity on Force Close?

    - by SushiRoll
    I have this piece of code that's really prone to errors so I wrapped it with try{}catch statement. I don't want to go back to the previous activity, I just want it to stay on the current activity so that the user can edit whatever is wrong with them. How do I implement this? try{ orgi.insertOrThrow(tableName, null, values); Toast.makeText(this, "You have successfully created a new profile!", 2).show(); gotoProfileList(); Log.e(getClass().getSimpleName(),"Successfully added to database"); }catch(SQLiteException se){ Log.e(getClass().getSimpleName(), "Database connection failed!" + se); //Stay in this activity... }finally{ if (orgi != null){ orgi.close(); } } Forget it, I was able to solve my own problem by showing up an alertDialog that tells the user about the error. Thanks anyways. :) try{ orgi.insertOrThrow(tableName, null, values); Toast.makeText(this, "You have successfully created a new profile!", 2).show(); gotoProfileList(); Log.e(getClass().getSimpleName(),"Successfully added to database"); }catch(SQLiteException se){ Log.e(getClass().getSimpleName(), "Database connection failed!" + se); displayError(); //stayInThisActivity(); }finally{ if (orgi != null){ orgi.close(); } public void displayError(){ AlertDialog.Builder error = new AlertDialog.Builder(this); error.setMessage("That profile name already exists, try another one.").setCancelable(false).setPositiveButton("Yes",new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { dialog.cancel(); } }); AlertDialog alert = error.create(); alert.setTitle("Error"); alert.show(); }

    Read the article

  • How to send Event signal through Processes - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. I'm trying to work out how the other process will know of the event being fired so it can do the tasks it needs to do, I don't understand how one process that is separate from another can tell what the states the events are in especially as it needs to act as soon as the event has changed state. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

    Read the article

  • Using a "take-home" coding component in interview process

    - by Jeff Sargent
    In recent interviews I have been asking candidates to code through some questions on the whiteboard. I don't feel I'm getting a clear enough picture of the candidates technical ability with this approach. Granted, the questions might not be good enough, maybe the interview needs to be longer, etc, but I'm wondering if a different approach would be better. What I'd like to try is to create a simple, working project in Visual Studio and have it checked into source control. The candidate can check that code out from home/wherever and then check back in work representing their response to the assignment that I'll provide. I'm thinking that if the window of time is short enough and the assignment clear enough then the solution will be safe enough from all-out Googling (i.e. they couldn't search for and find the entire solution online). I would then be able to review the candidates work. Has enough worked with something like this before, either to vet a candidate or as a candidate yourself? Any thoughts in general? P.S. my first StackOverflow question - hi guys and gals. EDIT: I've seen comments about asking someone to work for free - I wouldn't mind paying the person for their time.

    Read the article

  • Visitor Pattern can be replaced with Callback functions?

    - by getit
    Is there any significant benefit to using either technique? In case there are variations, the Visitor Pattern I mean is this: http://en.wikipedia.org/wiki/Visitor_pattern And below is an example of using a delegate to achieve the same effect (at least I think it is the same) Say there is a collection of nested elements: Schools contain Departments which contain Students Instead of using the Visitor pattern to perform something on each collection item, why not use a simple callback (Action delegate in C#) Say something like this class Department { List Students; } class School { List Departments; VisitStudents(Action<Student> actionDelegate) { foreach(var dep in this.Departments) { foreach(var stu in dep.Students) { actionDelegate(stu); } } } } School A = new School(); ...//populate collections A.Visit((student)=> { ...Do Something with student... }); *EDIT Example with delegate accepting multiple params Say I wanted to pass both the student and department, I could modify the Action definition like so: Action class School { List Departments; VisitStudents(Action<Student, Department> actionDelegate, Action<Department> d2) { foreach(var dep in this.Departments) { d2(dep); //This performs a different process. //Using Visitor pattern would avoid having to keep adding new delegates. //This looks like the main benefit so far foreach(var stu in dep.Students) { actionDelegate(stu, dep); } } } }

    Read the article

  • Is it safe to read regular expressions from a file?

    - by Zilk
    Assuming a Perl script that allows users to specify several text filter expressions in a config file, is there a safe way to let them enter regular expressions as well, without the possibility of unintended side effects or code execution? Without actually parsing the regexes and checking them for problematic constructs, that is. There won't be any substitution, only matching. As an aside, is there a way to test if the specified regex is valid before actually using it? I'd like to issue warnings if something like /foo (bar/ was entered. Thanks, Z. EDIT: Thanks for the very interesting answers. I've since found out that the following dangerous constructs will only be evaluated in regexes if the use re 'eval' pragma is used: (?{code}) (??{code}) ${code} @{code} The default is no re 'eval'; so unless I'm missing something, it should be safe to read regular expressions from a file, with the only check being the eval/catch posted by Axeman. At least I haven't been able to hide anything evil in them in my tests. Thanks again. Z.

    Read the article

  • Type errors when using same name

    - by lykimq
    I have 3 files: 1) cpf0.ml type string = char list type url = string type var = string type name = string type symbol = | Symbol_name of name 2) problem.ml: type symbol = | Ident of string 3) test.ml open Problem;; open Cpf0;; let symbol b = function | Symbol_name n -> Ident n When I combine test.ml: ocamlc -c test.ml. I received an error: This expression has type Cpf0.name = char list but an expression was expected of type string Could you please help me to correct it? Thank you very much EDIT: Thank you for your answer. I want to explain more about these 3 files: Because I am working with extraction in Coq to Ocaml type: cpf0.ml is generated from cpf.v : Require Import String. Definition string := string. Definition name := string. Inductive symbol := | Symbol_name : name -> symbol. The code extraction.v: Set Extraction Optimize. Extraction Language Ocaml. Require ExtrOcamlBasic ExtrOcamlString. Extraction Blacklist cpf list. where ExtrOcamlString I opened: open Cpf0;; in problem.ml, and I got a new problem because in problem.ml they have another definition for type string This expression has type Cpf0.string = char list but an expression was expected of type Util.StrSet.elt = string Here is a definition in util.ml defined type string: module Str = struct type t = string end;; module StrOrd = Ord.Make (Str);; module StrSet = Set.Make (StrOrd);; module StrMap = Map.Make (StrOrd);; let set_add_chk x s = if StrSet.mem x s then failwith (x ^ " already declared") else StrSet.add x s;; I was trying to change t = string to t = char list, but if I do that I have to change a lot of function it depend on (for example: set_add_chk above). Could you please give me a good idea? how I would do in this case.

    Read the article

  • git changes modification time of files

    - by tanascius
    In the GitFaq I can read, that Git sets the current time as the timestamp on every file it modifies, but only those. However, I tried this command sequence (EDIT: added complete command sequence) $ git init test && cd test Initialized empty Git repository in d:/test/.git/ exxxxxxx@wxxxxxxx /d/test (master) $ touch filea fileb exxxxxxx@wxxxxxxx /d/test (master) $ git add . exxxxxxx@wxxxxxxx /d/test (master) $ git commit -m "first commit" [master (root-commit) fcaf171] first commit 0 files changed, 0 insertions(+), 0 deletions(-) create mode 100644 filea create mode 100644 fileb exxxxxxx@wxxxxxxx /d/test (master) $ ls -l > filea exxxxxxx@wxxxxxxx /d/test (master) $ touch fileb -t 200912301000 exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 1 -rw-r--r-- 1 exxxxxxx Administ 132 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Dec 30 10:00 fileb exxxxxxx@wxxxxxxx /d/test (master) $ git status -a warning: LF will be replaced by CRLF in filea # On branch master warning: LF will be replaced by CRLF in filea # Changes to be committed: # (use "git reset HEAD <file>..." to unstage) # # modified: filea # exxxxxxx@wxxxxxxx /d/test (master) $ git checkout . exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 0 -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 fileb Now my question: Why did git change the timestamp of file fileb? I'd expect the timestamp to be unchanged. Are my commands causing a problem? Maybe it is possible to do something like a git checkout . --modified instead? I am using git version 1.6.5.1.1367.gcd48 under mingw32/windows xp.

    Read the article

  • Problems updating a textBox ASP.NET

    - by Roger Filipe
    Hello, I'm starting in asp.net and am having some problems that I do not understand. The problem is this, I am building a site for news. Every news has a title and body. I have a page where I can insert news, this page uses a textbox for each of the fields (title and body), after clicking the submit button everything goes ok and saves the values in the database. And o have another page where I can read the news, I use labels for each of the camps, these labels are defined in the Page_Load. Now I'm having problems on the page where I can edit the news. I am loading two textboxes (title and body) in the Page_Load, so far so good, but then when I change the text and I click the submit button, it ignores the changes that I made in the text and saves the text loaded in Page_Load. This code doesn't show any database connection but you can understand what i'm talking about. protected void Page_Load(object sender, EventArgs e) { textboxTitle.Text = "This is the title of the news"; textboxBody.Text = "This is the body of the news "; } I load the page, make the changes in the text , and then click submit. protected void btnSubmit_Click(object sender, EventArgs e) { String title = textboxTitle.Text; String body = textboxBody.Text; Response.Write("Title: " + title + " || "); Response.Write("Body: " + body ); } Nothing happens, the text in the textboxes is always the one I loaded in the page_load, how do I update the Text in the textboxes?

    Read the article

  • Help me clean up this crazy lambda with the out keyword

    - by Sarah Vessels
    My code looks ugly, and I know there's got to be a better way of doing what I'm doing: private delegate string doStuff( PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt ); private bool tryEncryptPassword( doStuff encryptPassword, out string errorMessage ) { ...get some variables... string encryptedPassword = encryptPassword(encrypter, publicKey, privateKey, out salt); ... } This stuff so far doesn't bother me. It's how I'm calling tryEncryptPassword that looks so ugly, and has duplication because I call it from two methods: public bool method1(out string errorMessage) { string rawPassword = "foo"; return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 1 rawPassword, publicKey, privateKey, out salt ), out errorMessage ); } public bool method2(SecureString unencryptedPassword, out string errorMessage) { return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 2 unencryptedPassword, publicKey, privateKey, out salt ), out errorMessage ); } Two parts to the ugliness: I have to explicitly list all the parameter types in the lambda expression because of the single out parameter. The two overloads of EncryptPasswordAndDoStuff take all the same parameters except for the first parameter, which can either be a string or a SecureString. So method1 and method2 are pretty much identical, they just call different overloads of EncryptPasswordAndDoStuff. Any suggestions? Edit: if I apply Jeff's suggestions, I do the following call in method1: return tryEncryptPassword( (encrypter, publicKey, privateKey) => { var result = new EncryptionResult(); string salt; result.EncryptedValue = encrypter.EncryptPasswordAndDoStuff( rawPassword, publicKey, privateKey, out salt ); result.Salt = salt; return result; }, out errorMessage ); Much the same call is made in method2, just with a different first value to EncryptPasswordAndDoStuff. This is an improvement, but it still seems like a lot of duplicated code.

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • How can I receive mouse events when a wrapped control has set capture?

    - by Greg
    My WndProc isn't seeing mouse-up notifications when I click with a modifier key (shift or control) pressed. I see them without the modifier key, and I see mouse-down notifications with the modifier keys. I'm trying to track user actions in a component I didn't write, so I'm using the Windows Forms NativeWindow wrapper (wrapping the component) to get Windows messages from the WndProc() method. I've tried tracking the notifications I do get, and I the only clue I see is WM_CAPTURECHANGED. I've tried calling SetCapture when I receive the WM_LBUTTONDOWN message, but it doesn't help. Without modifier (skipping paint, timer and NCHITTEST messages): WM_PARENTNOTIFY WM_MOUSEACTIVATE WM_MOUSEACTIVATE WM_SETCURSOR WM_LBUTTONDOWN WM_SETCURSOR WM_MOUSEMOVE WM_SETCURSOR WM_LBUTTONUP With modifier (skipping paint, timer and NCHITTEST messages): WM_KEYDOWN WM_PARENTNOTIFY WM_MOUSEACTIVATE WM_MOUSEACTIVATE WM_SETCURSOR WM_LBUTTONDOWN WM_SETCURSOR (repeats) WM_KEYDOWN (repeats) WM_KEYUP If I hold the mouse button down for a long time, I can usually get a WM_LBUTTONUP notification, but it should be possible to make it more responsive.. Edit: I've tried control-clicking outside of the component of interest and moving the cursor into it before releasing the mouse button, and then I do get a WM_LBUTTONUP notification, so it looks like the component is capturing the mouse on mouse-down. Is there any way to receive that notification when another window has captured the mouse? Thanks.

    Read the article

< Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >