Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 620/750 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

• What issues might I have in opening .NET 2.0 Projects in Visual Studio 2010?

  - by Ben McCormack

  The small software team I work on recently got approved to upgrade to Visual Studio 2010 (we're currently using VS 2005). We have several ASP.NET 2.0 and WinForms (in .NET 2.0) projects in production. I've been tasked with downloading VS 2010 and seeing how well it plays with our current projects. What issues should I be aware of when targeting older applications in VS 2010? If I open a VS 2005 project in VS 2010, will it still place nicely when my teammate goes back to open the project in VS 2005? Will we have to upgrade projects to work in VS 2010 (assuming the projects themselves aren't upgraded to .NET 4)? Can I use VS 2010 to edit legacy VB6 apps (just kidding)? I'm excited to work with the newest software, but we're concerned about running into development snags on production applications that are already working just fine. NOTE: I started a bounty in hopes of getting a more detailed answer to this question. Perhaps the answer really is as simple as those already provided, but I'm interested in more feedback regarding our options to transition from using VS 2005 to VS 2010.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Unit testing a Grails custom taglib based on built-in Grails taglib

  - by dipess

  I've an app based on Grails 1.3.7. And I need to write a unit test for a custom taglib that is based on the built-in taglib, <g:select /> to be specific. I checked out the solution on this previous SO post but the solution stated is not working in my case (some properties are not being prooperly mocked up). The other solution that I found was this. Using this approach, I get most of the properties of FormTagLib mocked up except for the grailsApplication property that select requires. The actual error that I get is Cannot invoke method getArtefact() on null object. How can I properly write the unit test in such a case? Edit Here are my test class and the full stacktrace. Line #45 on the stacktrace is the call to the g.select from my custom taglib. My custom taglib is something like def clientSpecificQueues = {attrs-> def queueList = taskService.getClientSpecificQueues(session.clientName) def queueLabel = "Some String" if (queueList.size() > 0){ out << queueLabel else out << g.select(name:'queueId', from: queueList, optionKey: 'id', optionValue: 'name') }

  Read the article

• How to efficiently store and update binary data in Mongodb?

  - by Rocketman

  I am storing a large binary array within a document. I wish to continually add bytes to this array and sometimes change the value of existing bytes. I was looking for some $append_bytes and $replace_bytes type of modifiers but it appears that the best I can do is $push for arrays. It seems like this would be doable by performing seek-write type operations if I had access somehow to the underlying bson on disk, but it does not appear to me that there is anyway to do this in mongodb (and probably for good reason). If I were instead to just query this binary array, edit or add to it, and then update the document by rewriting the entire field, how costly will this be? Each binary array will be on the order of 1-2MB, and updates occur once every 5 minutes and across 1000s of documents. Worse, yet there is no easy way to spread these out (in time) and they will usually be happening close to one another on the 5 minute intervals. Does anyone have a good feel for how disastrous this will be? Seems like it would be problematic. An alternative would be to store this binary data as separate files on disk, implement a thread pool to efficiently manipulate the files on disk, and reference the filename from my mongodb document. (I'm using python and pymongo so I was looking at pytables). I'd prefer to avoid this though if possible. Is there any other alternative that I am overlooking here? Thanks in advnace.

  Read the article

• problem with enable/disable button using javascript

  - by LiveEn

  Im am trying to add a check box that will enable/disable the edit button. Im retrieving a price list and displaying it inside a table. When i add the javascript into the php code it doesn't work. Below is my code <table border="1"> <tr> <td width="100">Fee % </td> <td width="100">Price</td> <td width="100">Total</td> <td width="102">&nbsp;</td> </tr> <tr> <?php $sql1="select * from pricelist"; $result1=mysql_query($sql1) or die(mysql_error()); while ($row=mysql_fetch_array($result1)) { $id=$row['id']; $price=$row['h_price']; $a=0; print "<form id='form1' name='$a+' method='post' action=''>"; print "<td><input name='fees' value ='$fees' type='text' size='4' /></td>"; print "<td><input name='price' value ='$price' type='text' size='15' /></td>"; echo "<td><input type='checkbox' onclick='this.$a+.disabled = !this.checked;'><td>"; print"<td><input type='submit' name='$a+' value='Submit' disabled='disabled' /></td>"; print "</tr>"; print "</form>"; } ?> </table> Can someone please tell me what am i doing wrong? Thanks

  Read the article

• Project management and bundling dependencies

  - by Joshua

  I've been looking for ways to learn about the right way to manage a software project, and I've stumbled upon the following blog post. I've learned some of the things mentioned the hard way, others make sense, and yet others are still unclear to me. To sum up, the author lists a bunch of features of a project and how much those features contribute to a project's 'suckiness' for a lack of a better term. You can find the full article here: http://spot.livejournal.com/308370.html In particular, I don't understand the author's stance on bundling dependencies with your project. These are: == Bundling == Your source only comes with other code projects that it depends on [ +20 points of FAIL ] Why is this a problem, (especially given the last point)? If your source code cannot be built without first building the bundled code bits [ +10 points of FAIL ] Doesn't this necessarily have to be the case for software built against 3rd party libs? Your code needs that other code to be compiled into its library before the linker can work? If you have modified those other bundled code bits [ +40 points of FAIL ] If this is necessary for your project, then it naturally follows that you've bundled said code with yours. If you want to customize a build of some lib,say WxWidgets, you'll have to edit that projects build scripts to bulid the library that you want. Subsequently, you'll have to publish those changes to people who wish to build your code, so why not use a high level make script with the params already written in, and distribute that? Furthermore, (especially in a windows env) if your code base is dependent on a particular version of a lib (that you also need to custom compile for your project) wouldn't it be easier to give the user the code yourself (because in this case, it is unlikely that the user will already have the correct version installed)? So how would you respond to these comments, and what points may I be failing to take into consideration? Would you agree or disagree with the author's take (or mine), and why?

  Read the article

• Updating entity fields in app engine development server

  - by Joey

  I recently tried updating a field in one of my entities on the app engine local dev server via the sdk console. It appeared to have updated just fine (a simple float). However, when I followed up with a query on the entity, I received an exception: "Items in the mSomeList list must all be Key instances". mSomeList is just another list field I have in that entity, not the one I modified. Is there any reason manually changing a field would adversely throw something off such that the server gets confused? Is this a known bug? I wrote an http handler to alter the field through server code and it works fine if I take that approach. Update: (adding details) I am using the python google app engine server. Basically if I go into the Google App Engine Launcher and press the SDK Console button, then go into one of my entities and edit a field that is a float (i.e. change it from 0 to 3.5, for instance), I get the "Items in the mMyList list must all be Key instance" suddenly when I query the entity like this: query = DataModels.RegionData.gql("WHERE mRegion = :1", region) entry = query.get() the RegionData entity is what has the mMyList member. As mentioned previously, if I do not manually change the field but rather do so through server code, i.e. query = DataModels.RegionData.gql("WHERE mRegion = :1", region) entry = query.get() entry.mMyFloat = 3.5 entry.put() Then it works.

  Read the article

• Somewhat lost with jquery + php + json

  - by Luis Armando

  I am starting to use the jquery $.ajax() but I can't get back what I want to...I send this: $(function(){ $.ajax({ url: "graph_data.php", type: "POST", data: "casi=56&nada=48&nuevo=98&perfecto=100&vales=50&apenas=70&yeah=60", dataType: "json", error: function (xhr, desc, exceptionobj) { document.writeln("El error de XMLHTTPRequest dice: " + xhr.responseText); }, success: function (json) { if (json.error) { alert(json.error); return; } var output = ""; for (p in json) { output += p + " : " + json[p] + "\n"; } document.writeln("Results: \n\n" + output); } }); }); and my php is: <?php $data = $_POST['data']; function array2json($data){ $json = $data; return json_encode($json); } ?> and when I execute this I come out with: Results: just like that I used to have in the php a echo array2json statement but it just gave back gibberish...I really don't know what am I doing wrong and I've googled for about 3 hours just getting basically the same stuff. Also I don't know how to pass parameters to the "data:" in the $.ajax function in another way like getting info from the web page, can anyone please help me? Edit I did what you suggested and it prints the data now thank you very much =) however, I was wondering, how can I send the data to the "data:" part in jQuery so it takes it from let's say user input, also I was checking the php documentation and it says I'm allowed to write something like: json_encode($a,JSON_HEX_TAG|JSON_HEX_APOS|JSON_HEX_QUOT|JSON_HEX_AMP) however, if I do that I get an error saying that json_encode accepts 1 parameter and I'm giving 2...any idea why? I'm using php 5.2

  Read the article

• How do I implement aasm in Rails 3 for what I want it to do?

  - by marcamillion

  I am a Rails n00b and have been advised that in order for me to keep track of the status of my user's accounts (i.e. paid, unpaid (and therefore disabled), free trial, etc.) I should use an 'AASM' gem. So I found one that seems to be the most popular: https://github.com/rubyist/aasm But the instructions are pretty vague. I have a Users model and a Plan model. User's model manages everything you might expect (username, password, first name, etc.). Plan model manages the subscription plan that users should be assigned to (with the restrictions). So I am trying to figure out how to use the AASM gem to do what I want to do, but no clue where to start. Do I create a new model ? Then do I setup a relationship between my User model and the model for AASM ? How do I setup a relationship? As in, a user 'has_many' states ? That doesn't seem to make much sense to me. Any guidance would be really appreciated. Thanks. Edit: If anyone else is confused by AASMs like myself, here is a nice explanation of their function in Rails by the fine folks at Envy Labs: http://blog.envylabs.com/2009/08/the-rails-state-machine/ Edit2: How does this look: include AASM aasm_column :current_state aasm_state :paid aasm_state :free_trial aasm_state :disabled #this is for accounts that have exceed free trial and have not paid #aasm_state :free_acct aasm_event :pay do transitions :to => :paid, :from => [:free_trial, :disabled] transitions :to => :disabled, :from => [:free_trial, :paid] end

  Read the article

• How to read time from recorded surveillance camera video?

  - by stressed_geek

  I have a problem where I have to read the time of recording from the video recorded by a surveillance camera. The time shows up on the top-left area of the video. Below is a link to screen grab of the area which shows the time. Also, the digit color(white/black) keeps changing during the duration of the video. http://i55.tinypic.com/2j5gca8.png Please guide me in the direction to approach this problem. I am a Java programmer so would prefer an approach through Java. EDIT: Thanks unhillbilly for the comment. I had looked at the Ron Cemer OCR library and its performance is much below our requirement. Since the ocr performance is less than desired, I was planning to build a character set using the screen grabs for all the digits, and using some image/pixel comparison library to compare the frame time with the character-set which will show a probabilistic result after comparison. So I was looking for a good image comparison library(I would be OK with a non-java library which I can run using the command-line). Also any advice on the above approach would be really helpful.

  Read the article

• C# class can not disguise to be another class because GetType method cannot be override

  - by zinking

  there is a statement in the CLR via C# saying in C#, one class cannot disguise to be another, because GetType is virutal and thus it cannot be override but I think in C# we can still hide the parent implementation of GetType. I must missed something if I hide the base GetType implementation then I can disguise my class to be another class, is that correct? The key here is not whether GetType is virutal or not, the question is can we disguise one class to be another in C# Following is the NO.4 answer from the possible duplicate, so My question is more on this. is this kind of disguise possible, if so, how can we say that we can prevent class type disguise in C# ? regardless of the GetType is virtual or not While its true that you cannot override the object.GetType() method, you can use "new" to overload it completely, thereby spoofing another known type. This is interesting, however, I haven't figured out how to create an instance of the "Type" object from scratch, so the example below pretends to be another type. public class NotAString { private string m_RealString = string.Empty; public new Type GetType() { return m_RealString.GetType(); } } After creating an instance of this, (new NotAString()).GetType(), will indeed return the type for a string. share|edit|flag answered Mar 15 at 18:39 Dr Snooze 213 By almost anything that looks at GetType has an instance of object, or at the very least some base type that they control or can reason about. If you already have an instance of the most derived type then there is no need to call GetType on it. The point is as long as someone uses GetType on an object they can be sure it's the system's implementation, not any other custom definition. – Servy Mar 15 at 18:54 add comment

  Read the article

• pushing view controller inside a tab bar from app delegate, after a notification.

  - by shani

  hi i have an app with tab bar and a navigation controller inside every tab. i have set a notification that when it lunches the user can get lunch the app by pressing the action on the alert. i want to redirect the user to one of the views inside one of the controllers. i have tried this: (void)application:(UIApplication *)app didReceiveLocalNotification:(UILocalNotification *)notif { NSArray *data = [notif.userInfo objectForKey:@"todoDate"]; NSInteger ind = [[data objectAtIndex:2] integerValue]; QuickViewController *detailViewController ; detailViewController = [[QuickViewController alloc] initWithNibName:@"QuickViewController" bundle:nil]; detailViewController.title = @"Edit"; detailViewController.personName = [data objectAtIndex:0]; detailViewController.DelitionDate=[data objectAtIndex:1]; detailViewController.personCategory=@"NO Category"; detailViewController.personID = ind r ; rootControler.selectedIndex = 1; [rootControler.tabBarController.selectedViewController.navigationController pushViewController:detailViewController animated:YES]; } but nothing is happening (no crashing) except of the :rootControler.selectedIndex = 1; when i tried : presentModalViewController i got the view perfectly but without the navigation controller. thanks shani

  Read the article

• CakePHP Routes: Messing With The MVC

  - by thesunneversets

  So we have a real-estate-related site that has controller/action pairs like "homes/view", "realtors/edit", and so forth. From on high it has been deemed a good idea to refactor the site so that URLS are now in the format "/realtorname/homes/view/id", and perhaps also "/admin/homes/view/id" and/or "/region/..." As a mere CakePHP novice I'm finding it difficult to achieve this in routes.php. I can do the likes of: Router::connect('/:filter/h/:id', array('controller'=>'homes','action'=>'view')); Router::connect('/admin/:controller/:action/:id'); But I'm finding that the id is no longer being passed simply and elegantly to the actions, now that controller and action do not directly follow the domain. Therefore, questions: Is it a stupid idea to play fast and loose with the /controller/action format in this way? Is there a better way of stating these routes so that things don't break egregiously? Would we be better off going back to subdomains (the initial method of achieving this type of functionality, shot down on potentially spurious SEO-related grounds)? Many thanks for any advice! I'm sorry that I'm such a newbie that I don't know whether I'm asking stupid questions or not....

  Read the article

• UITableView superClass for delegate?

  - by fuzzygoat

  A quick question, I am setting a delegate for UITableView and I have a question regarding setting the delegate and dataSource properties. I have noticed that the properties for delegate and dataSource are not available, I was thinking that adopting the protocols would make them available. But I am now thinking that I maybe have the superclass for my delegate class wrong. Currently I have: -(void)viewDidLoad { TestDelegate *tempDelegate = [[TestDelegate alloc] init]; [self setMyDelegate:tempDelegate]; // setDelegate // setDataSource [tempDelegate release]; [super viewDidLoad]; } My interface for TestDelegate looks like: @interface TestDelegate : NSObject <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } Can I ask if the above should be: @interface TestDelegate : UITableView <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } gary EDIT: I think it might be right as NSObject, I have a viewtableView in IB, thats what I will need to connect my delegate class to. I added to tableView in IB so maybe I just need to make it available in Xcode.

  Read the article

• Replacing a unicode character in UTF-8 file using delphi 2010

  - by Jake Snake

  I am trying to replace character (decimal value 197) in a UTF-8 file with character (decimal value 65) I can load the file and put it in a string (may not need to do that though) SS := TStringStream.Create(ParamStr1, TEncoding.UTF8); SS.LoadFromFile(ParamStr1); //S:= SS.DataString; //ShowMessage(S); However, how do i replace all 197's with a 65, and save it back out as UTF-8? SS.SaveToFile(ParamStr2); SS.Free; -------------- EDIT ---------------- reader:= TStreamReader.Create(ParamStr1, TEncoding.UTF8); writer:= TStreamWriter.Create(ParamStr2, False, TEncoding.UTF8); while not Reader.EndOfStream do begin S:= reader.ReadLine; for I:= 1 to Length(S) do begin if Ord(S[I]) = 350 then begin Delete(S,I,1); Insert('A',S,I); end; end; writer.Write(S + #13#10); end; writer.Free; reader.Free;

  Read the article

• Two part question about submitting bluetooth-enabled apps for the iPhone

  - by Kyle

  I have a couple questions about submitting blue-tooth enabled apps on the iPhone. I want to first say that bluetooth is merely an option in the application. The application does not completely rely on bluetooth as there are many modes the user can go in. First, do they require you to have the "peer-peer" key set in UIRequiredDeviceCapabilities even if bluetooth interface options can be disabled or hidden for non-bluetooth enabled devices? Basically, it's just an OPTION in the game and there are many other modes the player can play.. Does Apple not allow you to do that? I'm just curious, because it seems like something they would do. Adding to that, how do you check for it's functionality at runtime? In essence, how do you check UIRequiredDeviceCapabilities at runtime. I'm aware of checking iPhone device types, so would that be a proper way of going about it? I'm also sort of unaware which devices can run bluetooth gamekit, there doesn't seem to be a proper reference at the SDK site, or I'm unable to find it. Thanks for reading! [edit] I can confirm the existance of somebody rejected for submitting a bluetooth enabled app which didn't work on a iPhone 2G.. Of course, they didn't say if that was the MAIN function of the app, though.

  Read the article

• Logging to a file on Android

  - by Greg B

  Is there any way of retrieving log messages from an Android handset. I'm building an application which uses the GPS of my HTC Hero. I can run and debug the application from eclipse but this isn't a good use case of GPS, sat at my desk. When I fire the app up when I am walking around, I get an intermittent exception. Is there anyway I can output these exceptions to a text file on the SD card or output calls to Log.x("") to a text file so that I can see what the exception is. Thanks EDIT : Solution Here is the code I finally went with... Thread.currentThread().setUncaughtExceptionHandler(new Thread.UncaughtExceptionHandler() { @Override public void uncaughtException(Thread thread, Throwable ex) { PrintWriter pw; try { pw = new PrintWriter( new FileWriter(Environment.getExternalStorageDirectory()+"/rt.log", true)); ex.printStackTrace(pw); pw.flush(); pw.close(); } catch (IOException e) { e.printStackTrace(); } } }); I had to wrap the line pw = new PrintWriter(new FileWriter(Environment.getExternalStorageDirectory()+"/rt.log", true)); in a try/catch as Eclipse would not let me compile the app. It kept saying Unhandled exception type IOException 1 quick fix Sorround with try/catch So I did and it all works which is fine by me but it does make me wonder what Eclipse was on about...

  Read the article

• SqlCeResultSet Problem

  - by Vlad

  Hello, I have a SmartDevice project (.NetCF 2.0) configured to be tested on the USA Windows Mobile 5.0 Pocket PC R2 Emulator. My project uses SqlCe 3.0. Understanding that a SmartDevice project is "more carefull" with the device's memory I am using SqlCeResultSets. The result sets are strongly typed, autogenerated by Visual Studio 2008 using the custom tool MSResultSetGenerator. The problem I am facing is that the result set does not recognize any column names. The autogenerated code for the fields does not work. In the client code I am using InfoResultSet rs = new InfoResultSet(); rs.Open(); rs.ReadFirst(); string myFormattedDate = rs.MyDateColumn.ToString("dd/MM/yyyy"); When the execution on the emulator reaches the rs.MyDateColumn the application throws an System.IndexOutOfRangeException. Investigating the stack trace at System.Data.SqlServerCe.FieldNameLookup.GetOrdinal() at System.Data.SqlServerCe.SqlCeDataReader.GetOrdinal() I've tested the GetOrdinal method (in my autogenerated class that inherits SqlCeResultSet): this.GetOrdinal("MyDateColumn"); // throws an exception this.GetName(1); // returns "MyDateColumn" this.GetOrdinal(this.GetName(1)); //throws an exception :) [edit added] The table exists and it's filled with data. Using typed DataSets works like a charm. Regenerating the SqlCeResultSet does not solve the issue, the problem remains. The problem basically is that I am not able to access a column by it's name. The data can be accessed trough this.GetDateTime(1)using the column ordinal. The application fails executing this.GetOrdinal("MyDateColumn"). Also I have updated Visual Studio 2008 to Service Pack 1. Additionaly I am developing the project on a virtual machine with Windows XP SP 2, but in my opinion if the medium is virtual or not should have no effect on the developing. Am I doing something wrong or am I missing something? Thank you.

  Read the article

• How to structure the tables of a very simple blog in MySQL?

  - by Programmer

  I want to add a very simple blog feature on one of my existing LAMP sites. It would be tied to a user's existing profile, and they would be able to simply input a title and a body for each post in their blog, and the date would be automatically set upon submission. They would be allowed to edit and delete any blog post and title at any time. The blog would be displayed from most recent to oldest, perhaps 20 posts to a page, with proper pagination above that. Other users would be able to leave comments on each post, which the blog owner would be allowed to delete, but not pre-moderate. That's basically it. Like I said, very simple. How should I structure the MySQL tables for this? I'm assuming that since there will be blog posts and comments, I would need a separate table for each, is that correct? But then what columns would I need in each table, what data structures should I use, and how should I link the two tables together (e.g. any foreign keys)? I could not find any tutorials for something like this, and what I'm looking to do is really offer my users the simplest version of a blog possible. No tags, no moderation, no images, no fancy formatting, etc. Just a simple diary-type, pure-text blog with commenting by other users.

  Read the article

• How to print contents from a session variable by looping in a foreach statement

  - by itsover9000

  im trying to write a code where can print and loop through the contents of my session variable by using a foreach statement here is my code <form class="form form-inline" method = "post" action="reportmaker.php"> <select name="rfield"> <option value="">--Select Field--</option> <?php $sc2=mysql_query("SELECT * from searchcolumn s left join report_fields r on s.scol_id=r.field_id where s.category != 'wh'"); foreach($sc2 as $sc){ ?> <option value="<?php echo $sc[advsearch_col]; ?>"><?php echo $sc[advsearch_name]; ?></option> <?php } ?> </select> <button type="submit" value = "submit" id="add" name="add" class="btn pull-right">Add More</button> </form> <?php if(isset($_POST['add'])) { $_SESSION['temp'][]=$_POST['rfield']; } if($_SESSION[temp][]!=""){ foreach($_SESSION[temp][] as $temp) { echo $temp; } } ?> the error that appears with this code is Fatal error: Cannot use [] for reading the line where the error is is this if($_SESSION[temp][]!=""){ i need to print the contents of the session array and this is the only way i know how is there a way to fix this? thanks =========EDIT thanks for the answers guys i finally got it

  Read the article

• How do I make a serialization class for this?

  - by chobo2

  I have something like this (sorry for the bad names) <root xmlns="http://www.domain.com" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.Domain.com Schema.xsd> <product></product> <SomeHighLevelElement> <anotherElment> <lowestElement> </lowestElement> </anotherElment> </SomeHighLevelElement> </root> I have something like this for my class public class MyClass { public MyClass() { ListWrapper= new List<UserInfo>(); } public string product{ get; set; } public List<SomeHighLevelElement> ListWrapper{ get; set; } } public class SomeHighLevelElement { public string lowestElement{ get; set; } } But I don't know how to write the code for the "anotherElement" not sure if I have to make another wrapper around it. Edit I know get a error in my actual xml file. I have this in my tag xmlns="http://www.domain.com" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.Domain.com Schema.xsd Throws an exception on the root line saying there was a error with this stuff. So I don't know if it is mad at the schemaLocation since I am using local host right now or what.

  Read the article

• Why doesn't java.util.Set have get(int index)?

  - by Marty Pitt

  I'm sure there's a good reason, but could someone please explain why the java.util.Set interface lacks get(int Index), or any similar get() method? It seems that sets are great for putting things into, but I can't find an elegant way of retrieving a single item from it. If I know I want the first item, I can use set.iterator().next(), but otherwise it seems I have to cast to an Array to retrieve an item at a specific index? What are the appropriate ways of retrieving data from a set? (other than using an iterator) I'm sure the fact that it's excluded from the API means there's a good reason for not doing this -- could someone please enlighten me? EDIT: Some extremely great answers here, and a few saying "more context". The specific scneario was a dbUnit test, where I could reasonalby assert that the returned set from a query had only 1 item, and I was trying to access that item. However, the question is more valid without the scenario, as it remains more focussed : What's the difference between set & list. Thanks to all for the fantastic answers below.

  Read the article

• Given a typical Rails 3 environment, why am I unable to execute any tests?

  - by Tom

  I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

  Read the article

• Reporting Services "cannot connect to the report server database"

  - by Dano

  We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

  Read the article

• template specialization of a auto_ptr<T>

  - by Chris Kaminski

  Maybe I'm overcomplicating things, but then again, I do sort of like clean interfaces. Let's say I want a specialization of auto_ptr for an fstream - I want a default fstream for the generic case, but allow a replacement pointer? tempate <> class auto_ptr<fstream> static fstream myfStream; fstream* ptr; public: auto_ptr() { // set ptr to &myfStream; } reset(fstream* newPtr) { // free old ptr if not the static one. ptr = newPtr }; } Would you consider something different or more elegant? And how would you keep something like the above from propagating outside this particular compilation unit? [The actual template is a boost::scoped_ptr.] EDIT: It's a contrived example. Ignore the fstream - it's about providing a default instance of object for an auto_ptr. I may not want to provide a specialized instance, but would like to keep the auto_ptr semantics for this static default object. class UserClass { public: auto_ptr<fstream> ptr; UserClass() { } } I may not provide an dynamic object at construction time - I still want it to have a meaningful default. Since I'm not looking at ownership-transfer semantics, it really shouldn't matter that my pointer class is pointing to a statically allocated object, no?

  Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >