Search Results

Search found 3804 results on 153 pages for 'regex'.

Page 115/153 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • Sed: regular expression match lines without <!--

    - by sixtyfootersdude
    I have a sed command to comment out xml commands sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml Takes: <a> <!-- Comment --> <b> bla </b> </a> Produces: <!-- Security: <a> --> <!-- Security: <!-- Comment --> --> // NOTE: there are two end comments. <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> Ideally I would like to not use my sed script to comment things that are already commented. Ie: <!-- Security: <a> --> <!-- Comment --> <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> I could do something like this: sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml sed 's/^[ \t]*<!-- Security: \(<!--.*-->\) -->/\1/' web.xml but I think a one liner is cleaner (?) This is pretty similar: http://stackoverflow.com/questions/436850/matching-a-line-that-doesnt-contain-specific-text-with-regular-expressions

    Read the article

  • JavaScript: add or subtract from number in string

    - by yoavf
    I have a string that looks like "(3) New stuff" where 3 can be any number. I would like to add or subtract to this number. I figured out the following way: var thenumber = string.match((/\d+/)); thenumber++; string = string.replace(/\(\d+\)/ ,'('+ thenumber +')'); Is there a more elegant way to do it?

    Read the article

  • what is the regular expression for this

    - by bn
    I want to parse this (adv) much (thanks) I want to eliminate the words and the bracket (adv) but not (thanks) the condition is: inside bracket, and word length inside bracket is 1-5 characters I am using preg_match in PHP Thank You

    Read the article

  • Elegant way to distinct Path or Entry key

    - by sum1stolemyname
    I have an application loading CAD data (Custom format), either from the local filesystem specifing an absolute path to a drawing or from a database. Database access is realized through a library function taking the drawings identifier as a parameter. the identifiers have a format like ABC 01234T56-T, while my paths a typical windows Paths (eg x:\Data\cadfiles\cadfile001.bin). I would like to write a wrapper function Taking a String as an argument which can be either a path or an identifier which calls the appropriate functions to load my data. Like this: Function CadLoader(nameOrPath : String):TCadData; My Question: How can I elegantly decide wether my string is an idnetifier or a Path to a file? Use A regexp? Or just search for '\' and ':', which are not appearing in the Identifiers?

    Read the article

  • Need to add specific characters to regular expression

    - by lordryan
    i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

    Read the article

  • Match Phrases (in array) in text string

    - by Tim Hanssen
    I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • How can I handle validation of non-latin script input in PHP?

    - by Matt
    I am trying to adapt a php application to handle non-latin scripts (specifically: Japanese, simplified Chinese and Arabic). The app's data validation routines make frequent use of regular expressions to check input, but I am not sure how to adapt the \w character type to other languages without installing additional locales on the system (which I cannot rely on). Previous developers to have worked on the app have simply added needed characters to the regexes as the number of languages we supported grew (you frequently see "[\wÀÁÂÃÄÅÆÇÈÉ... etc" in the code), but I can't really do this for all the alphabets I need to support now. Does anybody out there have some advice on how to tackle this?

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • extracting multiple fields from a text file using php

    - by Dave
    Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Regular expression to match text that doesn't start with substring?

    - by Steven
    I have text with file names scattered throughout. The filenames appear in the text like this: |test.txt| |usr01.txt| |usr02.txt| |foo.txt| I want to match the filenames that don't start with usr. I came up with (?<=\|).*\.txt(?=\|) to match the filenames, but it doesn't exclude the ones starting with usr. Is this possible with regular expressions?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • How can I improve this regular expression?

    - by Michael Haren
    I want a regular expression to match valid input into a Tags input field with the following properties: 1-5 tags Each tag is 1-30 characters long Valid tag characters are [a-zA-Z0-9-] input and tags can be separated by any amount of whitespace Here's what I have so far--it seems to work but I'm interested how it could be simplified or if it has any major flaws: \s*[a-zA-Z0-9-]{1,30}(\s+[a-zA-Z0-9-]{1,30}){0,4}\s* // that is: \s* // match all beginning whitespace [a-zA-Z0-9-]{1,30} // match the first tag (\s+[a-zA-Z0-9-]{1,30}){0,4} // match all subsequent tags \s* // match all ending whitespace Preprocessing the input to make the whitespace issue easier isn't an option (e.g. trimming or adding a space). If it matters, this will be used in javascript. Any suggestions would be appreciated, thanks!

    Read the article

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >